ID: 1103715798

View in Genome Browser
Species Human (GRCh38)
Location 12:122944717-122944739
Sequence CTCCAGCTGGAGCAGGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 275}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103715790_1103715798 0 Left 1103715790 12:122944694-122944716 CCCGAGCATTTCCCTACAGAGGC 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1103715798 12:122944717-122944739 CTCCAGCTGGAGCAGGCTGTGGG 0: 1
1: 0
2: 3
3: 36
4: 275
1103715788_1103715798 1 Left 1103715788 12:122944693-122944715 CCCCGAGCATTTCCCTACAGAGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1103715798 12:122944717-122944739 CTCCAGCTGGAGCAGGCTGTGGG 0: 1
1: 0
2: 3
3: 36
4: 275
1103715787_1103715798 5 Left 1103715787 12:122944689-122944711 CCTGCCCCGAGCATTTCCCTACA 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1103715798 12:122944717-122944739 CTCCAGCTGGAGCAGGCTGTGGG 0: 1
1: 0
2: 3
3: 36
4: 275
1103715783_1103715798 30 Left 1103715783 12:122944664-122944686 CCAAGGCTTGTCACTCATGCCTT 0: 1
1: 0
2: 0
3: 20
4: 241
Right 1103715798 12:122944717-122944739 CTCCAGCTGGAGCAGGCTGTGGG 0: 1
1: 0
2: 3
3: 36
4: 275
1103715791_1103715798 -1 Left 1103715791 12:122944695-122944717 CCGAGCATTTCCCTACAGAGGCC 0: 1
1: 0
2: 0
3: 8
4: 172
Right 1103715798 12:122944717-122944739 CTCCAGCTGGAGCAGGCTGTGGG 0: 1
1: 0
2: 3
3: 36
4: 275
1103715786_1103715798 6 Left 1103715786 12:122944688-122944710 CCCTGCCCCGAGCATTTCCCTAC 0: 1
1: 0
2: 0
3: 5
4: 135
Right 1103715798 12:122944717-122944739 CTCCAGCTGGAGCAGGCTGTGGG 0: 1
1: 0
2: 3
3: 36
4: 275
1103715784_1103715798 11 Left 1103715784 12:122944683-122944705 CCTTCCCCTGCCCCGAGCATTTC 0: 1
1: 0
2: 2
3: 29
4: 429
Right 1103715798 12:122944717-122944739 CTCCAGCTGGAGCAGGCTGTGGG 0: 1
1: 0
2: 3
3: 36
4: 275
1103715785_1103715798 7 Left 1103715785 12:122944687-122944709 CCCCTGCCCCGAGCATTTCCCTA 0: 1
1: 0
2: 1
3: 8
4: 217
Right 1103715798 12:122944717-122944739 CTCCAGCTGGAGCAGGCTGTGGG 0: 1
1: 0
2: 3
3: 36
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103715798 Original CRISPR CTCCAGCTGGAGCAGGCTGT GGG Intronic
900589465 1:3453351-3453373 CTCCACCTGGAGCCGCCTGTGGG - Intergenic
900998640 1:6136344-6136366 CTCCTGCAGGAGCAGGGTGTTGG - Intronic
901083718 1:6598025-6598047 TTCCAGCAAGAGTAGGCTGTAGG - Intronic
901530304 1:9848839-9848861 CTCCTTCTGGAACAGGCTGATGG + Exonic
902359690 1:15935657-15935679 CACCAGCTGGGGCTGGCTGCGGG - Exonic
902601095 1:17540428-17540450 CTCCTGCAGGAGGAGACTGTGGG + Intronic
903641981 1:24866545-24866567 CTGATGCTGTAGCAGGCTGTGGG + Intergenic
905276144 1:36819451-36819473 CCTCAGCTGGAGCAGGAGGTGGG + Intronic
905795726 1:40815458-40815480 CTGCAGCTGAAGCAGGGTTTAGG - Intronic
905863766 1:41366148-41366170 GCCCTGCTGGAGCAGGCTGGGGG - Intronic
905934573 1:41813293-41813315 CTCCTGCTGGTGGAGGCTGTGGG - Intronic
905940726 1:41861165-41861187 CCCCAGATGGAGCATGGTGTAGG - Intronic
906688054 1:47775262-47775284 CTCCAGCTGGCTGAGGCTGTCGG + Exonic
