ID: 1103716942

View in Genome Browser
Species Human (GRCh38)
Location 12:122950387-122950409
Sequence CTCCCTTCCCTCCCTGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 724
Summary {0: 1, 1: 0, 2: 7, 3: 77, 4: 639}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103716929_1103716942 17 Left 1103716929 12:122950347-122950369 CCAGGGCCTCCCTGGCCCCTGTC 0: 1
1: 1
2: 11
3: 77
4: 746
Right 1103716942 12:122950387-122950409 CTCCCTTCCCTCCCTGGTGCAGG 0: 1
1: 0
2: 7
3: 77
4: 639
1103716927_1103716942 29 Left 1103716927 12:122950335-122950357 CCAGGGGCATTTCCAGGGCCTCC 0: 1
1: 2
2: 8
3: 41
4: 358
Right 1103716942 12:122950387-122950409 CTCCCTTCCCTCCCTGGTGCAGG 0: 1
1: 0
2: 7
3: 77
4: 639
1103716933_1103716942 7 Left 1103716933 12:122950357-122950379 CCTGGCCCCTGTCTTCCTTAGGA 0: 1
1: 0
2: 0
3: 26
4: 243
Right 1103716942 12:122950387-122950409 CTCCCTTCCCTCCCTGGTGCAGG 0: 1
1: 0
2: 7
3: 77
4: 639
1103716938_1103716942 -8 Left 1103716938 12:122950372-122950394 CCTTAGGAACAGGCCCTCCCTTC 0: 1
1: 0
2: 0
3: 14
4: 168
Right 1103716942 12:122950387-122950409 CTCCCTTCCCTCCCTGGTGCAGG 0: 1
1: 0
2: 7
3: 77
4: 639
1103716937_1103716942 0 Left 1103716937 12:122950364-122950386 CCTGTCTTCCTTAGGAACAGGCC 0: 1
1: 0
2: 1
3: 13
4: 131
Right 1103716942 12:122950387-122950409 CTCCCTTCCCTCCCTGGTGCAGG 0: 1
1: 0
2: 7
3: 77
4: 639
1103716931_1103716942 8 Left 1103716931 12:122950356-122950378 CCCTGGCCCCTGTCTTCCTTAGG 0: 1
1: 0
2: 1
3: 30
4: 278
Right 1103716942 12:122950387-122950409 CTCCCTTCCCTCCCTGGTGCAGG 0: 1
1: 0
2: 7
3: 77
4: 639
1103716934_1103716942 2 Left 1103716934 12:122950362-122950384 CCCCTGTCTTCCTTAGGAACAGG 0: 1
1: 0
2: 1
3: 15
4: 195
Right 1103716942 12:122950387-122950409 CTCCCTTCCCTCCCTGGTGCAGG 0: 1
1: 0
2: 7
3: 77
4: 639
1103716936_1103716942 1 Left 1103716936 12:122950363-122950385 CCCTGTCTTCCTTAGGAACAGGC 0: 1
1: 0
2: 1
3: 11
4: 153
Right 1103716942 12:122950387-122950409 CTCCCTTCCCTCCCTGGTGCAGG 0: 1
1: 0
2: 7
3: 77
4: 639
1103716930_1103716942 11 Left 1103716930 12:122950353-122950375 CCTCCCTGGCCCCTGTCTTCCTT 0: 1
1: 0
2: 6
3: 104
4: 976
Right 1103716942 12:122950387-122950409 CTCCCTTCCCTCCCTGGTGCAGG 0: 1
1: 0
2: 7
3: 77
4: 639

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103716942 Original CRISPR CTCCCTTCCCTCCCTGGTGC AGG Intronic
900266509 1:1759906-1759928 CTCCCTGCACTTCCTGGTCCTGG - Intronic
900272164 1:1796617-1796639 CGCCCCTCCTCCCCTGGTGCGGG + Intronic
900482340 1:2905322-2905344 CTCCCTACCCACTCAGGTGCAGG + Intergenic
900569510 1:3351457-3351479 CTCCTTCCCATCCCTGGTCCTGG + Intronic
900604224 1:3516643-3516665 CGCCCTCCCCTCCATGGTGCCGG - Intronic
900610388 1:3542179-3542201 CTGCCTTCCCACACTGGGGCTGG - Intronic
901766561 1:11503561-11503583 CTCTCTTTCCCCCCTGGAGCTGG - Intronic
902295422 1:15463543-15463565 CTCCCTTCCCTCCCAGGCCTGGG - Intronic
902298314 1:15483421-15483443 CTCCCTTCCCTCCCAGGCCTGGG - Intronic
902391979 1:16112272-16112294 CTCCCATCTCCCCCTGGGGCTGG + Intergenic
902817879 1:18926414-18926436 CTGCCTCCCCTCCCTGGCCCAGG - Intronic
903589165 1:24441172-24441194 CTGCTCTCCCTCCCTGGAGCAGG + Intronic
903773456 1:25778391-25778413 CTCCCTTCGCTCACTGCTGCCGG - Intronic
904311794 1:29633955-29633977 CTCCCCTCCTTCCCTGAGGCTGG + Intergenic
904321079 1:29698200-29698222 CTCCACTCCCTCCCTGCGGCTGG - Intergenic
904402031 1:30263237-30263259 CTCTCTTCCTTCCATGGGGCAGG - Intergenic
904418973 1:30379361-30379383 CTCCCTCCCCTCCCATGCGCTGG + Intergenic
904431982 1:30470185-30470207 CTCCTGTCCCATCCTGGTGCAGG - Intergenic
904629966 1:31833663-31833685 CTTCCTTCCCTTCCTGGGACTGG + Intergenic
904860989 1:33537502-33537524 CTGCCATCCCCCTCTGGTGCTGG - Exonic
905557654 1:38899866-38899888 CTCGCTGCCCTTCCTGGGGCAGG + Intronic
905863710 1:41365952-41365974 TTCCCTTCTCTCCCAGGGGCTGG + Intronic
905925052 1:41743728-41743750 CTCTCTTCCCTCTCTGGTCCTGG + Intronic
906125038 1:43422555-43422577 CTCCCTGACCTCTCTGCTGCGGG + Exonic
906196304 1:43932689-43932711 CTGCCTTTCCTCCCAGGAGCCGG + Intergenic
907172921 1:52487652-52487674 CACCTTGCCCTCCCAGGTGCTGG - Intronic
907249275 1:53127409-53127431 CTCACCTCTCTCCCTGGAGCCGG - Intronic
907319033 1:53591266-53591288 CTCCCTCTCCTCCATGATGCTGG - Intronic
