ID: 1103716178

View in Genome Browser
Species Human (GRCh38)
Location 12:122946715-122946737
Sequence GCCACCATGTAGAACTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103716178_1103716188 28 Left 1103716178 12:122946715-122946737 CCAGCCAAGTTCTACATGGTGGC 0: 1
1: 0
2: 0
3: 13
4: 177
Right 1103716188 12:122946766-122946788 CACCATGTGCATGTCACCACAGG 0: 1
1: 0
2: 4
3: 12
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103716178 Original CRISPR GCCACCATGTAGAACTTGGC TGG (reversed) Intronic
901090118 1:6635336-6635358 GCCGCCCTGTAGTTCTTGGCTGG - Exonic
901937177 1:12634954-12634976 GCCTCCATGTTGAACATGCCTGG - Intergenic
903006879 1:20304411-20304433 GCAAGCATGTAGAACGTGGAGGG + Intronic
908360166 1:63361234-63361256 GCCACCAAGTCTAACTTGTCTGG + Intergenic
909631488 1:77773659-77773681 GCCACACTGTAGAACTTTGGGGG + Intergenic
910155234 1:84209948-84209970 TCCAGCATGTAGAACTGGTCTGG - Intronic
911333332 1:96550923-96550945 GCCACCATGTATAATTTGGGAGG - Intergenic
913487557 1:119346955-119346977 GACACCTTGTAGTATTTGGCAGG + Intergenic
915652581 1:157327814-157327836 GACACCTTATAGTACTTGGCAGG - Intergenic
921841565 1:219834404-219834426 GCCTCCATGTGGAACATGCCTGG - Intronic
922177523 1:223208279-223208301 CCCACAATGTAAGACTTGGCAGG - Intergenic
923868216 1:237963037-237963059 GCCTCCATGTTGAACATGCCTGG - Intergenic
924646799 1:245885336-245885358 ACCACCATGTTGAACATGCCTGG + Intronic
924712094 1:246537881-246537903 GCCTCCATGTTGAACATGCCTGG - Intergenic
924850501 1:247824350-247824372 GCCACCATTTTGAACGTGCCTGG + Intergenic
924929280 1:248713218-248713240 GCCTCCATGTTGAACATGCCTGG - Intergenic
1064385903 10:14891256-14891278 GCCACAATGAACAACTTGCCAGG - Intronic
1064738254 10:18406121-18406143 GCCACAAAGAAGAAATTGGCAGG + Intronic
1064773819 10:18753283-18753305 GCCACCATGGTGAACATGCCTGG - Intergenic
1064903462 10:20318517-20318539 GCCACCAGGTTGAACATGCCTGG - Intergenic
1065266208 10:23978885-23978907 GCCACCAGAGAGAACATGGCAGG - Intronic
1065997574 10:31073396-31073418 GCCCCCATGGAGAACTGAGCAGG - Intergenic
1069508710 10:69024058-69024080 GCCACACTGTAGAACTTTGGAGG - Intergenic
1070074858 10:73125175-73125197 CCCACCAAGAAGAACGTGGCTGG + Exonic
1070182323 10:74026159-74026181 GCCTCCATGTTGAACATGCCTGG + Intronic
1072120650 10:92402932-92402954 GCCGCCATGTTGAACATGCCTGG - Intergenic
1072388175 10:94954279-94954301 GCCGCCATTTTGAACTTGCCTGG - Intronic
1072407947 10:95171869-95171891 GCCTCCATGTGGAACCTGTCAGG - Intergenic
1077921376 11:6644325-6644347 GGGACCATGGAGAAGTTGGCAGG - Intronic
1079464752 11:20718956-20718978 GCCTTTATGTAGAACTTTGCTGG + Intronic
1088952494 11:114585878-114585900 GCCTCCATGTTGAACATGCCTGG - Intronic
1089982206 11:122781547-122781569 GCTGTCATGAAGAACTTGGCCGG + Intronic