907553626 1:55325796-55325818 TTCCAGATGCAGCAGGGTGTAGG - Intergenic
907596367 1:55723844-55723866 CCCCAGAAGGAGCAGGCTGTGGG - Intergenic
910811077 1:91237252-91237274 CCCCAACTGGAGCAGCCTGGTGG - Intergenic
911227037 1:95317927-95317949 CTACTGCTGGGGCAGGCGGTGGG - Intergenic
912209792 1:107545336-107545358 ATGCAGCTGGAGGAGGCTGGAGG - Intergenic
912261006 1:108111597-108111619 CCCCTGATGGAGCAGGCTGGAGG - Intergenic
912395923 1:109343974-109343996 CTGCAGGAGGAGCAGGTTGTGGG - Intronic
913123791 1:115766665-115766687 CTCCAGCTTTAGCAGCCTGAGGG + Intronic
913529604 1:119724375-119724397 CTCCTGCTGGAGGAGGATCTGGG + Intronic
914086865 1:144461613-144461635 AGCCAGCTGGCGCAGGCTATGGG - Intronic
914311744 1:146472600-146472622 AGCCAGCTGGCGCAGGCTATGGG + Intergenic
915264656 1:154708117-154708139 CTGCTGCTGGCGCAGGGTGTCGG + Exonic
915304772 1:154970882-154970904 CTCGAACTGGAGCAGGGGGTAGG + Intronic
916502109 1:165396236-165396258 CTCCCGCAGTAGGAGGCTGTGGG - Intergenic
917638685 1:176961224-176961246 CTCCATGTAGAGCAGGCTATAGG + Intronic
920450670 1:206059071-206059093 CTCCAGCTGGGGCAGGCTGGTGG - Intronic
920513685 1:206568605-206568627 CTCCAGCTGGAGCTCCCTGGAGG - Intronic
922504912 1:226120861-226120883 GTTCAGCTGGAGCATGCTGCCGG - Intergenic
922595735 1:226811334-226811356 CTCCAGGTGTCCCAGGCTGTAGG + Intergenic
922725460 1:227920958-227920980 GTACAGCTGGAGCAGGGTGCCGG - Exonic
1063238968 10:4148994-4149016 ATACAGATGGGGCAGGCTGTGGG + Intergenic
1064066039 10:12182266-12182288 CTCCAGCTGGGGCATCATGTTGG + Intronic
1064650371 10:17503029-17503051 CTTAGGCTGGAGAAGGCTGTTGG + Intergenic
1064815030 10:19251399-19251421 CTCTAGCTGGAATAGGCTGCTGG - Intronic
1065110437 10:22435819-22435841 CTTCACCTGGGGGAGGCTGTCGG + Intronic
1067719798 10:48719724-48719746 CGCCAGATGCAGCAGGCTGTGGG + Intronic
1068844689 10:61658767-61658789 CTCCAGCTGGAGAAAACGGTGGG + Intergenic
1069527215 10:69183099-69183121 CACCTGCAGGAGCAGGCTGAGGG - Intronic
1069854702 10:71433659-71433681 CTGCAGGTGGAGCTGGCTGAGGG - Intronic
1069871559 10:71536181-71536203 CTCCATGGAGAGCAGGCTGTAGG + Intronic
1070150147 10:73800434-73800456 ATGCAGGTGGTGCAGGCTGTGGG - Exonic
1070967599 10:80538996-80539018 CTCCGGCAGGAGGATGCTGTGGG + Intronic
1072439402 10:95440412-95440434 CTGCAGGTGGGGCAGGCTGTGGG - Intronic
1075012620 10:118887573-118887595 CTCAAGCAGGAGCAGGCTGGTGG - Intergenic
1075594537 10:123718809-123718831 CGACAGGTGAAGCAGGCTGTTGG + Intronic
1076732450 10:132445514-132445536 CTCCAGCGGCAGGAGGCTGAGGG + Intronic
1076988049 11:253545-253567 CTCCAACAGGAGCAGGCCGTGGG - Intergenic
1077551751 11:3203518-3203540 CTCCGTCTGGAGCAGCCCGTCGG - Intergenic
1078955685 11:16191959-16191981 CTTCAGCTGGAGCAGGCCCTGGG - Intronic
1080051170 11:27860504-27860526 CTCCAGGTGGAGTAAGCTTTGGG - Intergenic
1080661129 11:34296842-34296864 CCACAGTTGGAGAAGGCTGTAGG + Intronic
1080876149 11:36276137-36276159 CTTCATCTGGAGCAGGCAGGTGG + Exonic
1080974311 11:37318736-37318758 CTATAACTGGAGGAGGCTGTAGG + Intergenic