907957733 1:59246960-59246982 TTCCTTTCCCTCCCTTGTCCAGG + Intergenic
911765139 1:101665105-101665127 CGCCTTTCCCTCCCTTGTGCAGG + Intergenic
912450122 1:109763457-109763479 CCCTCTTCCCTCCCTGGGGTAGG - Intronic
912716962 1:111989866-111989888 CTCCCTTCCCCCGCCGCTGCCGG + Intergenic
912719545 1:112007980-112008002 CTCCCTTCCCTCCATGACTCAGG + Intergenic
913572170 1:120131715-120131737 CTCCCTCCCCTCCATGGAGAGGG + Intergenic
914293090 1:146293359-146293381 CTCCCTCCCCTCCATGGAGAGGG + Intergenic
914554134 1:148744142-148744164 CTCCCTCCCCTCCATGGAGAGGG + Intergenic
914844506 1:151274476-151274498 CTCCCTTCCCTTCCTGCCTCTGG - Intergenic
915288315 1:154866900-154866922 CCCTCTTCCCTGCCTGGGGCAGG - Intronic
915733312 1:158069083-158069105 CCCCATTCCCTCTCTGGTTCCGG + Intronic
916056294 1:161070866-161070888 TTCCCTTCCCTCCCAGCTACAGG + Intergenic
916684005 1:167128160-167128182 CTCTCTGCCCTCCCTGGTGGAGG - Exonic
916899601 1:169206410-169206432 CTCCCTACCCTCCGTGTTCCAGG - Intronic
917513053 1:175683951-175683973 CTCCCTTCCCACCTTGGGACTGG - Intronic
918107282 1:181425790-181425812 CTTCATTCCCTCCCTGCTACAGG - Intronic
919024929 1:192156011-192156033 CTCTCTTCACTCCTTTGTGCAGG - Intergenic
919812024 1:201414695-201414717 CTCCCCTCATTCCCTGATGCCGG - Intronic
920195402 1:204223191-204223213 CTCCATTCCCTGCCTGCTTCTGG + Intronic
920314199 1:205065992-205066014 CTCCCTTCCCTCAAAGCTGCGGG + Intronic
920379002 1:205525041-205525063 ATCCCTTCCCTCCCAGAGGCTGG + Intronic
920415846 1:205798957-205798979 CTTCATTGCCTCCCTGGTACTGG - Exonic
920929044 1:210369738-210369760 CTCCCTTCAGTCCCTGCCGCTGG - Intronic
920965645 1:210698598-210698620 CTCCCTCCCCTCCGTGATTCTGG - Intronic
921046161 1:211479321-211479343 CTCCCCTCCCGCCCAGGTTCCGG - Exonic
921046900 1:211484214-211484236 CACCTTTCCATCCCTGGGGCTGG + Intronic
922592347 1:226786861-226786883 CTCCCCTTCCTCCCTGGAGGAGG + Intergenic
922773987 1:228206759-228206781 CTTCTTTGGCTCCCTGGTGCTGG + Intronic
922919914 1:229293645-229293667 CTGCCTCCCCTCCATGGGGCAGG - Intronic
923957488 1:239039432-239039454 CTTCCTTACCTCCCTTGTGGAGG - Intergenic
1062834417 10:626491-626513 CTCCATCCCATCCCTGGTGTTGG + Intronic
1062969520 10:1635650-1635672 CTCCCTTCCCTCCCTGTGAACGG + Intronic
1064954166 10:20888619-20888641 CTCCCCTCTCCCCCTGGAGCAGG - Intronic
1065464290 10:26002396-26002418 CCCCTTCCCCTCCCTTGTGCAGG - Intronic
1067067361 10:43111473-43111495 CGACCCTCCCTCCCTGGAGCAGG - Intronic
1067098376 10:43317132-43317154 CTGCCTTCCTTCCCTGTGGCTGG + Intergenic
1067269055 10:44773832-44773854 CTCCCCTCCTGCCCTGCTGCAGG + Intergenic
1067455835 10:46418734-46418756 CTCCCTCTCCTCCCTGAGGCCGG + Intergenic
1067631365 10:47965905-47965927 CTCCCTCTCCTCCCTGAGGCCGG - Intergenic
1067708962 10:48633704-48633726 CAGCCCTCCCTCCCTGCTGCTGG - Intronic
1067750531 10:48968491-48968513 CTCCCTTCCTTGCCCTGTGCTGG - Intronic
1068946868 10:62738538-62738560 CTTCCTACCCTCCCAGGTGAGGG + Intergenic
1069403424 10:68074545-68074567 CTCATTTCCCTACCTGTTGCTGG - Intronic
1069561378 10:69432907-69432929 CTCCATGCCATTCCTGGTGCTGG - Intergenic
1069708578 10:70474846-70474868 CTCCCTTCCCTGCCAGGCCCTGG - Intergenic
1069989875 10:72308648-72308670 CTCCCTTCCCTCTGTGGAGCTGG - Intergenic
1069997824 10:72354005-72354027 CACTCTTCCCTCCCTGGCTCAGG + Intronic
1070314293 10:75295391-75295413 CTCCCGCCCCTCCCTGGCCCTGG - Intergenic
1070436374 10:76397617-76397639 GTGCCTTCGCTTCCTGGTGCTGG + Intronic
1070609012 10:77920724-77920746 CTCCCTTTCTTCCCTGGTCAGGG + Intronic
1071531026 10:86390352-86390374 CTGCCTCCACTCCCTGGTCCAGG - Intergenic
1071871524 10:89800418-89800440 CTTCCTTCCCTCCTTTGTGGAGG - Intergenic
1072799894 10:98385545-98385567 CTCCCTTCTCAGCCTGGGGCTGG - Intronic
1072989655 10:100179835-100179857 GTCCCTTACCTGCCTGGAGCTGG + Intronic
1073449029 10:103598681-103598703 CTCCCTCCTCTGCCTGCTGCCGG + Exonic
1073455779 10:103635929-103635951 CTCCCTTCCCTGCCCTGAGCTGG - Intronic
1073566058 10:104536626-104536648 CTCTCTTCTCTCCCTGGTTCTGG - Intergenic
1074087647 10:110220600-110220622 CTCCCTCCCCTGCCAGGAGCTGG - Intronic
1074445114 10:113515146-113515168 CTCCCTTCCCTCCCTGCCTCTGG + Intergenic