1091793289 12:3283525-3283547 GCCACCATGGGGCACCTGGCGGG + Exonic
1097767424 12:63542247-63542269 GCCTCCATGTTGAACATGCCTGG - Intergenic
1097783797 12:63737290-63737312 GCCTCCATGTTGAACATGCCTGG - Intergenic
1099379500 12:81937489-81937511 GCCACCATCAAGAACTTGAAAGG - Intergenic
1102657348 12:114493574-114493596 GCCACTATTTAGAAAATGGCAGG - Intergenic
1103236613 12:119378247-119378269 GCCACCATGTTGAACATGCCTGG + Intronic
1103716178 12:122946715-122946737 GCCACCATGTAGAACTTGGCTGG - Intronic
1104781759 12:131426037-131426059 GCCTCCATGTTGAACATGTCTGG + Intergenic
1107746370 13:43514579-43514601 GCCAAAATCTAGAACTTGGGTGG - Intronic
1109271611 13:60261868-60261890 GCCTCCATGTTGAACATGCCTGG + Intergenic
1109463675 13:62698334-62698356 GCCATCCTGTATAACATGGCAGG - Intergenic
1111519082 13:89376051-89376073 GCCTCTATACAGAACTTGGCAGG - Intergenic
1114058764 14:19000180-19000202 GCCACATTGTAGAACTTTGGGGG - Intergenic
1114103780 14:19401574-19401596 GCCACATTGTAGAACTTTGGGGG + Intergenic
1114196883 14:20485993-20486015 GCCTCCATGTTGAACATGCCTGG - Intergenic
1115850613 14:37587567-37587589 GCCATCATGTAGAAAATGGACGG + Intergenic
1116263087 14:42656032-42656054 GACACCATATAGTATTTGGCAGG - Intergenic
1117034952 14:51718634-51718656 GCATCCATGTACAACTTGTCAGG - Intronic
1117201897 14:53398915-53398937 GCCATCATTTATAAATTGGCTGG + Intergenic
1121348271 14:93152393-93152415 TCCACCATCAAAAACTTGGCAGG - Intergenic
1202853965 14_GL000225v1_random:38153-38175 GCCACCATGGAGGGCCTGGCGGG + Intergenic
1124958116 15:34373278-34373300 GCCACATTGTAGAACTTTGGGGG + Intergenic
1126515892 15:49537763-49537785 CCCACAATGTAGAACCTGGAAGG + Intronic
1128522408 15:68384554-68384576 GCCACCCAGCAGACCTTGGCAGG - Intronic
1129790967 15:78340423-78340445 GCCACCATGCCCAACTTCGCCGG + Exonic
1130038868 15:80386920-80386942 GCCTCCATGTTGAACATGCCTGG + Intronic
1131979060 15:97978136-97978158 GCCTCCATGTTGAACATGCCTGG + Intergenic
1134642174 16:15837990-15838012 TCCACCTTGGAGAACTTGGGTGG + Exonic
1135685513 16:24495407-24495429 GCCGCCATGTTGAACATGCCTGG + Intergenic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1135841808 16:25883826-25883848 GCTACCTTGTAGAACTGGGCTGG - Intronic
1140533958 16:75692006-75692028 GCCTCCATGTTGAACCTAGCTGG - Intronic
1142289752 16:89188091-89188113 GCCTCCATGAAGAACTGGGTGGG - Exonic
1142614571 17:1126937-1126959 GCCCCCGTGGAGAACTTGGCTGG - Intronic
1143466520 17:7140453-7140475 GCCTCCATGTTGAACATGCCTGG + Intergenic
1144438982 17:15264708-15264730 GCCACCATTGAGAACCAGGCAGG - Intronic
1147020290 17:37526220-37526242 TCCACCATGTGGAACATAGCTGG - Intronic
1149472433 17:56928398-56928420 GACACCTTGTAGTATTTGGCAGG - Intergenic
1149535616 17:57431303-57431325 GCCACCATGTAGGATGTGGGTGG + Intronic
1149616538 17:58005947-58005969 GCCTCCAAGTGGAAGTTGGCAGG - Exonic
