ID: 1103708254

View in Genome Browser
Species Human (GRCh38)
Location 12:122892044-122892066
Sequence CTAAGCGACAGTTCCTTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103708249_1103708254 -2 Left 1103708249 12:122892023-122892045 CCGGTTTAGTTGCCTAATCCCCT 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1103708254 12:122892044-122892066 CTAAGCGACAGTTCCTTTTAAGG 0: 1
1: 0
2: 0
3: 1
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103708254 Original CRISPR CTAAGCGACAGTTCCTTTTA AGG Intronic
901910965 1:12457778-12457800 CTTAGGGACAGCTCCCTTTACGG - Intronic
903090250 1:20908623-20908645 CTAAGAGACTCTTCCATTTATGG - Intronic
909734409 1:78938250-78938272 CAAAGCCACAGGTTCTTTTATGG + Exonic
917114076 1:171584228-171584250 CTATGCCACAGATCATTTTAAGG + Intronic
917499004 1:175568905-175568927 CTAAGGAAAAGTTCCTTTGAAGG + Intronic
1063153889 10:3360574-3360596 CTCAGAAACAGTTCCTTTTTGGG + Intergenic
1069021849 10:63497517-63497539 CTAAAAGACAGTTTCTTTCAGGG + Intergenic
1069029431 10:63579770-63579792 CTTAGCAACATTTCCTTTAATGG - Intronic
1073959223 10:108906936-108906958 CTTAGGGACAGTCCCTCTTATGG + Intergenic
1085307965 11:75498942-75498964 CAAAGCCAAAGTTCCTTCTATGG + Intronic
1094486895 12:30932750-30932772 CTAAAAGACAGTTCCTTCCATGG - Intronic
1095144501 12:38709570-38709592 CTAAAGGACAGGTTCTTTTATGG - Intronic
1095849714 12:46789079-46789101 CTGAGCCACAGTTCCCTATAGGG - Intronic
1103708254 12:122892044-122892066 CTAAGCGACAGTTCCTTTTAAGG + Intronic
1107271059 13:38616551-38616573 GTAAACGACATTTTCTTTTAAGG - Intergenic
1119717270 14:76867797-76867819 CTGAGCGACACTTCCTCTTTGGG - Intronic
1122022820 14:98853532-98853554 GTCAGCGGCATTTCCTTTTATGG - Intergenic
1125346651 15:38725374-38725396 CCTAGTGACATTTCCTTTTATGG - Intergenic
1134827165 16:17294120-17294142 CTAAGCAACTGTTCCTCTGAAGG + Intronic
1138862800 16:60778459-60778481 CTTAGACACAGCTCCTTTTATGG - Intergenic
1154034499 18:10786430-10786452 CTAAGGGACAGAGACTTTTAAGG + Intronic
1155079187 18:22390678-22390700 CTGAGCCTCAGTTCCTTTAATGG - Intergenic
1157593538 18:48850472-48850494 CTAAGAGACAGCTCATTTTGGGG - Intronic
1167524427 19:49974903-49974925 CTAAGCCACGGTTCCATTTTGGG + Intergenic
931872878 2:66480420-66480442 CTAAGCCAGAGTTTCTTTCAAGG + Intronic
934739483 2:96709398-96709420 GGAAGCTGCAGTTCCTTTTAGGG + Intronic
944272015 2:197794921-197794943 CAGAGCTACAGTACCTTTTAAGG + Intergenic
944445739 2:199786354-199786376 CTAAGTGACACCCCCTTTTAAGG - Intronic
945644605 2:212474974-212474996 CTAAGCGGGAGGACCTTTTAAGG - Intronic
1182535101 22:30995174-30995196 GTAAGCCACAGTACCTTTTTAGG + Intergenic
949561103 3:5203417-5203439 CTCAGAGGCAGTTCTTTTTACGG - Intronic
952573574 3:34746920-34746942 CTACTAGACAGTTCCTTTTTTGG - Intergenic
953908444 3:46880323-46880345 CTAGCAGACAGTTCCTGTTAGGG + Intronic
958737631 3:98027697-98027719 TTAAGCAACAGATCCTTTTTGGG - Intronic
962385640 3:134930146-134930168 CCAAGGGACTCTTCCTTTTATGG + Intronic
968035104 3:195541893-195541915 CCAAGCAGTAGTTCCTTTTATGG + Intronic
972095665 4:35344049-35344071 CTAGGTGACAGTACTTTTTAGGG + Intergenic
975423268 4:74195052-74195074 CTAGGTGACAGTTCTTTTTTAGG + Intronic
976838435 4:89402908-89402930 CTAGGGAACATTTCCTTTTATGG - Intergenic
977533319 4:98225880-98225902 ATAAGCAAAAGTTCATTTTATGG - Intergenic
982999921 4:162401399-162401421 CTAACTTACAGTTACTTTTAAGG - Intergenic
986774560 5:11002119-11002141 CTATGCCCCAATTCCTTTTAGGG + Intronic
989713481 5:44430103-44430125 CTATGTGAAATTTCCTTTTAAGG - Intergenic
993171927 5:84430619-84430641 CTCAGGGATAGTTACTTTTAGGG - Intergenic
995002698 5:107153995-107154017 TTAAGCTACTTTTCCTTTTATGG + Intergenic
999113889 5:149144517-149144539 CTAAGCAAGAGTTTCTATTAGGG - Intronic
1002619502 5:180477633-180477655 TTAATTGACATTTCCTTTTATGG + Intergenic
1004069028 6:12279746-12279768 ATAAGCCACAGTTTCATTTAAGG - Intergenic
1004363517 6:14992282-14992304 CTAAGGGAAACTTCCTTTTGCGG + Intergenic
1005152185 6:22764813-22764835 CTAAGAGTCAGTTCTTTTTAGGG - Intergenic
1005331885 6:24758616-24758638 CTAAAAAACACTTCCTTTTAAGG + Intergenic
1011136483 6:84106063-84106085 CTAAGTGACAGTACCTTGCAGGG - Intergenic
1012785979 6:103626301-103626323 CTAAGAGCCAGTTCAGTTTATGG + Intergenic
1024840500 7:53580843-53580865 TTAATTCACAGTTCCTTTTATGG - Intergenic
1030273939 7:107699504-107699526 CTAAGCCTCAGTTTCTTTTCTGG + Intronic
1030314138 7:108097197-108097219 ATAATCCACAGTTCCTTATATGG + Intronic
1038127892 8:24694846-24694868 CAAAGTGTCAGTTCCTTTTTTGG + Intergenic
1039322964 8:36453019-36453041 GTAAGGGACAGCTCATTTTATGG + Intergenic
1041897974 8:62948036-62948058 CTAAGCGGCAGTTGCTCATATGG - Intronic
1042547911 8:69967009-69967031 GGAAGCGGCAGTGCCTTTTATGG - Intergenic
1045849934 8:106682629-106682651 CCAAGTGACATTTTCTTTTAGGG + Intronic
1046863832 8:119124087-119124109 CTAGGCCACAGTTCCTCTCAGGG - Intergenic
1056234092 9:84574499-84574521 CTCAGAGAAAATTCCTTTTAGGG + Intergenic
1188267010 X:28089357-28089379 CTAAGCAACAATTCCTGTTCAGG + Intergenic
1197467945 X:126829314-126829336 ATAAGAGGCAGTTGCTTTTATGG + Intergenic