1074813917 10:117130811-117130833 CTCCCTTCCCTCCCTGGCTTTGG - Intronic
1074823514 10:117198671-117198693 CTCCCCTCCCACTCTGGTGTGGG + Intronic
1075080705 10:119381751-119381773 CTCCCCTCCCCGCCAGGTGCAGG + Intronic
1075562092 10:123475222-123475244 AGCACTTCCCTCCTTGGTGCAGG - Intergenic
1075672283 10:124270781-124270803 CCCCCTTCCCTACCTGATGGGGG + Intergenic
1075871950 10:125777647-125777669 TGCCCTTTCCTCCCTGGTGAAGG + Intergenic
1075992045 10:126846491-126846513 CTCCCTCCCGTCCCTGTTCCAGG - Intergenic
1076055652 10:127370119-127370141 CTGCCTTCTCTCCCTGGGTCGGG - Intronic
1076168287 10:128299725-128299747 CTCCCTCTCCTCCTTGCTGCAGG + Intergenic
1076221808 10:128739791-128739813 GTCCCCTCCCTTCCTGGTGGCGG + Intergenic
1076411078 10:130251280-130251302 TTCCCTGCCCTCCCTGATGGAGG - Intergenic
1076559254 10:131350389-131350411 CTTCCTTCACTCCCGGGAGCAGG - Intergenic
1076764395 10:132625133-132625155 CTTCCTTCCCTCCCTCCAGCTGG + Intronic
1077125490 11:933685-933707 CGCCTCTCCCACCCTGGTGCTGG - Intronic
1077411370 11:2405417-2405439 CTGCCTTCCCTGCCTGGCCCGGG - Intronic
1077470784 11:2759574-2759596 CTCCCTTCCTTCCCACATGCTGG - Intronic
1077773818 11:5249676-5249698 CTTCCTTCCCTCCCTTGTCCTGG + Intronic
1077774321 11:5254600-5254622 CTTCCTTCCCTCCCTTGTCCTGG + Intronic
1078135635 11:8649548-8649570 CTCTCGTCCCTCCCTGTTGATGG - Intronic
1078147209 11:8730220-8730242 CTGCCTTCCCTCTCTGGGGGTGG + Exonic
1078458061 11:11491093-11491115 ATCACTTCTCTCCCTGGTCCAGG + Intronic
1078640956 11:13095629-13095651 CTACCTTCCCTATATGGTGCTGG - Intergenic
1078943404 11:16034659-16034681 CTCCCTTCCCTTTGTGGTGTTGG - Intronic
1079295464 11:19229575-19229597 GCCCCTTGCCTCTCTGGTGCTGG + Exonic
1079373517 11:19871909-19871931 CTGCCTTGCCTCCTTGGTGAGGG + Intronic
1079705235 11:23607466-23607488 CTCCCTTTCCTCCCAGCTTCTGG - Intergenic
1080715146 11:34792806-34792828 CTCATTTCCCTTCCTGGTTCAGG - Intergenic
1081630599 11:44686989-44687011 TTCCCTTCCCTCCAATGTGCTGG + Intergenic
1081956194 11:47096352-47096374 CTCCTTTCCCTCCCAGGCCCTGG + Intronic
1082816323 11:57512266-57512288 CTGCCTTCTCCACCTGGTGCTGG - Intronic
1082952300 11:58830642-58830664 CTCCCCTCCCTCCCAGATCCTGG - Intergenic
1083213261 11:61202629-61202651 CTGCCTTCCCTTCCTGGAGGAGG - Intergenic
1083216140 11:61221374-61221396 CTGCCTTCCCTTCCTGGAGGAGG - Intergenic
1083219024 11:61240200-61240222 CTGCCTTCCCTTCCTGGAGGAGG - Intergenic
1083331922 11:61902684-61902706 CTCCCTTCTCTGCCTGGCTCTGG - Intronic
1083527504 11:63383180-63383202 CTCCCTTCCCTCCCTCCTGAGGG - Intronic
1083727018 11:64633978-64634000 CTTCCTTCACACCCTGGTGTTGG + Intronic
1083903867 11:65657584-65657606 ACCCCTTCCCTTCCAGGTGCTGG + Intronic
1083946381 11:65925309-65925331 GTCCCTCCCCTCTTTGGTGCAGG + Intergenic
1084007261 11:66329972-66329994 CTCCCTGCCCTCCCCAGTGATGG - Intergenic
1084383117 11:68826057-68826079 CCGCCTTCCCTCCCTGGCCCTGG + Intronic
1085269626 11:75262652-75262674 ATCCCTTCCCTGCCTGACGCAGG - Intergenic
1085454544 11:76658352-76658374 CTTCCTTTCCACCCTGGTGTGGG - Exonic
1088135553 11:106552259-106552281 AGCCCCTCCCTCCCAGGTGCAGG + Intergenic
1088920668 11:114258031-114258053 CTCTCCTCCCTGCCTGGGGCAGG + Intronic
1088921833 11:114265042-114265064 CTCCCTTCCCTGGATGTTGCAGG + Intronic
1089002003 11:115059930-115059952 CCCCCTTCCCTGCCTGGCCCTGG + Intergenic
1089392124 11:118109199-118109221 CTGCCTCCCATCCCTGGTCCGGG + Intronic
1089555233 11:119312402-119312424 TTCCTCTGCCTCCCTGGTGCTGG + Exonic
1089671891 11:120062444-120062466 CTCCCATCCCTCCCTCCTCCGGG - Intergenic
1089681595 11:120121829-120121851 CTCCCTTCCATCCATGGACCAGG - Intronic
1089695848 11:120215926-120215948 CTCCCTATCCTCCCTGATGCTGG - Intronic
1089826366 11:121281634-121281656 CTCCCTACCCACCCTGGTAGGGG - Intergenic
1089845056 11:121452056-121452078 CTCCGGCCCCTCCCTGGCGCGGG - Intergenic
1090357495 11:126149896-126149918 CTCCCTTCCCTCTTTAGTGTGGG + Intergenic
1090373566 11:126273510-126273532 CTCGCTTCCTAACCTGGTGCAGG - Intronic
1090656579 11:128850424-128850446 CTCTGTTCTCTGCCTGGTGCTGG - Intronic
1090669960 11:128939206-128939228 CTCCCTTCCCCATCTGGTTCTGG + Intronic
1090928853 11:131277636-131277658 CTACCTTCCTTCCCAGCTGCAGG + Intergenic
