ID: 1103713581

View in Genome Browser
Species Human (GRCh38)
Location 12:122930172-122930194
Sequence CTGCGGGGACAGTGGGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 454}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103713572_1103713581 -3 Left 1103713572 12:122930152-122930174 CCATGGATGGCCTGCTGGATCTG 0: 1
1: 0
2: 1
3: 23
4: 214
Right 1103713581 12:122930172-122930194 CTGCGGGGACAGTGGGGGCCTGG 0: 1
1: 0
2: 5
3: 51
4: 454
1103713568_1103713581 17 Left 1103713568 12:122930132-122930154 CCGTGTGCTTCTGCAGGTTGCCA 0: 1
1: 0
2: 2
3: 24
4: 204
Right 1103713581 12:122930172-122930194 CTGCGGGGACAGTGGGGGCCTGG 0: 1
1: 0
2: 5
3: 51
4: 454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103713581 Original CRISPR CTGCGGGGACAGTGGGGGCC TGG Intronic
900096052 1:940520-940542 CTGCGGGGACTCGGGAGGCCCGG + Intronic
900146976 1:1162696-1162718 CTGCGGGGCCTGCGGGGCCCGGG + Intergenic
900169087 1:1257565-1257587 CTCCCGGGGCAGTGGGGGTCTGG - Intronic
900186872 1:1336870-1336892 CCGGGGGGACAGTGGGGCCTTGG - Intronic
900202983 1:1419626-1419648 CTGCGGGGACAGAAGAGGCCTGG - Intronic
900349754 1:2228703-2228725 CGGCGGGGGCCGGGGGGGCCCGG + Exonic
900431364 1:2604615-2604637 CTGCCGGGGCTGTGGGTGCCAGG + Intronic
900525756 1:3127811-3127833 GTGGGGGGACAGTGGGAGGCGGG + Intronic
900556769 1:3284580-3284602 CTGCAGGGAAAGGGGCGGCCAGG + Intronic
900613203 1:3553158-3553180 TTGGGGGGTCAGTGGGGGGCGGG - Intronic
900656835 1:3762790-3762812 CAGCAGGGACACTTGGGGCCTGG - Intronic
900947856 1:5841288-5841310 CTGTGGGGACCGTGGGGGCAGGG - Intergenic
901624719 1:10617483-10617505 CCGCAGGTACAGTGGGGGCTGGG - Intronic
901654566 1:10762055-10762077 CTCCGGGGACTCTGAGGGCCGGG - Intronic
901759068 1:11459064-11459086 GTGAGGGGGAAGTGGGGGCCAGG - Intergenic
902234638 1:15049482-15049504 CTGCTGTGACACTGGGGGGCTGG - Intronic
902514293 1:16981419-16981441 CTGCGGGGCCAAGGGGGGACTGG - Intergenic
903597075 1:24503003-24503025 CTGCGGGGCCTCTGGGAGCCTGG - Exonic
904450174 1:30605995-30606017 CTGTGGGGGCTGTGGGAGCCAGG + Intergenic
905449008 1:38045439-38045461 CGGCGGGGGCGGTGGGGGCGCGG + Exonic
905631696 1:39522380-39522402 CTGCAGGGACAGAAGGGGCAAGG - Intronic
905666057 1:39763792-39763814 CTGCAGGGACAGAAGGGGCAAGG + Exonic
905959923 1:42035441-42035463 CTGGCGCGACAGCGGGGGCCGGG - Intronic
906516358 1:46441071-46441093 CTGCAGGGACAGTGAGGGATGGG - Intergenic
908738981 1:67307911-67307933 CTGCGGGGACCGGGTGGCCCCGG - Exonic
909562720 1:77024071-77024093 CTGCTTGGTCAGTGTGGGCCTGG + Intronic
911288537 1:96027929-96027951 CTGCAGGAACAGTGTGGGGCAGG - Intergenic
912381401 1:109249875-109249897 CTCAGGGGGCAGTGGGAGCCCGG + Intergenic
912659717 1:111516612-111516634 CTGCTGGGTGAGTGGGGCCCAGG + Intronic
913198249 1:116475643-116475665 CTGAGAGAACTGTGGGGGCCAGG + Intergenic
916694313 1:167221068-167221090 CGGCGGGGAGATGGGGGGCCGGG + Intronic
919751111 1:201038828-201038850 CTGTGGGGACATGGAGGGCCCGG + Intergenic
919816402 1:201443514-201443536 ATGCAGGAAAAGTGGGGGCCAGG + Intergenic
920060276 1:203222543-203222565 CTGAGGGGACAGTGGGGTGAGGG - Intronic
920288787 1:204901686-204901708 CCGAGGGGAGAGTGGGGGCAAGG + Intronic
921537915 1:216374980-216375002 CTGAGGGGAGAGAGTGGGCCTGG - Intronic
922493869 1:226040789-226040811 CTCTGTGGAGAGTGGGGGCCTGG - Intergenic
923007952 1:230067201-230067223 CCGCGGGCGCGGTGGGGGCCGGG - Exonic
923021611 1:230168438-230168460 CTCCGGGGACAGGAGGGGCAAGG - Intronic
1062885336 10:1011782-1011804 CCGCGGGGACAGTGAGGGCACGG - Intronic
1062961284 10:1575518-1575540 CTGCCGGGTCAGAGGGGCCCTGG + Intronic
1063929967 10:11018469-11018491 CCGCGGGGTGAGTGGGGGACGGG + Intronic
1064329368 10:14379350-14379372 CTGCGGGTAAAGTGGTGGCCAGG - Intronic
1065553064 10:26888465-26888487 CTGCAGGGACAGTGAGGCCAGGG - Intergenic
1067110505 10:43396832-43396854 CAGCGGGGAGAGTGGGGGCAGGG + Intronic
1068637392 10:59362666-59362688 CTGCGGGGACAGAGCTGGGCGGG + Intronic
1069567774 10:69474934-69474956 CAGCGGGGTCTGGGGGGGCCTGG + Intronic
1070151992 10:73811096-73811118 CTGCGGGCGCCGAGGGGGCCCGG + Intronic
1070167711 10:73911164-73911186 CTGCGGGGACAGGTGGACCCTGG - Exonic
1070289124 10:75103464-75103486 CTCAGGGGACAGTGGGGCCTGGG - Intronic
1070554756 10:77518921-77518943 ATGCGTGGACAGTGGGTGCTGGG - Intronic
1070815201 10:79318486-79318508 CAGCAGGGACAGTGGGGAGCTGG - Intergenic
1070948591 10:80413120-80413142 GAGGGGGGACAGTGGGGGACAGG - Intronic
1071290567 10:84185849-84185871 CTCTGGGGACAGTGGTGCCCAGG + Intergenic
1071290575 10:84185873-84185895 CTCTGGGGACAGTGGTGCCCAGG + Intergenic