1081835393 11:46149445-46149467 GGTCAGCTGGGGCAGGCTGTGGG - Intergenic
1083756050 11:64792208-64792230 CTGCAGCAGGAGCAGGCTGGTGG + Exonic
1084205054 11:67586340-67586362 AGCCAGCGGGAGCAGGCTGGAGG - Intronic
1084603825 11:70161552-70161574 CAGAAGCTGGACCAGGCTGTTGG + Intronic
1085043349 11:73339739-73339761 CTCCAGGAGGGGCAGGCTGGGGG - Intronic
1087475799 11:98632999-98633021 CTCCATCTGGAGCAGGGGCTTGG + Intergenic
1089293073 11:117450103-117450125 CTCCACATGGAGCAAGCTGAGGG - Intronic
1089840323 11:121411901-121411923 CTCCACATGGAGGACGCTGTAGG + Intergenic
1090049583 11:123365912-123365934 GTTCAGCTGGTGCAGGCTATGGG - Intergenic
1091357211 11:134946273-134946295 CTCCAGCCCCAGCAGGCTGGAGG + Intergenic
1091831828 12:3555564-3555586 CTCCAGGTGCTGCAGTCTGTTGG + Intronic
1093101946 12:15038314-15038336 CTGCAGTGGGAGGAGGCTGTGGG + Intergenic
1096501094 12:52064201-52064223 CTCCAGCCTGGGCAGGCTGAGGG - Intergenic
1099473559 12:83080108-83080130 CACCAGCTGGAGAAAACTGTTGG - Intronic
1102261939 12:111448181-111448203 CTCCAGGTGCTGCAGGCTGTTGG - Exonic
1103715794 12:122944706-122944728 CTCCAGCTGGAGGCCTCTGTAGG - Intronic
1103715798 12:122944717-122944739 CTCCAGCTGGAGCAGGCTGTGGG + Intronic
1104351034 12:128044174-128044196 CTCCAGCTGGAGAAAACTCTTGG - Intergenic
1113459954 13:110475126-110475148 AGCCAGCTAGAGCAGGTTGTTGG + Intronic
1114474214 14:22982423-22982445 CTCCCGCTGGGGGATGCTGTGGG - Exonic
1114614088 14:24059216-24059238 CTGCAGTCGGAGGAGGCTGTGGG + Intronic
1114674407 14:24430879-24430901 CTCCAGCTGCAGCCAGATGTGGG - Exonic
1116786827 14:49297172-49297194 CTCCAGATCCACCAGGCTGTAGG - Intergenic
1117954406 14:61111444-61111466 CTCCCTCTGGAGCAGGCTGGGGG + Intergenic
1119124549 14:72113467-72113489 CTCCAGTTGAAGCAGGATGTAGG - Intronic
1119768181 14:77203895-77203917 CTCTAGCTGGAGCTGACTCTGGG + Intronic
1119846254 14:77832477-77832499 CTCCAGCAGCAGCAGCCAGTTGG - Intronic
1121867192 14:97373500-97373522 GTCCAGCTGAAGCAAGCTGAGGG + Intergenic
1122740567 14:103869539-103869561 CTCCAGCCGGGGCAGGCTGCAGG - Intergenic
1122884751 14:104706049-104706071 CTCCAGCTGGATCAGCAGGTCGG - Exonic
1123105227 14:105838169-105838191 CTCCAGCTGGAGACGGCAGTGGG + Intergenic
1123630410 15:22257015-22257037 CTCCATTTGGAGGAGGCTTTTGG + Intergenic
1123982742 15:25619022-25619044 CTGCAGCTGTGGGAGGCTGTGGG - Intergenic
1124120370 15:26883506-26883528 CTCCAGCCGCAGCAGCTTGTTGG - Exonic
1124373961 15:29118896-29118918 GTCCAGCTGGGTTAGGCTGTGGG + Intergenic
1124690039 15:31814247-31814269 TTCCAGCTGGAGTAAGTTGTTGG - Intronic
1124847028 15:33301169-33301191 TGGCAGCTGGAGCAGGCTGAAGG + Intergenic
1127306833 15:57714331-57714353 CTTCAACTGTAGCAGGCTGGTGG + Intronic
1127376512 15:58389708-58389730 CTTCAGCTGGATCAGGGTCTGGG - Intronic
1127497242 15:59524673-59524695 TTCCGGCTGGAGCAGGAAGTCGG - Intergenic
1127832518 15:62763493-62763515 CCAGTGCTGGAGCAGGCTGTGGG + Intronic
1127963929 15:63909947-63909969 TTCCAGCTGGCTCAGGCTGGAGG - Intronic
1128232675 15:66046543-66046565 CTGCAGCTGCTGCAGGCTGAGGG + Intronic