1090935555 11:131338754-131338776 CCCACTTCCCACCCTGGTTCAGG + Intergenic
1091585762 12:1815708-1815730 GTCCCTTCCCTCCCAGCTTCAGG + Intronic
1091601580 12:1921206-1921228 CTTCCTTCCCTGACTGGTGGAGG + Intergenic
1091997857 12:5009180-5009202 ATCCCTTCCCACCCAGTTGCAGG + Intergenic
1092776671 12:11949872-11949894 AGCCCTTCCCTCCCTGCTTCTGG - Intergenic
1093389612 12:18602435-18602457 CTCCCTACCCACCCTGGTAGTGG + Intronic
1094603269 12:31929264-31929286 CACTCTTCTCTCCCTGGTACTGG + Intergenic
1096155088 12:49337160-49337182 CTCCCCTCCCTCCCGGGCGCGGG + Exonic
1096526586 12:52213548-52213570 CTCTCTTCCCTCCTTGAGGCTGG + Intergenic
1096694721 12:53341199-53341221 CTGCCTTGCAGCCCTGGTGCTGG - Intronic
1097203470 12:57299878-57299900 GTCCCCCTCCTCCCTGGTGCAGG + Intronic
1097357201 12:58614966-58614988 CTCCATTCCCTGCTTGTTGCTGG + Intronic
1100338506 12:93655710-93655732 CTCCCTTCCCTGCCCTGTGAAGG + Intergenic
1100565227 12:95789447-95789469 CTCCTCTCCCTCCCTCTTGCGGG - Intronic
1101654321 12:106706440-106706462 CTCCCTTTTCTCCCTAGTTCAGG - Intronic
1102058716 12:109915932-109915954 CTCCCCTCCCTCCCTCCTGTGGG + Intronic
1102496164 12:113320808-113320830 CTGCCCTCCCTCCAGGGTGCAGG + Intronic
1102596080 12:113993597-113993619 CTCCCTTCCCCCCTTGGTCAAGG + Intergenic
1102647279 12:114412002-114412024 CTCCTGTGGCTCCCTGGTGCTGG + Intergenic
1102739677 12:115196089-115196111 CTCCCATGCCTCCCATGTGCTGG + Intergenic
1103409439 12:120700279-120700301 GTCCCTTCCCTCCCCTTTGCTGG + Exonic
1103449495 12:121018450-121018472 CTCCCCTCCCTCCTTGGGCCCGG - Intergenic
1103556808 12:121771338-121771360 CGCCCTTCTATCCCTGGGGCTGG - Intronic
1103716942 12:122950387-122950409 CTCCCTTCCCTCCCTGGTGCAGG + Intronic
1104053834 12:125214530-125214552 ATCCCTTCCCTCCCTGCTCCAGG - Intronic
1104286951 12:127432286-127432308 CACCCTCCCCTCCCCGCTGCAGG - Intergenic
1104323236 12:127771967-127771989 TTCCCTTCCCTCCTTGGTGGTGG - Intergenic
1104695078 12:130857302-130857324 CTCCTTCCCCTCCCTTGTCCAGG + Intergenic
1104763530 12:131312440-131312462 CTCCGTGCCCACCGTGGTGCTGG - Intergenic
1104815972 12:131645637-131645659 CTCCGTGCCCACCGTGGTGCTGG + Intergenic
1105316060 13:19264865-19264887 CTTCCTTCCCTCCCAGATCCAGG + Intergenic
1105439849 13:20405914-20405936 ATTCCTCCCCTCCCTGCTGCCGG + Intronic
1105685267 13:22774908-22774930 GTCCCTACCCTTCCTGGTGGAGG - Intergenic
1106050629 13:26186730-26186752 TTCCCTGCCCTCCCCGGAGCCGG - Intronic
1106072472 13:26425866-26425888 CTTCCTCCCTTCCCTGGAGCTGG - Intergenic
1106207465 13:27613266-27613288 CACCCTCCCCTCCCTGCTGCAGG - Intronic
1106396230 13:29383632-29383654 CCACCTTCCCTCCCTTTTGCAGG + Intronic
1106629099 13:31451998-31452020 CTCTATTGCCTCCCTGGTTCTGG + Intergenic
1107429887 13:40330913-40330935 CCCCTTTCCCTCCCTTGTCCAGG - Intergenic
1107541567 13:41393926-41393948 CCCCTTTCCCTCCCTTGTCCAGG + Intergenic
1107662338 13:42651533-42651555 CTCCCTTCCCCTCCTTCTGCAGG + Intergenic
1107730508 13:43343724-43343746 CTCCATTCCATACCAGGTGCAGG - Intronic
1107815788 13:44243290-44243312 CTTCTTTCCCTCCCTGCCGCAGG - Intergenic
1107997571 13:45875968-45875990 CCCCTTTCCCTCCCTTGTCCAGG - Intergenic
1109459931 13:62643388-62643410 CACCTTTCCCTCCCTTGTCCAGG + Intergenic
1110405390 13:75144888-75144910 CACCCTTCCCTTCCAAGTGCTGG + Intergenic
1111678414 13:91415056-91415078 CTACCTTGCCTCCCTGTTGCTGG + Intronic
1113037054 13:106062054-106062076 CTCCCTGCCCTCCAAGGTGGAGG + Intergenic
1113376620 13:109770118-109770140 CTCCCTGCCCTCCATGGTGGTGG - Intronic
1113432786 13:110264966-110264988 TTCCCCTCCTTCCCTGTTGCTGG + Intronic
1113861415 13:113490187-113490209 CTCCCTCCCCTCCCGGCAGCAGG + Intronic
1114434949 14:22698444-22698466 ATCCCTTCCCTCCCAGGGCCGGG - Intergenic
1115524945 14:34270577-34270599 CTCCCTTCACTCCCATCTGCTGG - Intronic
1115928914 14:38468186-38468208 CTCACTGCCTTCCTTGGTGCAGG + Intergenic
1116846404 14:49868291-49868313 CTCCCTCCCCTCCCAGTTGCTGG - Intergenic
1117348150 14:54854362-54854384 CTTCCTGCCCTCCCTGCTGCAGG - Intronic
1117647285 14:57865680-57865702 CTCCCTTCCCCGCCTCGCGCAGG + Intronic
1118467246 14:66042129-66042151 CTCCTCTCCCTCACTGGTTCTGG - Intergenic
1118908038 14:70037216-70037238 CTCCCTAGCCACCCTGATGCTGG + Intergenic