1071469915 10:85976679-85976701 CTGCAGGGACACTGGGGAACTGG - Intronic
1071495912 10:86167520-86167542 CTGTGGGGACAGTGGTTGCTGGG + Intronic
1072228571 10:93393221-93393243 TCCCGGGGACAGAGGGGGCCTGG + Intronic
1075023688 10:118968601-118968623 CAGCGGGAACAGGAGGGGCCAGG + Intergenic
1075269734 10:121038237-121038259 TTGCAGGGGCTGTGGGGGCCAGG + Intergenic
1075788828 10:125068881-125068903 CTGAGGGGAGAGTGGGGCCTCGG - Intronic
1076362675 10:129900504-129900526 CTCCAGGGACAGAGGAGGCCTGG + Intronic
1076687479 10:132204597-132204619 CTGCGGGGACTGTGGGCTGCAGG - Intronic
1076778662 10:132711774-132711796 CCCCAGGGACAGTGGTGGCCTGG - Intronic
1076801947 10:132835011-132835033 CTGTGGGGACAGCCGGGCCCAGG + Intronic
1076849952 10:133087892-133087914 CCGCGGCGACAGCGGGGACCCGG - Exonic
1076887888 10:133270903-133270925 CTGCTGGGCCAGTGTGGGACAGG + Exonic
1077366688 11:2164098-2164120 GTGCAGGGGCAGTGGGAGCCTGG + Exonic
1077368233 11:2169863-2169885 CCGCGGGGACTGTGGGGACAAGG + Exonic
1077392940 11:2308358-2308380 CTGCGGGGCCTGGTGGGGCCTGG - Intronic
1078159491 11:8828442-8828464 CTGCGGGGAAGCTGGGGGTCAGG + Intronic
1079136057 11:17776627-17776649 CTGTGGGTCTAGTGGGGGCCTGG + Intronic
1080706582 11:34701283-34701305 CTGTGGGGCCCGTGGGAGCCAGG + Intergenic
1081630778 11:44688252-44688274 CTGCGTGGGCAGCTGGGGCCAGG - Intergenic
1081814511 11:45930929-45930951 CTGAGGGGACAGTGAAGGACAGG + Intronic
1081980069 11:47260707-47260729 CTGAGGGGAAAGAGGGGGCCAGG + Intronic
1083266063 11:61547373-61547395 CTGCGGGGGCAGAAGGGACCAGG + Intronic
1083293985 11:61705436-61705458 ATGTGAGGACAGTGGAGGCCTGG - Intronic
1083428462 11:62601615-62601637 CGGCGGCGACAGCGCGGGCCGGG - Exonic
1083429393 11:62606088-62606110 CGGCTGGTACAGTGGGGGCCCGG - Exonic
1083680342 11:64348841-64348863 CTGGGGGGGCAGGGGGCGCCAGG - Intronic
1083849136 11:65355108-65355130 CCGCGGGGAGGGTGGTGGCCTGG - Intronic
1083852990 11:65378718-65378740 CTGGGGTGTCAGTGGGTGCCGGG + Intronic
1084083301 11:66843146-66843168 CTGCGGGAACAAGGGGGCCCGGG - Intronic
1084534039 11:69746356-69746378 GTGTGAGGACAGTGAGGGCCAGG + Intergenic
1084937432 11:72594661-72594683 CTGAGGGGAGAGTGTGGTCCTGG - Intronic
1084960233 11:72712635-72712657 CTGTGTGGACAGAGGGGGCGTGG - Intronic
1085695954 11:78704960-78704982 CTGCAGGGACAGAGGGAGCTGGG - Intronic
1085984777 11:81772330-81772352 CTGCAGGGAGAGTGGGTGGCTGG + Intergenic
1086150721 11:83607439-83607461 CAGCGGGGACAGTGGGTACTGGG - Intronic
1089671883 11:120062426-120062448 CTGCAGTGACAGAGGAGGCCCGG + Intergenic
1089790121 11:120936848-120936870 CTGGGGGGCAGGTGGGGGCCAGG - Intronic
1089800629 11:121024204-121024226 CGGCGGCGACAGCGGTGGCCGGG + Exonic
1093702309 12:22235809-22235831 CTGAGGGGACAGAGAGGACCTGG - Intronic
1094107928 12:26833202-26833224 CTGAGGGGACCGAGGGGGCTCGG - Intergenic
1096563241 12:52451937-52451959 CTCCAGGGGCAGTGGTGGCCTGG - Exonic
1096565393 12:52473596-52473618 CTCCAGGGGCAGTGGTGGCCTGG - Exonic
1096567413 12:52493047-52493069 CTCCAGGGGCAGTGGTGGCCTGG - Exonic
1096647853 12:53048004-53048026 CTTCGGAGAGAGAGGGGGCCCGG + Intronic
1096650337 12:53059285-53059307 CGGAGTGGCCAGTGGGGGCCGGG + Exonic
1096981049 12:55728499-55728521 CTGCGGGTAAAGAGGGGGCTGGG - Intronic
1097182403 12:57178900-57178922 CTGTGAGGCCAATGGGGGCCAGG + Exonic
1097905883 12:64919330-64919352 CTGCTGGTACAGTGGGTGCTTGG + Intergenic
1098703962 12:73664543-73664565 CTGTGGAGTCACTGGGGGCCAGG - Intergenic
1098914107 12:76239681-76239703 CTGCGGGGAGGGTGGGGGTCGGG + Intergenic
1101409575 12:104457376-104457398 CTGCGGGGACCGGGGTGTCCGGG - Exonic
1101518556 12:105460210-105460232 CTGCGGCGGGGGTGGGGGCCAGG + Intergenic
1101813711 12:108129630-108129652 CAGCGGCGACAGCGGTGGCCGGG - Intronic
1102432865 12:112897270-112897292 CTCAGGGGGCAGTGGGAGCCCGG - Exonic
1102521261 12:113478709-113478731 CTGGGGGAAGAGTGGGGGCCTGG - Intergenic
1103505330 12:121439211-121439233 GTGTTGAGACAGTGGGGGCCGGG - Intronic
1103713581 12:122930172-122930194 CTGCGGGGACAGTGGGGGCCTGG + Intronic
1104623804 12:130337552-130337574 GGGCGGGGCCTGTGGGGGCCTGG + Intergenic
1104676861 12:130716997-130717019 CTGCGGGGCCACTGGAGGCTTGG - Intergenic
1104945111 12:132412227-132412249 CTGGGGTGTCAGTGGGGGCCTGG + Intergenic
1104945214 12:132412552-132412574 CTGGGATGTCAGTGGGGGCCTGG + Intergenic
1104945303 12:132412841-132412863 CTGGGATGTCAGTGGGGGCCTGG + Intergenic
1104945335 12:132412932-132412954 CTGGGGTGTCAGTGGGGGCCTGG + Intergenic
1104945358 12:132413005-132413027 CTGAGGTGTCAGTGGGGGTCTGG + Intergenic
1104945393 12:132413098-132413120 CTGGGGTGTCAGTGGGGGCCTGG + Intergenic