1129182815 15:73887666-73887688 CACCATCTGCAGCATGCTGTAGG - Exonic
1129597227 15:76974457-76974479 CTCCAGCTCTGGCAGGCTGGAGG + Intergenic
1131106240 15:89736759-89736781 TGGCAGCTGGAGGAGGCTGTTGG + Intronic
1131225324 15:90620118-90620140 CCCGAGCTGTGGCAGGCTGTGGG + Intronic
1134133908 16:11667648-11667670 CTCCATCAGGAGCAGGCTGTGGG + Intergenic
1134269617 16:12722351-12722373 CTCCAGCTGAGGCAGGCTGCAGG + Intronic
1135345166 16:21682888-21682910 CACTAGCTGGAGGTGGCTGTTGG + Intronic
1137338064 16:47571293-47571315 CTGCAGCTGAAGCAGGTGGTGGG + Intronic
1137546774 16:49410293-49410315 GGCCAGCTGGTGCTGGCTGTTGG + Intergenic
1138347407 16:56328481-56328503 CCCTCCCTGGAGCAGGCTGTGGG + Intronic
1138594276 16:58021404-58021426 CTGCAGCTGCAGCAGGCAGGAGG - Exonic
1139509137 16:67416411-67416433 CTCCGGCTCCAGCAGGCTGGAGG + Exonic
1140035019 16:71365125-71365147 CTCCATCTGGAGCACCCTCTGGG - Intronic
1140655327 16:77133877-77133899 CTCCAGCTGCAGCAGTCTCCAGG + Intergenic
1141635048 16:85310159-85310181 CGCCAGCGGGAGCAGGTGGTGGG - Intergenic
1142153843 16:88524347-88524369 CTTCTGCTGGGGCAGGCTGGGGG - Intronic
1142195155 16:88736190-88736212 CCCCAGCTGGCGCAGGCTGACGG + Exonic
1142426567 16:90004749-90004771 CTCCAGCTGCAGCAGCCTGAGGG - Intergenic
1143323106 17:6080744-6080766 CTGCAGCAGCAGCAGGCTGCCGG - Exonic
1143380280 17:6491518-6491540 CTCTGGCTGAAGCAGGCTGGGGG + Intronic
1143481637 17:7230561-7230583 CTCCAGAAGGAGAAGGCTGAGGG + Intronic
1143783409 17:9240830-9240852 CTCATGCTGGAGCTGCCTGTTGG + Exonic
1146629464 17:34459461-34459483 CTCCATCTGGGGCAGCCTGGTGG - Intergenic
1146675726 17:34772583-34772605 CGGCAGGTGGTGCAGGCTGTTGG + Intergenic
1146735098 17:35232128-35232150 CACTGGCTGGAGCAGCCTGTGGG + Intergenic
1147356801 17:39904834-39904856 ATCCTGCTGGAGCTGGCTGAGGG - Exonic
1147644619 17:42026453-42026475 CTCTAGCTGCAGCAGGCTCAAGG - Intronic
1148131767 17:45266576-45266598 CTCCAGCTGGAACATGGTGCTGG - Exonic
1148850830 17:50554290-50554312 ATGCAGCCGGAGCAGGTTGTGGG - Exonic
1149182537 17:53956609-53956631 CTCCATCTGGGGCAGGGTGGCGG + Intergenic
1149445277 17:56708384-56708406 CTCCAACTGGAGCTGGTTGTAGG - Intergenic
1149620366 17:58040242-58040264 CTTCAGCTGGAGCATGCTAGTGG - Intergenic
1150291209 17:63983440-63983462 TCTCAGCTGGGGCAGGCTGTGGG + Intergenic
1152123659 17:78433758-78433780 CTCCTGCAGGAGCCGGCTTTTGG - Intronic
1152419417 17:80184063-80184085 CTCCAGCTGGTGCAGGCCCTCGG - Exonic
1152743328 17:82028129-82028151 CTCAAGCTGGAGCAGCAGGTGGG + Exonic
1152747912 17:82049674-82049696 TACCTGCTGGAGCAGGGTGTCGG + Exonic
1152791762 17:82283813-82283835 CTGGGGCTGGAGCAGGCTGAGGG + Intergenic
1153375260 18:4369919-4369941 ACCCAGCTGGAGCAGCCTGGAGG + Intronic
1153973836 18:10249399-10249421 CTCCATCTGGTGCTGGCTGTAGG - Intergenic
1155418704 18:25629771-25629793 GTCTAGCTGGAGCAGTCTGCTGG - Intergenic
1155509965 18:26566658-26566680 ATTCTGCTGGAGCAGCCTGTGGG + Intronic
1156100025 18:33581997-33582019 CTACAACTGCAGAAGGCTGTGGG - Intronic