1119338106 14:73851789-73851811 CCCCCTCCCCTCCCAGGGGCGGG - Intergenic
1120395727 14:83964737-83964759 CCCCTTTCCCTCCCTTGTCCAGG + Intergenic
1120852568 14:89184677-89184699 CTCCATTTCCTCACTGGTGAAGG + Intronic
1120986615 14:90340830-90340852 CTACCTTCACTCCCTGGAGGTGG - Intergenic
1121098373 14:91233514-91233536 TTCCCTTCCCACCCTGTTGTGGG + Exonic
1122505149 14:102227362-102227384 CCCCCAGCCCTCCCTGCTGCTGG + Intronic
1122542115 14:102504491-102504513 CTCGCTGCCCTTCCTGGGGCAGG + Exonic
1122543542 14:102510303-102510325 CGCCCCTCCCTCCCTTGCGCGGG - Intergenic
1122780342 14:104140818-104140840 CCCCCTTCCCTAGCTGGCGCTGG + Intronic
1122903574 14:104792005-104792027 CTCCCATCCCACCCAGCTGCTGG + Intronic
1123020824 14:105397146-105397168 CTGCCCAACCTCCCTGGTGCTGG - Exonic
1124145166 15:27118248-27118270 GTCCCTTCCCTCTCTGTTCCAGG - Intronic
1124251029 15:28106692-28106714 CTCCCTGCGCTCGCTGTTGCCGG - Intergenic
1124751715 15:32375573-32375595 TTACCTTCCCACCCTAGTGCAGG + Intergenic
1125002523 15:34786180-34786202 CCCCCTCCCCTCCCTGGTTGAGG - Intergenic
1125518093 15:40334078-40334100 CTTTCTTCCCTCCCTCCTGCTGG + Exonic
1126436245 15:48641319-48641341 CTCTCCTCCCCCCCTGTTGCAGG - Intronic
1126453246 15:48833507-48833529 CTCCCCTCCCTCCCTTCTGAAGG + Intronic
1126685645 15:51246701-51246723 CTGCCTCCCCTCCCTGTGGCAGG - Intronic
1127262976 15:57339202-57339224 CTCCCTTCCCCTCCTGATTCTGG - Intergenic
1127903054 15:63355243-63355265 CACCCTCCCCTCGCTGGGGCAGG + Intronic
1129207282 15:74044696-74044718 CTCCCTGCAGCCCCTGGTGCAGG + Exonic
1129298013 15:74610373-74610395 CTCCCTGGCCTGCCTGGAGCAGG - Intronic
1129778659 15:78254339-78254361 CTCCCTGACCACCCTGGTGGAGG + Intergenic
1129786137 15:78311329-78311351 CCCCCTTGCCTCCCAAGTGCAGG - Intergenic
1130287798 15:82570299-82570321 TTCCCTTCCCTCCCTGGTCCAGG - Intronic
1130552939 15:84903554-84903576 AACACTTCCCTCCCTGGGGCTGG - Intronic
1131300601 15:91196487-91196509 CTGCCTTCCCTTCATAGTGCTGG - Intronic
1131547191 15:93325672-93325694 CACCCTTCCCACCCTTGTGCTGG + Intergenic
1132209630 15:100010396-100010418 CTTCCTTCTCTCCGTGGTGCAGG + Intronic
1132783405 16:1641375-1641397 CTTCCTTCCCTCCCCGGGGCAGG - Intronic
1132826425 16:1907714-1907736 CTCCCTCCCTCCCCTGGGGCAGG - Intergenic
1132924882 16:2424144-2424166 CTCCCTTCCACCCCCGGTGGTGG + Intergenic
1133224686 16:4335253-4335275 CCCCCCGCCCTCCCTGGAGCAGG + Exonic
1133318654 16:4899440-4899462 CTTCCTTCCCTACCTCCTGCAGG + Intronic
1133416353 16:5610105-5610127 CTCCCTGCCCTCCCAGTGGCAGG - Intergenic
1133765012 16:8831919-8831941 CCCCCTTCCCTCCCTTCTCCAGG + Intronic
1134066441 16:11231570-11231592 TTCCCTTCCCTCCTTGTTTCAGG + Intergenic
1134631099 16:15756704-15756726 CTGCCTTCCATCCCTGTTACTGG - Intronic
1136588373 16:31202237-31202259 TTCCCTTCCCGCCGTGGGGCCGG + Intronic
1137441012 16:48498455-48498477 CTCCATTTCCACCCTGGTGGGGG - Intergenic
1138442409 16:57042901-57042923 CTTCCTTCCTTCCCAGGTGCAGG - Intronic
1138614623 16:58155276-58155298 AGCCCTTCCCTCACTGGTGCAGG - Intergenic
1138998912 16:62484886-62484908 CCCCCTTCCCTCCCTGGAAAGGG + Intergenic
1139334806 16:66224295-66224317 CTCCCTTCCCACCCCTTTGCTGG + Intergenic
1139365336 16:66429081-66429103 CTCCCTCCACTCCCGGGTGGAGG + Intronic
1139402837 16:66696267-66696289 CTCCCTCCCCGCCCCGCTGCGGG - Intronic
1139719930 16:68844032-68844054 CGCCCTACCCTCTCTGGAGCTGG - Intronic
1140393206 16:74606438-74606460 CTTATTTCCCTCCCTGTTGCCGG - Intronic
1140968968 16:79994581-79994603 CTTCCTTCCCACCATGGAGCAGG + Intergenic
1141094885 16:81156083-81156105 TTCCCTCCCTTCCCAGGTGCAGG + Intergenic
1141300873 16:82814399-82814421 CTCCCTTTCCTCCCTGGAGGTGG - Intronic
1141608161 16:85167319-85167341 CTCCCTTTCCTCTCTAGAGCAGG - Intergenic
1142134724 16:88446405-88446427 CTCGCTCCCCTGCCTGGTGAAGG + Intergenic
1142605523 17:1079000-1079022 CTCCCTCCCCTCCCCCTTGCTGG - Intronic
1142738588 17:1917414-1917436 CTCCCTACACTCGCTGGGGCTGG - Intergenic
1143031560 17:3970844-3970866 CTCCCTTAGCTCCCTAGTACTGG + Intergenic
1143055820 17:4161006-4161028 GTCTCTGCCCTCCCTGGGGCAGG + Intronic
1143405804 17:6676604-6676626 CTTCCCTCCCTCCCTGACGCTGG + Intergenic
1143446822 17:7014785-7014807 CTCCCTGCTCTCCGTGGTCCCGG + Exonic