1104945406 12:132413135-132413157 CTGGGATGTCAGTGGGGGCCTGG + Intergenic
1104945437 12:132413226-132413248 CTGGGATGTCAGTGGGGGCCTGG + Intergenic
1104945469 12:132413317-132413339 CTGGGGTGTCAGTGGGGGCCTGG + Intergenic
1104945493 12:132413390-132413412 CTGAGGTGTCAGTGGGGGTCTGG + Intergenic
1104945528 12:132413483-132413505 CTGGGGTGTCAGTGGGGGCCTGG + Intergenic
1104945541 12:132413520-132413542 CTGGGATGTCAGTGGGGGCCTGG + Intergenic
1104945591 12:132413665-132413687 CTGGGGTGTCAGTGGGGGCCTGG + Intergenic
1104945612 12:132413721-132413743 CTGGGGTGTCAGTGGGGGCCTGG + Intergenic
1104945626 12:132413760-132413782 CTGAGGTGTCAGTGGGGGTCTGG + Intergenic
1104945633 12:132413779-132413801 CTGGGGTGTCAGTGGGGGTCTGG + Intergenic
1104968236 12:132519264-132519286 CTTAGGGGACTGTGGGAGCCTGG + Intronic
1105071288 12:133235742-133235764 GCGCGGGGGCAGGGGGGGCCTGG - Exonic
1105578507 13:21673967-21673989 CTGCGGGGACCACGGGGGCCGGG + Intronic
1105696785 13:22897406-22897428 CTGCGGAGGCTGTGGGGGCCCGG + Intergenic
1106193747 13:27476131-27476153 ATGAGAGGACACTGGGGGCCTGG - Intergenic
1106398678 13:29406489-29406511 CTGGGGGTACAGTGGGGGTGAGG - Intronic
1106539135 13:30674385-30674407 CGGCGGGGACCGTGCCGGCCGGG + Intergenic
1106564201 13:30871132-30871154 CTGAGAGGACAGCGGGGGCCTGG + Intergenic
1111951695 13:94713203-94713225 CAGCGAGGACAGAGGGGCCCCGG - Intergenic
1112299034 13:98213543-98213565 CAGCGGGGCCATTGGGGGGCGGG - Intronic
1112652723 13:101416359-101416381 CGGCGGCGACAGTGGGCGACCGG + Intronic
1113458495 13:110465566-110465588 CTGCGGGGCCAGGAGGGCCCAGG - Exonic
1113724553 13:112588304-112588326 CTGCGCGGACAGAGCGGCCCCGG + Intergenic
1113948747 13:114059587-114059609 CTGCGGGCACAGAGGGCGCTCGG + Intronic
1114614096 14:24059256-24059278 CTGCAGGGACTGTGTGGGCAAGG - Exonic
1119738832 14:77000756-77000778 CTGCAGGGATAGGAGGGGCCCGG - Intergenic
1120921942 14:89763417-89763439 GTGTGGGGACAGTGGGGGAAGGG - Intergenic
1121007664 14:90500646-90500668 ATGTGAGCACAGTGGGGGCCTGG + Intergenic
1122156459 14:99753212-99753234 GTGCGGGGGCAGTGGGGGGTGGG - Intronic
1122634470 14:103123593-103123615 CGGCGGGGACAGGAGGGGGCTGG + Exonic
1122692644 14:103538503-103538525 CTGCGGGAGCGGTGGTGGCCTGG + Intergenic
1122772351 14:104103038-104103060 CAGTGGGCACAGTGGGTGCCTGG + Intronic
1122783703 14:104154423-104154445 CTGCGGCCACAGGTGGGGCCTGG + Intronic
1122836716 14:104434255-104434277 CCTCGGGGACAGTGTGGGGCAGG - Intergenic
1122854795 14:104554854-104554876 CTGCCTGGACTGTGAGGGCCTGG + Intronic
1122871557 14:104641187-104641209 CAGTGGGGACGGTGGGGGCTGGG - Intergenic
1123039958 14:105486451-105486473 CTGCGGGGGCTGCGGGGGCTGGG - Intergenic
1123790061 15:23711134-23711156 CTGGAGGGACAGTGGAGGGCAGG - Intergenic
1124426902 15:29570453-29570475 CTCCGGGGACTGCGCGGGCCGGG - Intronic
1124685167 15:31776399-31776421 CTGTGGGGAGAGTGGGAGCAAGG + Intronic
1124937508 15:34186670-34186692 CTGCAGGGACAGTGGGGAGGGGG - Intronic
1125536284 15:40442289-40442311 CCCCGGGGACTGCGGGGGCCGGG + Intronic
1125758480 15:42081757-42081779 CTGTGGGGACAGTGAGAGGCGGG - Intronic
1126131751 15:45348508-45348530 CTGGGGTGGCAGTGGGGCCCAGG + Intergenic
1126736638 15:51737590-51737612 CCGCAGGGACAGTGCGGGCGAGG + Exonic
1128388138 15:67165107-67165129 CTGTGGGGACAGCAGGTGCCAGG + Intronic
1128740708 15:70082080-70082102 CTGCTGGGAAGGTTGGGGCCAGG - Intronic
1128761359 15:70218120-70218142 CTCCAGGGGCAGTGGGGTCCAGG - Intergenic
1129242744 15:74261310-74261332 CAGAGGGAACAGTGAGGGCCGGG + Intronic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1129519741 15:76178142-76178164 CTGCTGGGACAGAGGAAGCCTGG + Intronic
1129853943 15:78811195-78811217 CTGCGGGGACTGGGGCCGCCGGG + Exonic
1131074548 15:89486986-89487008 CTGCGGGGACAGTGCAGCCCGGG + Intronic
1131825752 15:96321814-96321836 CTGCCGGGAGAGTGGGTTCCAGG - Intergenic
1132358268 15:101189828-101189850 GCGCTGGGACAGTGGAGGCCTGG + Intronic
1132464904 16:72783-72805 CTGCGGGGACACCTGGGGCTGGG + Intronic
1132724016 16:1331104-1331126 CTCCGGGGACAGTGAGGGGATGG - Intergenic
1132855501 16:2042917-2042939 CTGCGGGGACAGGAGGGGAATGG - Intronic
1132909276 16:2299972-2299994 CTGTGGGGACAGGGAGGGCCGGG - Intronic
1132934893 16:2475225-2475247 CCGCGGTGACAGCGGGGACCCGG - Intronic
1132988199 16:2778966-2778988 GAGTGTGGACAGTGGGGGCCAGG + Intergenic
1133233736 16:4378325-4378347 CTGCGGCCACAGTGGTGGCCAGG + Intronic
1133917944 16:10125930-10125952 CTGCAGGAAAACTGGGGGCCAGG + Intronic
1135345455 16:21685128-21685150 CTGCAGGGAATGAGGGGGCCGGG + Intronic