1156263600 18:35466990-35467012 CTCCAGGAGCAGCAGTCTGTGGG + Intronic
1157136817 18:45063979-45064001 CCCCAGGAGGAGCAGGCTGGTGG + Exonic
1157493452 18:48139371-48139393 ACCCAGCTGGAGCGGGATGTGGG + Intronic
1158820999 18:61158779-61158801 GTCCAGCTGAAGCAGGCAGGTGG + Intergenic
1159957179 18:74527075-74527097 CTCCTGCTGGAGCCGCCAGTGGG + Intergenic
1161006099 19:1937507-1937529 CTCCAGCTGTAACAGGCGGCAGG + Intergenic
1161346615 19:3771614-3771636 CTCCAGCTGGTGCAGCTGGTAGG + Exonic
1163432932 19:17278993-17279015 CTCCTCCTCCAGCAGGCTGTAGG - Exonic
1164552783 19:29225670-29225692 CTCCAGGTGCTGCAGGCTTTGGG - Intergenic
1164855408 19:31517082-31517104 TTCCAGCTGGAGCAGCCAGTGGG + Intergenic
1164908491 19:31986629-31986651 CCCCAGCAGGAGAAGGCCGTGGG + Intergenic
1165072814 19:33265390-33265412 CTCCAGCTGGAGCCTCCTGGAGG - Intergenic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1166144829 19:40826575-40826597 GTCCAGCAGGGGCAGGGTGTGGG - Intronic
1166182913 19:41121632-41121654 GTCCAGCAGGGGCAGGGTGTGGG + Intronic
1166374052 19:42317047-42317069 AGCCAGCAGGAGCAGGATGTGGG - Intronic
1166405670 19:42520268-42520290 CACCAGCTGTATGAGGCTGTGGG - Intronic
1166741250 19:45116226-45116248 CTTCAGCTGCGGCAGGCAGTTGG + Intronic
1167306534 19:48713290-48713312 CTCCAGCAGCAGCCGGCTGTGGG - Exonic
926152597 2:10433111-10433133 CTGCAGCTGGAAGAGGCCGTGGG - Intergenic
929537963 2:42796109-42796131 ACACAGCTGGTGCAGGCTGTTGG - Intergenic
930730721 2:54725081-54725103 CTCCAGCCGGAGCTGGCAGCGGG - Exonic
932412656 2:71556368-71556390 CTCCAGGAGGAGCTGGCTGGGGG + Intronic
934028377 2:88019161-88019183 CTCCAGCAGGAGCAGGCAACAGG - Intergenic
934871353 2:97869301-97869323 CTCCTGCAGGAGAGGGCTGTGGG + Intronic
935546284 2:104403028-104403050 CAAAAGCTGGAGCAGGCTATGGG + Intergenic
936581768 2:113706316-113706338 CTCCAGCTGCAGCACCCTGAAGG + Intronic
937019402 2:118636417-118636439 ATGCAGCTGCAGCAAGCTGTGGG + Intergenic
939728601 2:145754071-145754093 CTCCGGCTGTAGCAGGTTGCAGG - Intergenic
940382571 2:153032919-153032941 CACCAGCTGGACCCGGCAGTGGG + Intergenic
943367784 2:186982047-186982069 CTGCAGCTGGAGCAAGGAGTTGG - Intergenic
948107792 2:235428985-235429007 CTCCAGCAGGAGGAGACTGCTGG + Intergenic
948874019 2:240818006-240818028 CCCCAGATGGGGCAGTCTGTGGG + Intronic
1170168070 20:13382031-13382053 CACCAGGAGGAGCAGGCTGCCGG - Intergenic
1173037290 20:39424609-39424631 CACCAGCAGTAGCAGCCTGTGGG + Intergenic
1174393310 20:50231487-50231509 CTCCAGCTGGAGCAACCTCTGGG - Intergenic
1174406142 20:50304633-50304655 CGCCAGCTCCAGCAGGCTGGGGG - Intergenic
1175220579 20:57414362-57414384 CTGCAGCTGGCCCAGGCTGGGGG - Intergenic
1175956303 20:62611282-62611304 ATCCAGCTGGTTCTGGCTGTGGG + Intergenic
1176382702 21:6121137-6121159 CTGTAACTGGAGCAGCCTGTGGG - Exonic
1176837654 21:13808632-13808654 CTCCTGCTTGAGAAGGCTCTGGG + Intergenic
1178029291 21:28505891-28505913 CTGGAGCTGGAGCAGCCTGGAGG + Intergenic
1178632747 21:34276986-34277008 CACCAGATGGGGCAGGCTTTGGG + Intergenic
1179740767 21:43417102-43417124 CTGTAACTGGAGCAGCCTGTGGG + Exonic