1143668989 17:8383529-8383551 GTACCTTCACTCCCAGGTGCCGG + Intergenic
1144698149 17:17319709-17319731 CTCCCGTCCCTCCCTGCCCCTGG - Intronic
1144734365 17:17546673-17546695 CTCCCTGTCCACCCTGGGGCTGG + Intronic
1144873221 17:18382983-18383005 CTCTCTCCCCACCCTGCTGCTGG + Intronic
1144874626 17:18390971-18390993 CCTCCTTCCCACCCTGGTCCAGG + Intergenic
1144915533 17:18720936-18720958 CTCTCTTCCCTCTCCAGTGCAGG - Intronic
1145157601 17:20553450-20553472 CCCCCTTCCCACCCTAGTCCAGG - Intergenic
1145941358 17:28744851-28744873 CTCCCCTCTCTCCCGGGGGCTGG + Intronic
1146064472 17:29623530-29623552 CTCCCTCCCCTCCCAGATGCAGG + Intergenic
1146064553 17:29623924-29623946 CTCCCTTTCCTCCCCAGTGCTGG - Intergenic
1146400673 17:32497913-32497935 CTCAGTCCCCTCCCTGGTGGTGG + Intronic
1146448778 17:32954959-32954981 CTCCCTTCCCTTCCAGGTAGAGG + Intergenic
1146612578 17:34320671-34320693 CTCCCTCCTCTCCCGGGTCCGGG + Intronic
1147212302 17:38878793-38878815 ATCTCTTCCCTGCCTGGTGAGGG + Intronic
1147361883 17:39935998-39936020 TCCCCTTCCCTCCCTGATGTTGG - Intergenic
1147566459 17:41539249-41539271 CCCCCGTGCCTCCCTGGTGCTGG - Intergenic
1147570550 17:41567932-41567954 AGCCCTCCCCTCCCTGGAGCAGG + Intronic
1147757621 17:42779444-42779466 CTCCCTTCTCAGGCTGGTGCTGG + Exonic
1148051057 17:44770069-44770091 CTCCCTTCCATCCCCGGCCCCGG - Intronic
1148203049 17:45762730-45762752 CACCTTCCCCTGCCTGGTGCTGG - Intergenic
1150282469 17:63937408-63937430 CTGTCTTCCCTCCCTGGAGTGGG - Intergenic
1151475674 17:74343191-74343213 CTGGCCTCCCTCCCTGGGGCTGG + Intronic
1152207911 17:78985099-78985121 CTGTCTTCCCACCATGGTGCTGG - Intergenic
1152338171 17:79709711-79709733 GCCCCTCCCCTCCCTGATGCTGG + Intergenic
1152338198 17:79709798-79709820 GCCCCTCCCCTCCCTGATGCTGG + Intergenic
1152338239 17:79709929-79709951 GCCCCTCCCCTCCCTGATGCTGG + Intergenic
1152338254 17:79709973-79709995 GCCCCTCCCCTCCCTGATGCTGG + Intergenic
1152338283 17:79710061-79710083 GCCCCTCCCCTCCCTGATGCTGG + Intergenic
1152338326 17:79710192-79710214 GCCCCTCCCCTCCCTGATGCTGG + Intergenic
1152343983 17:79740507-79740529 ATCACTTCCCTGCCTAGTGCTGG - Intronic
1152461027 17:80442551-80442573 CTCCCATCCGTGCCTGGTCCAGG - Intergenic
1152702260 17:81824979-81825001 GACCCTGCTCTCCCTGGTGCAGG + Exonic
1152743382 17:82028367-82028389 GCAGCTTCCCTCCCTGGTGCCGG + Intronic
1155173011 18:23280957-23280979 CTGCCTTCCCTACCTGGGGGTGG - Intronic
1157256452 18:46143873-46143895 CTGCCTCCCCTCCCAGGTTCAGG + Intergenic
1157481089 18:48054261-48054283 CGCCCTTCCCTCCCTGCTCCAGG - Intronic
1158940839 18:62405018-62405040 GTCCCTTCCCACACTGATGCTGG + Intergenic
1159726471 18:71966669-71966691 CTCCCTTACTTGTCTGGTGCTGG + Intergenic
1160328148 18:77969078-77969100 CTGTCTTCCCTCCCAGGAGCAGG + Intergenic
1160328172 18:77969174-77969196 CTGTCTTCCCTCCCAGGAGCAGG + Intergenic
1160328190 18:77969238-77969260 CTGTCTTCCCTCCCAGGAGCAGG + Intergenic
1160328207 18:77969302-77969324 CTGTCTTCCCTCCCAGGAGCAGG + Intergenic
1160328225 18:77969366-77969388 CTGTCTTCCCTCCCAGGAGCAGG + Intergenic
1160328269 18:77969526-77969548 CTGTCTTCCCTCCCAGGGGCAGG + Intergenic
1160328303 18:77969660-77969682 CTGTCTTCCCTCCCAGGGGCAGG + Intergenic
1160328322 18:77969724-77969746 CTGTCTTCCCTCCCAGGGGCAGG + Intergenic
1160328354 18:77969864-77969886 CTGTCTTCCCTCCCAGGAGCAGG + Intergenic
1160366910 18:78334217-78334239 GTCCCTTCCATCCCTGGTTGTGG + Intergenic
1160803103 19:979610-979632 TTCCCTCCTCTCCCTGGGGCCGG - Intergenic
1160871887 19:1281510-1281532 CTCCTCTGCCGCCCTGGTGCCGG + Intergenic
1161039236 19:2101262-2101284 CTCCTTGCCCTGCCTGGTGGGGG + Exonic
1161055655 19:2189560-2189582 CTCGCTTTCCGCCCTGATGCAGG - Intronic
1161061275 19:2216367-2216389 CGCCCTTCCCACGCAGGTGCAGG - Exonic
1161115874 19:2496028-2496050 CTCCCTTCCCTCCCCGACCCAGG - Intergenic
1161199552 19:3006720-3006742 CTCCCTGCCCTCCCAGGTGCGGG - Intronic
1161566613 19:5006140-5006162 CTTCCTTCCATCCCTGCTGCAGG + Intronic
1161571755 19:5034665-5034687 CTCCCTCCACTCCCTGGTTTTGG + Intronic
1161596331 19:5152773-5152795 CCTCCATCCCTCCCTGGGGCAGG - Exonic
1161723784 19:5917215-5917237 CACCCTTCCCACCCTGCTGTGGG - Exonic
1161990780 19:7682917-7682939 CTCCCTCCCCAGCCTGGGGCAGG - Exonic