1136043144 16:27596048-27596070 CTCTGGGGGCAGTGGGAGCCAGG + Intronic
1136109090 16:28053454-28053476 CTGGGAGGACAGAGGGGGACTGG + Intronic
1137057003 16:35750742-35750764 GTGGTGGGAAAGTGGGGGCCAGG - Intergenic
1138178806 16:54929117-54929139 CGGCGGGGACCGTGGGGCCGAGG - Intergenic
1138542924 16:57699276-57699298 CTGCGGGGAAACTGCAGGCCTGG + Intronic
1139594884 16:67951685-67951707 CTGGGAGGACACTGGGGGGCTGG + Intronic
1139966899 16:70750775-70750797 GTGTTGGGACAGTGAGGGCCTGG - Intronic
1141638641 16:85328887-85328909 CTGCGGGGGCAGGGGTGGCAGGG - Intergenic
1141684304 16:85561671-85561693 CTCCGGGGGCAGCTGGGGCCGGG - Intergenic
1142403127 16:89871460-89871482 CTGCGTGGACAGAGCAGGCCTGG - Intergenic
1143323163 17:6080947-6080969 CTCCGGAGCCAGCGGGGGCCGGG - Exonic
1143516234 17:7420556-7420578 CTGGTGGGATAGTGGGGGGCAGG + Intronic
1143563200 17:7707190-7707212 GTGCTGGGACAGTGGATGCCTGG + Intronic
1144033140 17:11340346-11340368 CTGTGGGGACAGCTGGGGCTGGG + Intronic
1145279429 17:21457099-21457121 CTGCGGGGAGGGGCGGGGCCCGG - Intergenic
1145351861 17:22090691-22090713 CTGCGGGGGAAGTGGGAGACAGG - Intergenic
1147551418 17:41445184-41445206 CAGCTGGGACCGTGGGGCCCTGG - Intergenic
1147671138 17:42177594-42177616 CTGGGGGCCCAGTGGGGGCTGGG + Intronic
1148094692 17:45044239-45044261 CTGTGGGGACATTGGGGCACAGG - Intronic
1148192068 17:45686242-45686264 ATGCAGGGACAGTGGCAGCCAGG - Intergenic
1148755606 17:49971572-49971594 CTGCTGGGAGAGTTGGGGCGCGG + Intronic
1148977993 17:51546355-51546377 CTGCAGGGGCACTTGGGGCCTGG + Intergenic
1149537298 17:57442791-57442813 CTGCCGGCACGCTGGGGGCCTGG + Intronic
1151010237 17:70484680-70484702 CTCAGTGGAGAGTGGGGGCCCGG + Intergenic
1151370842 17:73645223-73645245 CTGCGGGGGCAGCGTGAGCCGGG + Intergenic
1151555028 17:74842524-74842546 CTACAGAGACAGTGGGGGACTGG - Exonic
1151570655 17:74923827-74923849 CTGCGAGGACCGTGGGGGAGAGG + Intergenic
1151727721 17:75894291-75894313 ATTCGGGGACAGAGGAGGCCTGG - Intronic
1151955369 17:77377569-77377591 CTCGGGCGACAGTGGGGGCTCGG - Intronic
1151961793 17:77409502-77409524 CTGCGGGGAAGGGTGGGGCCAGG + Intronic
1152317614 17:79590037-79590059 CTGCAGGGGCGGTGGGGGACCGG + Intergenic
1152587360 17:81195033-81195055 CTGTGGGCACAGTCAGGGCCGGG + Intronic
1152617570 17:81345057-81345079 CTGCGGGGTCCGAGGAGGCCGGG - Intergenic
1152717262 17:81906084-81906106 CTGCCGGGTGAGTGGGGGCCAGG - Exonic
1152878834 17:82803990-82804012 GTTAGGGGAGAGTGGGGGCCGGG + Intronic
1154376769 18:13817269-13817291 ATGAGGGGACAGTGGCGGCCTGG - Intergenic
1154437413 18:14357568-14357590 GGGCGGGGACAGTGGGTGCTGGG - Intergenic
1155053070 18:22165068-22165090 CTGCGGGGCCAGGGAGTGCCAGG - Intergenic
1157413590 18:47484081-47484103 CTGCAGGGACAGAGGGCTCCTGG + Intergenic
1157620893 18:49016984-49017006 CTGAGGGGCCAGGGGTGGCCTGG - Intergenic
1160542850 18:79634590-79634612 TTGGGGGCACAGTGGGGGCGAGG - Intergenic
1160543888 18:79640272-79640294 CTGAGTGGAAAGTGGGGGACTGG + Intergenic
1160585457 18:79911231-79911253 CTGAGGGGCCAGTGGGGGCCTGG + Intronic
1160710323 19:548455-548477 CAACGGGCACAGTGGGGGCCGGG + Intronic
1160710935 19:550685-550707 CTGGGGTGACAGTGGGGACAGGG - Intergenic
1160711000 19:550897-550919 CTGGGGTGACAGTGGGGACAGGG - Intergenic
1160731669 19:644097-644119 CTGTGAGGACACTGGGGCCCTGG - Intergenic
1160767732 19:815852-815874 CTGTGGGGACAAGGTGGGCCAGG + Intronic
1160851439 19:1194770-1194792 CTGCGGGGCCAGTGCGTGCGAGG + Intronic
1160939880 19:1615269-1615291 GTGCGAGGTCAGTGGGGGCGCGG - Exonic
1160984589 19:1832452-1832474 CTGCAGGGACAGCGGGAGGCCGG + Intronic
1160992282 19:1864627-1864649 CTGCTGGGACACCGGGGTCCGGG + Intergenic
1160992478 19:1865361-1865383 CTGCTGGGATGGTGGGGACCTGG - Intergenic
1161080645 19:2308319-2308341 GTGCGGGGACACTGGGAGCGCGG + Intronic
1161164959 19:2781786-2781808 CAGCTGGGACTGTGTGGGCCCGG - Intronic
1161282259 19:3452459-3452481 CTGCGGAGACAGTGGGAAGCGGG - Intronic
1161395759 19:4044129-4044151 CTGCAGGGAAGGTGGGGGACAGG - Intergenic
1161447070 19:4324423-4324445 CTGCGGGGTCAGTGCGGGGCGGG - Intronic
1161454543 19:4363474-4363496 CTGTGGGGACAGTAGGGCTCAGG + Intronic
1161502325 19:4623183-4623205 CCTCGGGGACACTGGGGGCGGGG + Intergenic
1161590748 19:5128138-5128160 CAGCCGGGGCTGTGGGGGCCAGG - Intronic
1161738720 19:6007352-6007374 CAGCGTGGACAGTGAGGGACAGG - Intronic
1161841258 19:6682063-6682085 CTGCAGGGAGAGAGGGGTCCAGG - Intronic
1162019402 19:7861855-7861877 CTGCGGGAAGAGTGGGGTCAGGG - Intronic
1162131769 19:8530366-8530388 CTGCGGGGACAGAGGGTGGAGGG + Intronic
1162818384 19:13209180-13209202 GAGAGGGGACAGAGGGGGCCAGG - Intronic