1150719722 17:67604074-67604096 GCCTCCCTGTAAAACTTGGAAGG - Intronic
1152967819 18:132752-132774 GACACCATGTGGATCTTGGATGG + Intergenic
1153075473 18:1157184-1157206 GCCTCCATGTTGAACATGCCTGG + Intergenic
1154020275 18:10658538-10658560 GCCTCCATGTTGAACATGCCTGG + Intergenic
1156437397 18:37147296-37147318 GCCCACATGTTGAACTTGGCAGG - Intronic
1156437853 18:37152953-37152975 GCCTCCATGTTGAACATGCCTGG - Intronic
1158945421 18:62443309-62443331 GCCACATTGTAGAACTTCGGGGG - Intergenic
1159828427 18:73243613-73243635 GCCTCCATGTTGAACATGCCTGG - Intronic
1160019818 18:75171700-75171722 GACACCATGTAGAAACTGACTGG - Intergenic
1160114716 18:76066658-76066680 GCCTCCATGTTGAACACGGCTGG + Intergenic
1162880151 19:13652834-13652856 GCCTCCATGTTGAACATGCCAGG - Intergenic
1163066315 19:14798829-14798851 GCCTCCATGTTGAACATGACTGG + Intronic
1163066873 19:14803485-14803507 GTCACCATGTTGAACATGCCTGG + Intronic
1163733729 19:18965630-18965652 GCCCCCATGTTGAACATGCCAGG - Intergenic
1166384851 19:42375320-42375342 GCCACAGTGTAGACCTTGCCAGG - Intronic
1167164419 19:47788718-47788740 GCCTACCTGCAGAACTTGGCTGG + Intergenic
1167626339 19:50592185-50592207 GCCTCCATGTTGAACATGCCTGG + Intergenic
924971468 2:131861-131883 GTCACCATATACAACCTGGCAGG - Intergenic
925185535 2:1843832-1843854 GCCACCATGGAGGCCTGGGCTGG + Intronic
925437884 2:3857007-3857029 GCCACCATGAAGAAGCGGGCAGG - Intergenic
926999646 2:18780567-18780589 GCCCCCATGCAGCCCTTGGCTGG + Intergenic
929392983 2:41493528-41493550 GCCACCATGTTGAACTTACCTGG - Intergenic
930539058 2:52681315-52681337 GCCACCATGGTGGACTGGGCTGG - Intergenic
931691826 2:64840141-64840163 GCCTCCATCTGGAACTTTGCTGG - Intergenic
933094151 2:78157135-78157157 GCCTCCGTGTTGAACATGGCTGG - Intergenic
936087983 2:109482524-109482546 GACACCGTGGTGAACTTGGCCGG + Intronic
936777199 2:115988014-115988036 GCCACCAGGTAGAACATGAAGGG + Intergenic
938282430 2:130074037-130074059 GCCACATTGTAGAACTTTGGAGG + Exonic
938333059 2:130462609-130462631 GCCACATTGTAGAACTTTGGAGG + Exonic
938356752 2:130658062-130658084 GCCACATTGTAGAACTTTGGAGG - Exonic
938477233 2:131627451-131627473 GCCACATTGTAGAACTTTGGGGG - Intergenic
941860466 2:170273654-170273676 GTCACCATGTAGATAGTGGCAGG - Intronic
943487235 2:188501319-188501341 GCCTCCATGTAAGACTTGCCTGG + Intronic
948723695 2:239919170-239919192 GCCACCATGTGGACCTTCGGTGG + Intronic
1176046177 20:63093972-63093994 GCCTCCTTGGAAAACTTGGCTGG + Intergenic
1178339142 21:31770896-31770918 GAGACCATGTAGCACTTGGTAGG - Intergenic
1180477249 22:15722796-15722818 GCCACATTGTAGAACTTTGGGGG - Intergenic
1181336195 22:22131696-22131718 GCCACCATGTTGAACATGCCTGG + Intergenic
1182797001 22:32998193-32998215 GACACCATGTAGAAGTGGGTGGG + Intronic
1183195211 22:36348986-36349008 TCCACCTTGGAGAACTTGGGCGG + Exonic