1180720288 22:17902857-17902879 CTCCTGCTACAGCAGGCTTTGGG - Intronic
1180833889 22:18920183-18920205 CTCCACCCGGAGCAGGCAGAGGG + Intronic
1181485873 22:23231559-23231581 CTCCAGCCAGCACAGGCTGTTGG - Intronic
1181542826 22:23583054-23583076 CTCCAGCTGGAGTCAGCTCTGGG - Intergenic
1181803147 22:25360129-25360151 GTCCAGCTGCAGCACGATGTCGG + Exonic
1181876840 22:25946120-25946142 CTCCAGCTGGACCAGGCAAGAGG - Exonic
1182288191 22:29260222-29260244 CTCCAGCTGCTGCAGCCTGTTGG + Exonic
1182442129 22:30370788-30370810 GCCCAGCTGGAGGAGGCTGAAGG + Exonic
1182486730 22:30643565-30643587 AGCCAGCAGGAGCAGGGTGTGGG + Intronic
1183111867 22:35655915-35655937 CTCCAGCAGGAGCAACTTGTGGG + Intronic
1183197143 22:36361304-36361326 CTGCAGATGGGGCAGGCTCTGGG - Intronic
1184164031 22:42717000-42717022 CTCCTGCTGGAGTAGGCTTGTGG + Intronic
1184852859 22:47130678-47130700 ATCTTGCTGGAGCAGTCTGTGGG + Intronic
1185148269 22:49150781-49150803 CTCCTGGTGGCACAGGCTGTGGG - Intergenic
1203283975 22_KI270734v1_random:145481-145503 CTCCACCCGGAGCAGGCAGAGGG + Intergenic
952931691 3:38365668-38365690 CGCCAGCTGGAGGCTGCTGTGGG + Exonic
953242586 3:41162801-41162823 CTCCATGTGGAGCAGGCCTTGGG - Intergenic
953563900 3:44014763-44014785 CTGCAGCTGGCTCAGGCTCTAGG + Intergenic
954199356 3:49014971-49014993 CTACAGCTAGAAGAGGCTGTGGG + Exonic
954345228 3:49991628-49991650 CACCAGCTGGAGCTGGCTTTTGG - Intronic
954376348 3:50195943-50195965 ATCCTGCTGGAGAAGGCTGGAGG - Exonic
954762942 3:52890187-52890209 TCACAGCTGGAACAGGCTGTAGG - Intronic
954808309 3:53232789-53232811 CTTCAGCTGGAGCAGGTGGCCGG + Intronic
955259041 3:57365988-57366010 CTCCATCTTGAGCAGGGGGTGGG + Intronic
955418894 3:58717796-58717818 CTCCAGCTGGATGAGACTCTGGG + Intronic
955949918 3:64232783-64232805 CTACAGATGGAGCAGATTGTGGG - Intronic
958075024 3:88665575-88665597 CTACATCTTGAGCAGACTGTGGG - Intergenic
960595226 3:119402152-119402174 CTCCATCTGGAAGAGGCTGCTGG - Exonic
961525913 3:127497239-127497261 CTGCAGCTGGACCAGGCTTCTGG - Intergenic
961602687 3:128073352-128073374 CTTCAGCAGGAGCAGGCTGGGGG - Intronic
961825878 3:129598785-129598807 CTCCAGGTGGAGCAGGCTTCTGG - Intronic
962435325 3:135361199-135361221 GTCCAGCTGTGGGAGGCTGTGGG + Intergenic
962909021 3:139830857-139830879 CTCCAGCACAGGCAGGCTGTTGG + Intergenic
963280837 3:143383660-143383682 CTCCAGCTGAAGCAGGCAGAGGG - Intronic
968846062 4:3042173-3042195 CCCCTGCTGGAGCCGGCGGTGGG - Intergenic
968929761 4:3572610-3572632 CTCCAGTTGGAGCATCCAGTCGG - Intergenic
970455170 4:16216471-16216493 GTCCAGGTAGAGGAGGCTGTTGG - Intronic
971564335 4:28118354-28118376 CTCCTGCTTTACCAGGCTGTGGG + Intergenic
973982161 4:56315776-56315798 CACCAGCAGGAGGAGGCTGGGGG - Exonic
974907746 4:68078158-68078180 CTCCAGCTGGACCAGGATCAGGG - Intronic
975434337 4:74334213-74334235 CTGCAGCGGGAGCAGGTTCTGGG - Intergenic
978715829 4:111841224-111841246 CTCCAGCAGGGGGAAGCTGTGGG + Intergenic
980397296 4:132231051-132231073 CTGCTGCAGGAGCAGGATGTGGG - Intergenic