1163005723 19:14395739-14395761 CTGCCCGGACAGTGGGCACCAGG - Intronic
1163062099 19:14768267-14768289 CTGCCTGGACAGTGGGTCCCAGG + Intronic
1163125277 19:15241105-15241127 CTGCGGGGACAGGATGGGCCTGG - Intronic
1163441237 19:17323658-17323680 CTGGGGGGCGGGTGGGGGCCCGG + Exonic
1163820464 19:19493715-19493737 GCGCGGGGGCAGTGGGGGCAGGG - Intronic
1163826637 19:19527984-19528006 CTGTGGGGACAGTGGGGTATGGG - Intronic
1163851907 19:19669044-19669066 CCGCGGCGACTGTGGGGGTCTGG + Intronic
1163875750 19:19866162-19866184 CTGCGGTGACATCCGGGGCCCGG + Intronic
1164065242 19:21709310-21709332 CCGGGAGGACAGTGGGGCCCAGG - Intergenic
1164449726 19:28350489-28350511 GTCCGGGGACAATGGTGGCCTGG - Intergenic
1165213896 19:34255191-34255213 CCGCGGGGACCGGGAGGGCCGGG + Intronic
1165432902 19:35782531-35782553 CTGGCGGGACGGAGGGGGCCGGG + Intronic
1165444438 19:35849188-35849210 ATGGGGGGACAGTGGGGTCTGGG - Intronic
1165827372 19:38712960-38712982 CTGAGGGGGTAGTGGAGGCCCGG + Intronic
1165950761 19:39472935-39472957 CTGCGAGGCCTGTGGAGGCCTGG + Intronic
1166053350 19:40274241-40274263 CTGGGGACACAGTGGGGGCTAGG - Intronic
1166091817 19:40514262-40514284 CTGCAGGCACAGTAGGGGCAAGG - Intronic
1166301522 19:41914204-41914226 GTGTGGGAACAGAGGGGGCCTGG - Intronic
1167094838 19:47369635-47369657 CGGTGGGCACAGTGGGGGCTGGG + Intronic
1167258064 19:48442889-48442911 CGGCGGGGACAGCGGGCGCCCGG - Exonic
1167328417 19:48838813-48838835 CAGCTGGCACAGTGGGGACCCGG + Intronic
1167466486 19:49653185-49653207 CAGCGGGGGCAGTGGTGGCCAGG + Exonic
1167601793 19:50459088-50459110 CTGCGGGGAGAGGGCGGGGCGGG - Intronic
1168103269 19:54152405-54152427 CTGTGGGGAGGGTGGGGGTCCGG - Intronic
1168240270 19:55085725-55085747 CTGGGGGCACAGCAGGGGCCGGG - Intronic
1168257498 19:55174775-55174797 CTTCGGGGACAGGGAGGACCTGG - Intronic
1168259614 19:55186076-55186098 CTGGGGGGAGAGTGGGGAACAGG + Intronic
925846917 2:8043039-8043061 CTGCAGGGACAGAGGGGCCATGG + Intergenic
926101706 2:10122418-10122440 CCGCGGGACCTGTGGGGGCCTGG + Exonic
927100424 2:19783773-19783795 GTGTGGGGGCAGTGGGGGCAGGG - Intergenic
927181096 2:20447281-20447303 CGGCGGGGGCGGTGGGGGCGCGG - Exonic
927211571 2:20642178-20642200 CTGTGGGCACAGTCCGGGCCTGG - Intronic
928194575 2:29205989-29206011 CTGAGGGGCCAGTGGGGGCCAGG + Intronic
928511908 2:32010540-32010562 CAGCGGGGACGCCGGGGGCCGGG - Exonic
929075631 2:38076851-38076873 CTGGGGCGACTGGGGGGGCCTGG + Intronic
929624929 2:43396659-43396681 CTGTGGGGACAGGGGGGTGCAGG + Intronic
929647072 2:43637898-43637920 CTTCGGGGACAGTGGTTTCCGGG - Intronic
930988498 2:57620301-57620323 CCGAAGGGACAGAGGGGGCCTGG - Intergenic
932408007 2:71526773-71526795 CTGTGAAGACAGTGGGGCCCAGG - Intronic
932567200 2:72917563-72917585 GTGCGGGGACACCGGGGGCTGGG + Exonic
932880075 2:75493162-75493184 CTGCAGGGACAGTGGGCACAAGG - Exonic
933573527 2:84040760-84040782 CTATGGGGATAGTGGGGGTCAGG + Intergenic
933766721 2:85714232-85714254 CTGCTGGGAAGGTGGGGGCGTGG + Intergenic
934527723 2:95062000-95062022 CTGCCCAGACAGTGGGTGCCAGG + Intergenic
935217835 2:100988748-100988770 CTGGAGGAGCAGTGGGGGCCTGG - Intronic
935217866 2:100988840-100988862 CTGGAGGAGCAGTGGGGGCCTGG - Intronic
935217886 2:100988896-100988918 CTGGAGGAACAGTGGGGGCCTGG - Intronic
935217921 2:100988988-100989010 CTGGAGGAGCAGTGGGGGCCTGG - Intronic
935592465 2:104855352-104855374 CGGCGGGGCCGGCGGGGGCCCGG + Intergenic
935991129 2:108719850-108719872 CTGGGGGGACAGCGGTGGGCGGG + Intronic
936064360 2:109319376-109319398 CTGTGGGCTCAGTGGGGTCCCGG + Intronic
936182000 2:110275106-110275128 CTGGGACCACAGTGGGGGCCTGG + Intergenic
936230569 2:110696567-110696589 CTGGGACCACAGTGGGGGCCTGG - Intergenic
937505237 2:122529306-122529328 CTGAGGGGAAAGTGGTGGCCTGG - Intergenic
938034760 2:128027266-128027288 CTGCGAGCACAGCGGCGGCCGGG - Exonic
938716963 2:134029729-134029751 CTGCAAGGATCGTGGGGGCCTGG - Intergenic
939609210 2:144289565-144289587 CAGTGGGGATAGTGAGGGCCGGG + Intronic
940454026 2:153873198-153873220 CTGCGGGGTCAGTGGGGACGCGG + Intronic
942194080 2:173499622-173499644 CTGCCGTGACATTGGTGGCCTGG + Intergenic
942453286 2:176121896-176121918 CAGCACGGACAGTGGCGGCCAGG - Intergenic
943260701 2:185658333-185658355 CTGAAGGGACAGTGGGGGAGTGG - Intergenic
944731451 2:202521697-202521719 CTGTGGGGACAGTATGAGCCTGG + Intronic
945169068 2:206977149-206977171 CTGCAGGGAAATTGGGGGACAGG - Intergenic
945314912 2:208360678-208360700 CTGTGGTGAAGGTGGGGGCCAGG + Intronic
945833210 2:214809976-214809998 CGCCGGGGACAGAGGGGGCGGGG + Intergenic