1183910269 22:41073958-41073980 GCCACATTGTAGAACTTTGGGGG + Intergenic
949609157 3:5686404-5686426 GCCGCCATGTTGAACATGCCTGG + Intergenic
950499628 3:13355383-13355405 GCCACCATGTTGATCATGGCAGG - Intronic
957925774 3:86809209-86809231 GCCACCATGTAAGACGTGCCTGG + Intergenic
958762391 3:98325100-98325122 GCCTCCATGTTGAACATGCCTGG - Intergenic
959980692 3:112513370-112513392 GACACCTTATAGAATTTGGCAGG + Intergenic
961410059 3:126713842-126713864 GCCACCATTTAAAAGTTGGGAGG + Intronic
961660357 3:128465461-128465483 GCCATCATGGAGAACTGTGCAGG - Exonic
963518519 3:146337029-146337051 CCCACAAGGTAAAACTTGGCAGG - Intergenic
965087363 3:164115917-164115939 GCCGCCATGTTGAACATGCCTGG - Intergenic
966666863 3:182481130-182481152 GGCAACATGTAGATCTTGACTGG - Intergenic
967739942 3:192993999-192994021 GCAACCATGTAGACCTCGACTGG + Intergenic
975929127 4:79496611-79496633 GCCACCGTCTACAACTTTGCTGG + Intergenic
979718690 4:123872324-123872346 GCCAGCATGAAGAAAGTGGCAGG - Intergenic
981292552 4:143092824-143092846 GACACCTTGTAGTATTTGGCAGG - Intergenic
987736131 5:21845998-21846020 GCCTCCATGTTGAACATGCCTGG - Intronic
989486499 5:41997349-41997371 GCCACCATCAAGAACTTGAAAGG - Intergenic
991184510 5:63791802-63791824 GCCACTCTGTAGATATTGGCAGG - Intergenic
992543414 5:77786195-77786217 GCCACACTGTAGAACTTTGGGGG - Intronic
992801419 5:80299481-80299503 GCCACATTGTAGAACTTTGGGGG + Intergenic
993353377 5:86877058-86877080 GCCACTATGTTGAACATGCCTGG - Intergenic
995581270 5:113605772-113605794 GCCACCATGTTGAACATGACTGG - Intergenic
1000137627 5:158368078-158368100 GCCACCATGTGGGAATGGGCCGG + Intergenic
1000309977 5:160033018-160033040 GAAAGCAGGTAGAACTTGGCTGG - Intronic
1001612451 5:173013965-173013987 TCCACCATGTTGAACATGGTTGG - Intronic
1001731499 5:173963927-173963949 GCCTCCATGTTGAACATGCCTGG - Intergenic
1001791011 5:174458287-174458309 GTCACCATGTAGAATTTAGAAGG - Intergenic
1002186610 5:177457640-177457662 GCCTCCAGGTAGTACTGGGCTGG - Exonic
1003694338 6:8388261-8388283 GCCTCCATGTTGAACATGCCTGG + Intergenic
1005573981 6:27175104-27175126 GCCTCCATGAGGAACATGGCCGG - Intergenic
1008584917 6:52939913-52939935 CCCACTATGTTGAACTTGCCAGG - Intergenic
1011553860 6:88554686-88554708 GCCACCATCTTGAAATTGTCAGG - Intergenic
1013065108 6:106676541-106676563 GCCACCATTTTGAACATTGCTGG - Intergenic
1013293533 6:108738900-108738922 GCCGCCATTTTGAACATGGCTGG + Intergenic
1014110459 6:117615073-117615095 GACACCTTGTAGTATTTGGCAGG - Intergenic
1016663105 6:146604161-146604183 GCCACATTGTAGAACTTTGGGGG - Intronic
1022032441 7:26504687-26504709 GCCACCATGTTGAACATTCCTGG - Intergenic
1022717018 7:32907818-32907840 GCCTCCATGTTGAACATGCCTGG + Intergenic
1023000194 7:35800874-35800896 GCCGCCATGTTTAAGTTGGCCGG - Intergenic
1026117608 7:67509198-67509220 GCCTCCATGTTGAACATGCCTGG + Intergenic