1162267506 19:9587904-9587926 CCCCTTTCCCTCCCTTGTCCAGG - Intergenic
1162556701 19:11391156-11391178 CCCCCTTTCCTCCCTCCTGCTGG - Intronic
1162712235 19:12604022-12604044 TTCTCTTCCCTCCCTGGAGGTGG - Intronic
1163007672 19:14406684-14406706 CTCCCTTCCCTCCTAGCTGCTGG + Exonic
1163770167 19:19186225-19186247 CTCCCTTCCCTCACAGGTCTGGG + Intronic
1163927522 19:20360268-20360290 CCCCTTTCCCTCCCTTGTCCAGG + Intergenic
1164242030 19:23397687-23397709 CTCCTTTCCCTCCCTTGTTCAGG + Intergenic
1164557249 19:29263175-29263197 CTCCCTTTTCTCTCTGGTTCTGG - Intergenic
1165053447 19:33158102-33158124 CCCACTTCCCTCCCTGGAGCTGG - Intronic
1165098190 19:33421852-33421874 CACAACTCCCTCCCTGGTGCAGG + Intronic
1165104785 19:33462359-33462381 CTCCCTTCCCACCCGTGTCCTGG - Intronic
1165696681 19:37906439-37906461 CTGCCTTCCCTGCCACGTGCAGG - Intronic
1165900326 19:39166696-39166718 CACCCTTCCCTCCCTGCACCTGG + Intronic
1167236765 19:48320318-48320340 CTCGCTTCCCTCCTCGGAGCGGG + Intronic
1167299346 19:48670257-48670279 TTCCCTTCCCTCGCTGGAACTGG - Intronic
1168277434 19:55285374-55285396 CTCCATCCCCTCCCTGGCCCTGG - Intronic
1168702861 19:58451934-58451956 CTTTCTTCCCTCCCAGTTGCGGG + Intronic
1168705356 19:58467456-58467478 CTTTCTTCCCTCCCAGCTGCGGG + Exonic
925097900 2:1222510-1222532 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925097912 2:1222580-1222602 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925097935 2:1222720-1222742 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925097947 2:1222790-1222812 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925097959 2:1222860-1222882 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925097984 2:1223000-1223022 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925097996 2:1223070-1223092 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925098008 2:1223140-1223162 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925098020 2:1223210-1223232 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925098030 2:1223280-1223302 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925288066 2:2728837-2728859 CTCCCGTCCCTCCCGCGTGCAGG + Intergenic
926205913 2:10834387-10834409 CTTCCCTCCCTCCCTGGGGCTGG + Intronic
927449929 2:23199818-23199840 CTGCCCTCCCTTCCTAGTGCAGG - Intergenic
927934671 2:27069652-27069674 CTCACTGCTCTCCCTGGTCCGGG - Exonic
928359210 2:30649320-30649342 CTCCCTTCCCTGGCAGGTGCTGG - Intergenic
929002598 2:37362884-37362906 CTCACTTACCTGCCTGGTGTGGG - Intronic
929686555 2:44040052-44040074 CTCCCCTCCATCACTGGTTCAGG - Intergenic
929822704 2:45286179-45286201 CTCCCCTCCCAGCCTGCTGCAGG - Intergenic
929857296 2:45648060-45648082 TTCCCTTCCCTCTTTGCTGCTGG + Intergenic
929944761 2:46361979-46362001 TTTCCTTCCCTCCCTGGGGCCGG - Intronic
930353060 2:50281613-50281635 CTCACTTCCTTCCTTAGTGCAGG - Intronic
931224537 2:60318627-60318649 CTCCCTCCCCGCCCTGCTGCAGG + Intergenic
931669133 2:64630933-64630955 CTCTCTACCATCCCTGATGCTGG - Intergenic
931823914 2:65979611-65979633 ATCCCATCCCTCCCTGGAACAGG - Intergenic
932091738 2:68811801-68811823 CTCCCTTCCCTCCTAGGACCAGG + Intronic
932308514 2:70720899-70720921 CTCCCTTGCCTCCCTGCTGGAGG + Intronic
932571592 2:72941165-72941187 CTGCCTCCCCTCCTGGGTGCTGG - Intergenic
933373837 2:81452912-81452934 CTCCCTTCCCTTCCTGGCCTAGG + Intergenic
933981762 2:87556244-87556266 GTCCCTTCCCTCCCTGGCAAGGG - Intergenic
934708173 2:96499317-96499339 CTCCCTCCACTCCCAGGTGCTGG + Intronic
934850493 2:97697102-97697124 CTCCCGTCCTTCCATGGTGTAGG - Intergenic
934947151 2:98550231-98550253 CTCCATCCCCTCCCTGCTTCAGG - Intronic
935658055 2:105441761-105441783 CATCCTTCTCTTCCTGGTGCAGG + Intergenic
935936003 2:108183599-108183621 CTCCACTGCCTCCCTGGTCCAGG + Intergenic
936290244 2:111217311-111217333 ATCTCTGCCCTCCCTGGTGCAGG - Intergenic
936312074 2:111394573-111394595 GTCCCTTCCCTCCCTGGCAAGGG + Intergenic
936520629 2:113210114-113210136 CCCCATTCCCTCCCTGGGGCTGG + Intergenic
936524577 2:113234126-113234148 CTGGCTTCCTTCCCTGGTCCTGG + Intronic
936787731 2:116114508-116114530 CTCCCTTCCTTCCCAGATCCAGG - Intergenic
937022272 2:118668559-118668581 CTCCCTTCCCTCTCTGCCACAGG + Intergenic
937069237 2:119050232-119050254 TTCCCTTCCCACCCTGGTACTGG - Intergenic