945948079 2:216013423-216013445 GTGCGGGGACAGCGGCAGCCCGG + Exonic
946410945 2:219514902-219514924 CTGCGCAGTCCGTGGGGGCCTGG - Exonic
946411330 2:219516742-219516764 CTGCAGGCATGGTGGGGGCCAGG - Intronic
946865558 2:224038957-224038979 CTGCGGGGCCAGCGGGACCCTGG - Intronic
947087496 2:226471769-226471791 CTCAGGGCCCAGTGGGGGCCAGG + Intergenic
947525216 2:230873382-230873404 ATGCTGGGTCAGTGGGGGCCAGG - Intronic
948626849 2:239274820-239274842 CTGGGAGGAGCGTGGGGGCCAGG - Intronic
948777352 2:240296676-240296698 CTGCTGGGGCAGGGAGGGCCAGG + Intergenic
948867257 2:240782387-240782409 CTGCGGGGACGGAGGGCGTCCGG - Intronic
949041507 2:241851967-241851989 CTGCAGGGACAATAGGAGCCAGG - Exonic
1168949581 20:1787439-1787461 CTGCGTGCACCGTGGAGGCCAGG + Intergenic
1169145333 20:3248620-3248642 CTGCGCGGCCAGCGGGGGCCCGG + Intergenic
1170470630 20:16664560-16664582 CTGTTGGGACAGTGGGATCCTGG + Intergenic
1171193765 20:23180772-23180794 CTGATGGGACACTGGGGCCCAGG + Intergenic
1172132252 20:32663810-32663832 CTCCGGGGACAGTGTGGTGCAGG - Intergenic
1172944839 20:38679052-38679074 CTGAAGGGACAGTGTGGTCCTGG + Intergenic
1172948501 20:38706576-38706598 CAGAGGGGACAGTGGGGGCAGGG + Intergenic
1172980359 20:38937062-38937084 GTGCAGGAACAGTGGGGTCCTGG + Intronic
1173872314 20:46349889-46349911 GGGAGGGGACAGTGTGGGCCTGG - Exonic
1173974429 20:47176448-47176470 CAGCGTGGGCAGTGGTGGCCAGG + Intronic
1174287265 20:49482496-49482518 CTGGGGGGGCAGGGGGGGCGGGG - Exonic
1174362981 20:50040131-50040153 CTCCGGGGACAGGGAGGGGCAGG - Intergenic
1174905222 20:54543313-54543335 CTTCGTGGACAGTGGGGGGTGGG + Intronic
1175323684 20:58107695-58107717 CTGAGGGGTCAGCAGGGGCCAGG - Intergenic
1175470261 20:59222413-59222435 CGGCGGGGGCGGAGGGGGCCCGG - Intronic
1175983434 20:62752767-62752789 GAGCGGGGACAGGGGAGGCCAGG - Intronic
1175992512 20:62796751-62796773 CGGCGGGGAGCGTGGGGGCGAGG - Intronic
1176102502 20:63370886-63370908 GGGCGGGGGCATTGGGGGCCCGG - Intronic
1176131574 20:63498800-63498822 CCGCGGGGACCCTGCGGGCCGGG - Intronic
1178839918 21:36130174-36130196 CAGCGGGGACGCCGGGGGCCGGG + Intergenic
1178902310 21:36607131-36607153 GGGAGGGGACAGTGGAGGCCTGG - Intergenic
1179044064 21:37829512-37829534 CTGCTGGGTGTGTGGGGGCCAGG + Intronic
1179988150 21:44932462-44932484 CTGCGGGGCCAGAGTGGGCTGGG + Intergenic
1179997933 21:44982415-44982437 TCACGGGGACAGCGGGGGCCTGG + Intergenic
1180051116 21:45331506-45331528 CCACGGGGACAGTGGGAACCGGG - Intergenic
1180064247 21:45404941-45404963 CTGCGAGGACGGGGCGGGCCGGG - Intergenic
1180081106 21:45488030-45488052 TGGAGGGGACAGTGGGGGCAGGG - Intronic
1180089802 21:45528075-45528097 CAGTGGGGACAGTGGAGGCTCGG + Intronic
1181053039 22:20246647-20246669 CCCCAGGAACAGTGGGGGCCAGG - Intronic
1181133696 22:20749704-20749726 CTGTGGGGCCAGTGCTGGCCAGG - Intronic
1181174790 22:21029320-21029342 CTGATGGGTGAGTGGGGGCCAGG - Exonic
1182122529 22:27797171-27797193 CTACGGCGGCGGTGGGGGCCCGG - Exonic
1183098341 22:35568061-35568083 CTGAGGGCTCAGTGGGGGCGGGG - Intergenic
1183326768 22:37198775-37198797 CTGCGGGGACTGCGGGGGTTTGG - Intronic
1183691599 22:39392765-39392787 GTGTGGGGACAGTGGGGGCCAGG - Intergenic
1184152840 22:42648655-42648677 TTGCAGGGTCAGTGGGAGCCTGG + Intronic
1184512024 22:44939529-44939551 CTGTGAGCACAGTGGGGACCAGG + Intronic
1184651153 22:45920037-45920059 CTGCGGGGACAGGAGGGCCATGG - Intergenic
1184680980 22:46071991-46072013 GCGCGGGGACAGCGTGGGCCCGG - Intronic
1184689277 22:46110133-46110155 CTGGGGGACCTGTGGGGGCCAGG + Intronic
1184797696 22:46741404-46741426 CTCCGTGGACAGGAGGGGCCGGG - Intergenic
1184854198 22:47137608-47137630 CTGCAGGGACAGTGGTGGAGAGG - Intronic
1185054286 22:48569941-48569963 GTGCGGGGGCACTGGCGGCCAGG - Intronic
950669873 3:14519601-14519623 CAGAGGGCACAGTTGGGGCCAGG - Intronic
950792080 3:15480113-15480135 CTGGGGTTGCAGTGGGGGCCTGG - Intronic
951566991 3:24020465-24020487 CTGTGGAGCCAGTGGGGGCCAGG - Intergenic
952796470 3:37243436-37243458 CACCAGGGACAGCGGGGGCCGGG - Exonic
952885795 3:38010276-38010298 CTGCGGGGAGGGTGGTGGCTAGG + Intronic
953431944 3:42847303-42847325 CTGAGTGGCCAGCGGGGGCCAGG + Intronic
953875111 3:46662271-46662293 CTCCAGGGAGAGTGAGGGCCAGG + Intergenic
954135115 3:48578882-48578904 ATGCTGGGACAGAGGGGGCTCGG - Intronic
954375384 3:50191715-50191737 CTGCTGGGACCATGGGGGCTGGG + Exonic
954710620 3:52503554-52503576 CTGTGGGGACAGTTCCGGCCTGG - Intronic
954798618 3:53174403-53174425 CTGCAGGGCCAGGGGGTGCCGGG - Intronic
955228517 3:57079582-57079604 CTGGCGGGACAGTGGGAGCGAGG - Intergenic
956121097 3:65966613-65966635 GAGCGGGGAGAGTGGGGGCGCGG + Intronic