1026211659 7:68311331-68311353 GCCGCCATGTTGAACATGCCTGG + Intergenic
1026519924 7:71107744-71107766 GCCACCATATTGAACATGCCTGG - Intergenic
1027488598 7:78793144-78793166 GCCACCATCTAGAGCTTTCCTGG - Intronic
1028001871 7:85508893-85508915 GCCACCATCTTGAACATGTCTGG + Intergenic
1028824300 7:95252073-95252095 GATACCATGGAGAACTTGGATGG + Exonic
1029521855 7:101067821-101067843 GCCACCATGCAGGGCTTGCCAGG + Intergenic
1034218452 7:149425694-149425716 GGGACCATGTAGTTCTTGGCTGG + Intergenic
1034290570 7:149927827-149927849 GCCACACTGTAGAACTTTGGGGG + Intergenic
1034660502 7:152765006-152765028 GCCACACTGTAGAACTTTGGAGG - Intronic
1036382404 8:8245517-8245539 GCCTCCATGTTGAACATGCCTGG - Intergenic
1036686839 8:10917374-10917396 TCCACCATGCAGCACTTGGCAGG - Intronic
1038858743 8:31362055-31362077 GCCGCCATGTTGAACATGCCTGG + Intergenic
1039961566 8:42252068-42252090 GCCTCCATGTTGAACATGCCTGG - Intergenic
1039980584 8:42406747-42406769 GCCTCCATGTTGAACATGCCTGG + Intergenic
1040027262 8:42793142-42793164 GCCTCCACGTTGAACATGGCTGG + Intronic
1041649308 8:60286105-60286127 GCCCCCATGTAGCACATGGTAGG + Intergenic
1043250916 8:78071959-78071981 GCCTCCATGTTGAACATTGCTGG + Intergenic
1046199395 8:110903239-110903261 GCCACCATGTAAGACTTGCCTGG - Intergenic
1047445095 8:124912554-124912576 GCCTCCATGTTGAACATGCCTGG - Intergenic
1048634375 8:136279978-136280000 GCCACCAGATAGGAGTTGGCTGG + Intergenic
1049542994 8:143216846-143216868 TCCACCAGGATGAACTTGGCAGG - Intergenic
1050196373 9:3088219-3088241 GCCTCCATGTTGAACCTGCCTGG - Intergenic
1050910618 9:11064976-11064998 GCCTCCATGTTGAACATGCCTGG - Intergenic
1052472143 9:28912990-28913012 GCCACCATAAAGAATGTGGCTGG - Intergenic
1058084350 9:100732540-100732562 GCCACATTGTAGAACTTTGGAGG - Intergenic
1058824180 9:108759982-108760004 GCCTCCATGTTGAACATGCCTGG - Intergenic
1059436604 9:114280901-114280923 GCCACCCTAGAGAACATGGCTGG + Intronic
1060157481 9:121329764-121329786 GCCATTATGTAGGACTTGGCAGG + Intronic
1185889046 X:3808230-3808252 GCCTCCATGTTGAACGTGCCTGG + Intergenic
1187816365 X:23236776-23236798 GACACCTTGTAGTACTTGTCAGG - Intergenic
1187941604 X:24388044-24388066 GCCTCCATGTTGAACATAGCTGG + Intergenic
1189949902 X:46218157-46218179 GCCACCATGTACAGCTGTGCAGG - Intergenic
1189957178 X:46287792-46287814 GCCACATTGTAGAACTTTGAGGG + Intergenic
1194388021 X:93281054-93281076 GCCACCATGTAGAACATTTCAGG + Intergenic
1196772845 X:119312292-119312314 GACACCTTGTAGTATTTGGCAGG - Intergenic
1199201261 X:145092352-145092374 GCCACCATCTCAAACTTTGCTGG + Intergenic
1199476867 X:148255369-148255391 CCCCACATGTAGAACCTGGCAGG + Intergenic
1200773021 Y:7144715-7144737 GCCTCCATGTTGAACGTGCCTGG - Intergenic
1201276560 Y:12304116-12304138 GCCTCCATGTTGAACGTGCCTGG - Intergenic