982863591 4:160483205-160483227 CCTCAGCTGGAGCAAACTGTGGG + Intergenic
984815746 4:183834442-183834464 CTCCTGCTTGTGCAGACTGTAGG - Intergenic
985476417 5:81842-81864 CACCTGCTGCAACAGGCTGTGGG - Intergenic
985629356 5:1006758-1006780 CTCCAGCTTGGGCACCCTGTAGG + Intergenic
986798519 5:11235616-11235638 TCACAGCTGGAGGAGGCTGTGGG - Intronic
987262883 5:16221421-16221443 CTCCAGCTGGAGCAGGGACCTGG - Intergenic
987835143 5:23150926-23150948 CACCAGCTGTAGCAGGGTTTGGG - Intergenic
988306261 5:29498482-29498504 CTACAGCTGCAGCAAGGTGTTGG + Intergenic
988977546 5:36529883-36529905 GTCCAGCTGGGGGAGGCTGCAGG - Intergenic
992111450 5:73498289-73498311 CTCCAGCGGCTGCCGGCTGTAGG - Intergenic
992155702 5:73953255-73953277 CTCCAGGAGGAGCAGTCTGAAGG + Intergenic
992385398 5:76279735-76279757 GTGCAGCTGGAGAAGCCTGTGGG + Intronic
999287847 5:150404872-150404894 CTGCAGCTGGACCCGGGTGTTGG - Intronic
999424507 5:151475648-151475670 CTGAAGCTGGAGCAGGTGGTGGG + Intronic
1000816331 5:165927137-165927159 CTGGAGCTGGAGCAGGGTGAGGG - Intergenic
1001423120 5:171601801-171601823 CTCCAGCAGCAGCAGGTTCTGGG + Intergenic
1002170068 5:177369937-177369959 ATCAGGCTGGAGCAGGCAGTGGG + Intronic
1006772029 6:36561661-36561683 GTACAGCTGGAGCAAGTTGTGGG - Intergenic
1006839865 6:37021850-37021872 CTCCAGCTGCAGGGGGCAGTAGG + Intronic
1007230376 6:40343926-40343948 GTCCAGCTGGGTCAGCCTGTGGG - Intergenic
1007717306 6:43864748-43864770 TTCCAGTTTGAGCAGGCTGGGGG - Intergenic
1007721827 6:43889771-43889793 CTCCAGCTGGGCCTGGCTGCAGG + Intergenic
1011638581 6:89398796-89398818 CTCTAGGTGGTGAAGGCTGTAGG - Intronic
1012927574 6:105282990-105283012 CCCGAGCCGGAGCTGGCTGTGGG + Intronic
1015441115 6:133247747-133247769 CTCTAGGTGAAGCAGGATGTAGG + Intronic
1016526265 6:145004964-145004986 TATCAGCTTGAGCAGGCTGTGGG + Intergenic
1018936720 6:168278639-168278661 CTCCTGCTGGAGAGGGGTGTGGG - Intergenic
1019379323 7:712752-712774 CTCCAGCCGGTGCAGGCCGCGGG + Intronic
1022523211 7:31020948-31020970 CTCCAGGTGGAACAGGATGGAGG + Intergenic
1023780563 7:43651497-43651519 CTCAAGCTGGCACAGGCTGGAGG + Intronic
1023996457 7:45161815-45161837 GTCCAGGTGGACCAGGCTGCAGG + Intronic
1027781001 7:82520349-82520371 CAACAGATAGAGCAGGCTGTGGG + Intergenic
1028129433 7:87152647-87152669 CGCCGGCTGGCGCAAGCTGTCGG + Exonic
1029287433 7:99475512-99475534 CAGCAGGTGGAGCTGGCTGTAGG + Intronic
1029515078 7:101018795-101018817 CTCCTGCTGGGGAAGGCTGGGGG + Exonic
1029635056 7:101778032-101778054 ATCCAGATGGAGGAGGCTTTCGG - Intergenic
1030265917 7:107621765-107621787 CTCCTGCTGGAAGAGGCTCTGGG - Exonic
1030614877 7:111728824-111728846 CTCCTGCTGCAGCCGGCTTTGGG - Intronic
1030921171 7:115390145-115390167 CTCCAGTAAGAGCAGGATGTAGG + Intergenic
1032000598 7:128262730-128262752 GGCCAGCTGGGGCAGGCTGTGGG + Intergenic
1033269237 7:139915800-139915822 CACTGGCTGGAGCAGACTGTGGG + Intronic
1034702154 7:153105742-153105764 ACCCAGCTGGAGAAGGCTGCAGG - Intergenic
1035121573 7:156572837-156572859 CCCCAGAGGGAGGAGGCTGTGGG - Intergenic