956779624 3:72593750-72593772 CTGTGGGAACAGTGGTGCCCAGG + Intergenic
958161338 3:89819232-89819254 CTGTGGAGTCAGAGGGGGCCTGG - Intergenic
961519827 3:127460619-127460641 CTGCTGGGAACGTGGAGGCCGGG + Intergenic
965192530 3:165549803-165549825 CTGCAGGGACTGTGGCTGCCAGG + Intergenic
967904054 3:194486648-194486670 CGGCGGCGACAGCGGCGGCCGGG - Intronic
968056583 3:195696765-195696787 CGGAGGGGCCAGTGGGGACCCGG + Intergenic
968090540 3:195895883-195895905 CTGCGGGGCAGGTGGGCGCCCGG - Intronic
968144542 3:196287501-196287523 CAGCGAGGGCAGTGGGAGCCAGG - Intronic
968479056 4:825899-825921 CCGCGGGGAGAAGGGGGGCCGGG + Intronic
968567835 4:1323837-1323859 CTGTGGGGACAGGCAGGGCCAGG + Intronic
968583507 4:1405616-1405638 GGGCGGGCACAGTGGGGGCGGGG + Intronic
968585668 4:1414881-1414903 CTGCGGGGGCGGTGCAGGCCCGG - Intergenic
968850470 4:3074529-3074551 CTGCGGGGGCAGGGGCGGGCTGG + Intergenic
969413311 4:7043342-7043364 CTGCGGCGGCGGTGGCGGCCGGG + Intronic
970500416 4:16671479-16671501 CTGCTGAGACAGTAGGGACCTGG - Intronic
971222046 4:24717219-24717241 TTGCTGGGGCAGTAGGGGCCTGG + Intergenic
976087843 4:81424497-81424519 CTGCTGGGAAGGTGGGGGGCAGG - Intergenic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
982071866 4:151702582-151702604 CTGGGGGGAGAGTGGGGAGCGGG + Intronic
984396010 4:179200870-179200892 CAGCGGGGACGGTGGGGGTCGGG + Intergenic
984655101 4:182309018-182309040 CTGTGGAGACAGTAGGGGCTAGG - Intronic
984812369 4:183806668-183806690 CTGGAGGGAAAGTGGGGGTCGGG - Intergenic
985259012 4:188097681-188097703 CTGGGAGGGCAGTGGGAGCCAGG + Intronic
985711296 5:1431382-1431404 CTGGGTGGACAGTGAGGGACGGG + Intronic
985861896 5:2477854-2477876 CCACGGGGTCAGTGGGGGCCAGG - Intergenic
986210164 5:5664568-5664590 CTGCCGGGACAGAGGCAGCCTGG - Intergenic
986293423 5:6418227-6418249 GTGCATGGACAGTGGGGACCTGG + Intergenic
986709813 5:10480534-10480556 AGGCGGGGGCAGTGGGGTCCAGG + Intergenic
988077915 5:26376315-26376337 CTGCGGTGACTGTGGAGGCTGGG - Intergenic
994083390 5:95731836-95731858 CTGCACGGACAGAGGGGGCGAGG - Intronic
994745809 5:103676922-103676944 CTGGAGGGAGAGTGGGGGCTTGG + Intergenic
996176637 5:120368043-120368065 CTATGGAGACAGTGGGGACCAGG + Intergenic
996540903 5:124629424-124629446 CTGAGGGGATGGTGGGGGCTGGG + Intergenic
997380290 5:133431112-133431134 CTGCTGGGGGAATGGGGGCCTGG - Intronic
997454232 5:134005303-134005325 CAGCGCGGACACTGGGCGCCTGG + Intergenic
998260932 5:140631568-140631590 CTGCGGGGATAGAAGGAGCCAGG - Intergenic
998870061 5:146543011-146543033 CTGGGGGGTCAGTTGGGGTCAGG + Intergenic
999731940 5:154481727-154481749 CTGCAGGGGCAGTGTGGGCTAGG - Intergenic
1001056963 5:168457719-168457741 CAACGGGGCCGGTGGGGGCCAGG - Intronic
1001831771 5:174794907-174794929 CTGCGGGGTCAGCGGGGGGCAGG - Intergenic
1001924206 5:175624435-175624457 CTGCTGGGACAGTTTGGGCTGGG + Intergenic
1002226966 5:177730286-177730308 CTGCAGGGAAAATGGGTGCCCGG + Intronic
1002270807 5:178070777-178070799 CTGAGGGGCCAGTGGAGGCCTGG - Intergenic
1002581767 5:180212979-180213001 CTGCTGGGACTGTGGGGCCAGGG + Intergenic
1006366872 6:33621250-33621272 CTGCGGGGGGAGGGGGGGCGGGG + Exonic
1006450464 6:34103075-34103097 CTGGGGTGTCAGTGGGGGACAGG - Intronic
1006457191 6:34138585-34138607 CTGCCCAGCCAGTGGGGGCCCGG - Intronic
1007083673 6:39127515-39127537 CTGTGGAGACTGTGGGAGCCTGG - Intergenic
1007106190 6:39284760-39284782 CTGCTGGGCCAGTCGGGCCCTGG + Intergenic
1007520757 6:42450783-42450805 CTGCGGGCTCTGTGGGGGCTGGG - Intronic
1007618382 6:43196215-43196237 CTGCAGGGACAGTGAGGAGCAGG - Exonic
1007762187 6:44139603-44139625 CTGCTGGGTCAGTGAGGGCCAGG + Exonic
1007763805 6:44149695-44149717 CTGGGGTGAGGGTGGGGGCCAGG - Intronic
1011968389 6:93189715-93189737 CTGTTGGGAAAGTGGGGGGCTGG - Intergenic
1014505451 6:122248559-122248581 CTGCGGAGCTATTGGGGGCCAGG - Intergenic
1015200328 6:130572413-130572435 CTGTGGGGGCATGGGGGGCCAGG + Intergenic
1017073864 6:150600200-150600222 CGGTGGGGACAGAGGGCGCCGGG + Intronic
1017377350 6:153786645-153786667 CTGAAGGGAGAGTGGTGGCCAGG + Intergenic
1017717261 6:157221894-157221916 CTGGGGGGACTGCGGGCGCCTGG - Intergenic
1017787457 6:157768322-157768344 CTGGGAGGAGAGTGAGGGCCGGG - Intronic
1017793782 6:157823519-157823541 CCGCGGGGAGGGTCGGGGCCAGG + Intronic
1018200111 6:161386737-161386759 CTCCGGATACAGTGGGGGACTGG - Intronic
1018631732 6:165827343-165827365 GTGCGGGGACAGGAGGTGCCCGG + Intronic
1018910230 6:168097468-168097490 CTGACGGGACAGGTGGGGCCAGG + Intergenic
1019668238 7:2263504-2263526 CTGTGGGGACCCTGGGAGCCCGG + Intronic
1019704947 7:2493160-2493182 CTGGATGGACAGTGGGGGCATGG + Intergenic
1019912083 7:4106835-4106857 CTGCGGGGTCAGCGGTGGTCAGG - Intronic
1021840686 7:24719411-24719433 CTGCCGGGCCTCTGGGGGCCAGG + Intronic
1022742614 7:33137444-33137466 CTGCGGAGCCAGTGGGGGCTGGG - Intronic
1023966746 7:44966839-44966861 CTGCAGGGACAGAGGGGACTTGG + Intronic
1024839981 7:53574692-53574714 CAGCGGGGACTCTGGTGGCCTGG + Intergenic
1024957049 7:54933302-54933324 CTGCGGGGGCCGTGGGGCTCAGG + Intergenic
1025254522 7:57374561-57374583 CAGCAGGGAGAGTGGGGGCTTGG + Intergenic
1025943476 7:66089550-66089572 CTGTGGGGACCCTGGGTGCCAGG + Intronic
1026052332 7:66957947-66957969 CTGAGGGGAGAGAGGAGGCCTGG + Exonic
1028722390 7:94048419-94048441 ATGTGGAGACAGTTGGGGCCAGG + Intergenic
1029363300 7:100101881-100101903 CCGCGGGGACAGTGGCGGCCGGG + Exonic
1029413246 7:100428587-100428609 CAGGGGTGACAGTGGGGTCCAGG - Exonic
1029432340 7:100539382-100539404 CGGCGGGGTCAGCGGGGGCAAGG + Exonic
1029708167 7:102286352-102286374 CAGCAGGGACAATGGGAGCCTGG - Intronic
1032554707 7:132819838-132819860 CTGCGGGGGCAGCGTGAGCCGGG + Intronic
1033029193 7:137808564-137808586 CTGCCTGGACAGTGGGGGCTAGG - Intronic
1034277753 7:149831053-149831075 CTGAGGGGACTGTGGGGGTGGGG - Intergenic
1034997266 7:155585905-155585927 CTGCAGGTGCAGTGGGGGCCAGG - Intergenic
1035021384 7:155803076-155803098 CGGCGGGGACAGCGGCGGCGGGG - Exonic
1035670974 8:1417038-1417060 CGCCGGGGACAGTGTGGGGCGGG - Intergenic
1036766186 8:11550540-11550562 CACCGAGGCCAGTGGGGGCCAGG + Intronic
1037954262 8:23042006-23042028 CTGAGGGGACAGTGTGTGGCAGG - Intronic
1038592994 8:28857850-28857872 CTGAGGGGATAGAGAGGGCCAGG + Intronic
1038765409 8:30423414-30423436 CGGAGGGGACAGTGAGGGCTGGG + Intronic
1038816384 8:30909400-30909422 CTGAGGGGGGAGTGGGGGCGGGG - Intergenic
1039391048 8:37180928-37180950 GTGCGGAGAGAGTGTGGGCCAGG - Intergenic
1039436374 8:37562157-37562179 CTGCTGGGACATTGAAGGCCAGG + Intergenic
1039615355 8:38951010-38951032 CTGCGGGGGGAGTGGGGGTGTGG + Intronic
1040621370 8:49096303-49096325 CTGCAGGAACAGTAGGGGCAAGG - Intergenic
1041414961 8:57597812-57597834 CTGGGGGCACTGTGGGAGCCAGG - Intergenic
1047262587 8:123275205-123275227 CAGCGGGGCCAGCGAGGGCCAGG + Intronic
1048303269 8:133266737-133266759 CTGCGGGGACAAAGGGGACCTGG - Intronic
1048718833 8:137299111-137299133 TTGCGGGGACAGTGGGGGTGGGG - Intergenic
1049105636 8:140610709-140610731 GTGCAGAGACAGTGGGGCCCAGG - Intronic
1049411195 8:142474716-142474738 CCGCGGGGACTGTCGGGGCAGGG + Intronic
1049732467 8:144185690-144185712 GTGCGGGGACCGTGGGGGGAGGG + Intronic
1049732504 8:144185774-144185796 GTGCGGGGACCGTGGGGGGAGGG + Intronic
1049778124 8:144415708-144415730 CTTCGGGGAGCCTGGGGGCCTGG - Intronic
1051360198 9:16275427-16275449 CTGCGGGGACAGGCAGGGCCTGG + Intronic
1051911083 9:22154563-22154585 ATGCGGGGTCAGTGGGGGTGGGG + Intergenic
1051911110 9:22154635-22154657 ATGCGGGGTCAGTGGGGGTGGGG + Intergenic
1055338128 9:75253628-75253650 CTGCAAGGATAGTGGGGGGCTGG - Intergenic
1057277677 9:93684636-93684658 CTGGCTGGACAGTGGGGCCCAGG - Intergenic
1060553518 9:124496824-124496846 CCGGGGGGACGGTGGGGGCCAGG - Intronic
1061204725 9:129156331-129156353 CTGCCCGGACTGTGGTGGCCTGG + Intergenic
1061342559 9:129994402-129994424 CTGGGGGGAGAGTGGGGAGCTGG + Intronic
1061595344 9:131625225-131625247 GGGCGGGGACAGAGGGGGCCAGG + Intronic
1062004278 9:134231510-134231532 CAGAGGGGGCAGTGGGGGCTTGG + Intergenic
1062035891 9:134382372-134382394 CTGGGGAGACAGTGGGGGCCAGG + Intronic
1062076871 9:134594443-134594465 CTGGGGGCAGAGTGGGGCCCTGG - Intergenic
1062108663 9:134769772-134769794 CTGCGGGGAGGAAGGGGGCCTGG + Intronic
1062108680 9:134769825-134769847 CTGCGGGGAGGAAGGGGGCCTGG + Intronic
1062269393 9:135701705-135701727 CTGCGGGGGGTGTGGGGGCGGGG + Intergenic
1062362111 9:136193095-136193117 CCGCGGGGAGACTGGGCGCCAGG + Intergenic
1062460350 9:136660256-136660278 CAGCGGGGACAGGAGGGGCGGGG - Intronic
1062595125 9:137295929-137295951 CGGCGGGGACGGTGGGGGCGGGG - Intergenic
1186638134 X:11427762-11427784 CTGCGGAGCCGGTGGGGACCTGG + Intronic
1187447695 X:19373206-19373228 ATGCAGGGACAGAGGGGGCAAGG + Intronic
1189491431 X:41474128-41474150 CTTCGGGGACTGTGGCGTCCTGG + Exonic
1190334969 X:49256856-49256878 CTGGGGGGACAGAGGGTGTCAGG + Intronic
1192543763 X:71996159-71996181 CTGGGGGCAAGGTGGGGGCCTGG + Intergenic
1197796086 X:130299772-130299794 CTGCGGGGACACAGGGGGCTAGG + Intergenic
1199606673 X:149584305-149584327 CTGGGGTGACAGTAGGGGCAGGG + Intronic
1199632450 X:149785063-149785085 CTGGGGTGACAGTAGGGGCAGGG - Intronic