1035192790 7:157186904-157186926 CACCAGGTTGAGCAGGGTGTTGG - Exonic
1035581198 8:739823-739845 CAGCATGTGGAGCAGGCTGTAGG + Intergenic
1035700951 8:1639016-1639038 CAGCAGCTGGAGAGGGCTGTTGG - Intronic
1035748808 8:1980686-1980708 CTCCAGCTGGCGGAGGCTCCAGG - Intronic
1037550713 8:19968757-19968779 CTCAAGCTGAAGCAGGAGGTGGG + Intergenic
1038160339 8:25031221-25031243 CTCCAGCTCCAGCTGGCTCTAGG - Intergenic
1038580737 8:28747218-28747240 TTCCCACTGGAGCAGGATGTAGG - Intronic
1039474152 8:37830581-37830603 TCCCAGCTGGAGCAGGCTGCAGG + Intronic
1040279031 8:46028650-46028672 CTCCAGCTTGAGCTGACTGTTGG - Intergenic
1041433989 8:57817603-57817625 CTCCAGCTGTGGCAGGCAGGTGG - Intergenic
1042189544 8:66171719-66171741 CTCCATCTCGGGAAGGCTGTAGG + Intronic
1043464088 8:80487419-80487441 CTGCAGCAGCAGCAGGCGGTCGG + Exonic
1046583146 8:116118487-116118509 CTCCTGGTGGGGCTGGCTGTAGG - Intergenic
1048865831 8:138760867-138760889 CTCCTGCAGGAGCAGGGCGTGGG + Intronic
1049274158 8:141711408-141711430 CTCAGACTGGAGCAGGCAGTGGG - Intergenic
1049280508 8:141741756-141741778 CTCCAGCCGGAGCAGCCCCTCGG + Intergenic
1050672573 9:8014390-8014412 ATGGAGATGGAGCAGGCTGTGGG + Intergenic
1053007683 9:34614901-34614923 CTGCAGCTGGAGGTGGCAGTGGG + Intronic
1053173834 9:35908644-35908666 CTCCACATGGAGCAGGCTGTGGG - Intergenic
1053175409 9:35918844-35918866 TTACAGCTGAAGAAGGCTGTTGG + Intergenic
1053857786 9:42355999-42356021 CTCCAGCAGGAGCAGGCAACAGG + Intergenic
1054460517 9:65459862-65459884 CTCCAGTTGGAGCATCCAGTCGG + Intergenic
1056629773 9:88283679-88283701 CTCCAGCAGGTGAAGGCTGAGGG - Intergenic
1056938181 9:90933646-90933668 CTCCAGCAGGAGGCGGATGTGGG + Intergenic
1057025962 9:91733927-91733949 CTGCAGCTGGAGGAGACAGTTGG + Intronic
1058482946 9:105415510-105415532 TTCCAGCTGGAGCAGGATTTTGG + Intronic
1058892186 9:109370743-109370765 TTCCAGCTGGAGCAGGTTTCAGG + Intergenic
1059343588 9:113613312-113613334 CTGCACCTGGAGCTGGCTCTCGG - Intergenic
1059453790 9:114387293-114387315 CTGCTGCTGGAGCGGGCTGGGGG - Intronic
1059634332 9:116156751-116156773 CTCCACATGGTACAGGCTGTTGG + Intronic
1060116795 9:120948101-120948123 CTGCAGATGGAGCAGGTTGTGGG - Intergenic
1060761406 9:126252984-126253006 CTCCATCCAGAGCAGGCTCTGGG - Intergenic
1062057071 9:134474313-134474335 CTCCAGCCAGGGGAGGCTGTGGG - Intergenic
1062058485 9:134481855-134481877 CTCCATCTCTTGCAGGCTGTTGG + Intergenic
1062107468 9:134763799-134763821 CTCCTGCTGGAGCAGGATCTGGG + Intronic
1062276661 9:135734534-135734556 CACCTGCTGCAGCCGGCTGTGGG + Intronic
1192844561 X:74892439-74892461 CTCCTGCTTTACCAGGCTGTGGG - Intronic
1193036519 X:76957472-76957494 CATCAGGTGGAGCAGGGTGTTGG + Intergenic
1195144512 X:101999902-101999924 CTGCAGCGGGAGAAGGGTGTAGG - Intergenic
1202282056 Y:23199717-23199739 CTAGAGCGGGAGCAAGCTGTGGG + Intergenic
1202283835 Y:23218802-23218824 CTAGAGCGGGAGCAAGCTGTGGG - Intergenic
1202433728 Y:24814102-24814124 CTAGAGCGGGAGCAAGCTGTGGG + Intergenic
1202435511 Y:24833188-24833210 CTAGAGCGGGAGCAAGCTGTGGG - Intergenic