937295510 2:120807699-120807721 CTCCCTTCCCTCCCCGATCCTGG + Intronic
937433956 2:121864664-121864686 CTATCTTCCCTCACTGGTGGGGG + Intergenic
937954571 2:127414883-127414905 CTCCCTGCCCTGCCTGGGGTGGG + Intergenic
937955075 2:127417536-127417558 CTCCCTGCCCTACCTGTTCCTGG - Intergenic
938114044 2:128591389-128591411 CTGCCTTCCTCCCCTGTTGCTGG + Intergenic
939203047 2:139063058-139063080 CTCTCTTCCCTTCCTGGAGGTGG + Intergenic
940345338 2:152622906-152622928 TTCCATTCCCTCCCTCATGCTGG + Intronic
940954362 2:159712174-159712196 GCCCCTTCCCTCCCGGGCGCCGG - Intergenic
942227558 2:173830531-173830553 CCCACTCCCCTCCCTGGTGGTGG - Intergenic
942231735 2:173866780-173866802 CTACTTTCCCGCCCTGGAGCAGG + Intergenic
942566006 2:177264938-177264960 CTCCGTTAGCTCCCCGGTGCCGG + Exonic
943633847 2:190283432-190283454 CTCCTTTGCCTCCCTTGTCCAGG + Intronic
944773107 2:202933519-202933541 CTTGCTTCCCTCCTTGCTGCAGG + Intronic
945111815 2:206367139-206367161 CTACCTTGCCTCCCTGTTGCTGG - Intergenic
945305280 2:208254317-208254339 TCCCCTCCCCTCGCTGGTGCTGG + Exonic
945381033 2:209140683-209140705 CTTCCTTTCCTGCATGGTGCTGG - Intergenic
946012557 2:216577885-216577907 CTCTCTTCCATCCTTGGGGCTGG - Intronic
946162802 2:217846410-217846432 TTTCCTTCCCTCCCTGCAGCTGG + Intronic
946405658 2:219490717-219490739 ATCCCTGCCCTCCCAGGTTCCGG + Exonic
946408643 2:219505775-219505797 CACCCTTCCCTCCCTGGGGCTGG - Intronic
947822810 2:233083748-233083770 CTCCCTGGCCACCCTGGAGCTGG - Intronic
948158799 2:235807346-235807368 CATCCTTCCCTCCCTGTCGCCGG + Intronic
948370675 2:237487382-237487404 CTCCTTTCTCTCCCAGGTGCTGG + Exonic
948497616 2:238362547-238362569 CTCCCTTTTCTCCCTCTTGCTGG - Intronic
948680902 2:239634075-239634097 CTCCCTTGCCTCCCCAGTGAGGG - Intergenic
948680923 2:239634135-239634157 CTCCCTTGCCTCCCCAGTGAGGG - Intergenic
948796611 2:240406129-240406151 GTCCCTTGCCTGCCTGGTGTGGG - Intergenic
948860273 2:240749563-240749585 CTCCCTTCCCTGCCTGCCCCGGG - Intronic
948881159 2:240857855-240857877 CTGCCTGTCCTCCCTGGGGCGGG - Intergenic
1168823335 20:792153-792175 CCCCTTTCCCTCCCTTGTCCAGG + Intergenic
1168849231 20:965281-965303 CTCCCGTCCCTCCCTGAGCCTGG - Intronic
1168990171 20:2088201-2088223 CTCCCTTTCCTCCCTGCACCCGG + Intergenic
1169329351 20:4704444-4704466 CTCCCTTCTCTGCCTGCAGCAGG + Intergenic
1169692585 20:8348474-8348496 CTTCCTTCCCTCTTTGCTGCAGG + Intronic
1170723012 20:18900809-18900831 GTGCCTGCCCTCCCTGGTGCAGG - Intergenic
1170848568 20:19982814-19982836 CTCCCTTCAGTCCCTGGTTGAGG - Intronic
1171242342 20:23581956-23581978 TTCCCTACCCACCCTGGTGGAGG - Intergenic
1171412942 20:24958732-24958754 CTCCCCTCCCTGCCCCGTGCTGG - Intronic
1172167464 20:32907839-32907861 CTCCCATTCCTCCCAGGTGGAGG - Intronic
1172485318 20:35294376-35294398 CTCCATCCCATCCCAGGTGCAGG + Intergenic
1172747125 20:37220104-37220126 CTCCTTTTCCTCCCTAGTGATGG + Intronic
1173102835 20:40103535-40103557 CTTCCTTCCCCTCCTGGTACTGG - Intergenic
1173351049 20:42245874-42245896 CTCCCTGCCTTCCCTGGTCATGG - Intronic
1173369197 20:42419666-42419688 CTTCCCTACCTCCCTGGTTCTGG + Intronic
1173868539 20:46328232-46328254 CTCCTCTCACTCCCTGGTGAGGG - Intergenic
1175179132 20:57132644-57132666 CTCCCCTCCCCAGCTGGTGCGGG + Intergenic
1175399955 20:58694361-58694383 CTCCCTGCACTCCCTGGTGGCGG + Intronic
1175594492 20:60220035-60220057 GTCCCTGACCTCCCTGGTGCAGG - Intergenic
1176091616 20:63320882-63320904 CGCCCCTGCCTCCCAGGTGCGGG + Intronic
1176109264 20:63404131-63404153 ATCCCTTCCCTCCCAGAAGCTGG - Intergenic
1176112024 20:63415303-63415325 CTCCCCTCCCTCCCTCCCGCCGG - Intronic
1176112079 20:63415425-63415447 CTCCCCTCCCTCCCTCCCGCCGG - Intronic
1176112097 20:63415466-63415488 CTCCCCTCCCTCCCTCCCGCCGG - Intronic
1176112115 20:63415507-63415529 CTCCCCTCCCTCCCTCCCGCCGG - Intronic
1176112129 20:63415548-63415570 CTCCCCTCCCTCCCTCCCGCCGG - Intronic
1176913556 21:14597847-14597869 CTCTCTTTCCTGCCTGGAGCTGG - Intronic
1177017504 21:15810644-15810666 CCTCGTTCCCTCCCTGGTGAGGG + Intronic
1177180415 21:17738999-17739021 CTCCCCTCCCTCCCTGGTGTTGG + Intergenic
1177415080 21:20782363-20782385 CTCCTTCCCCTCCCTTGTTCAGG + Intergenic
1177694579 21:24555136-24555158 CGCCCTTCCCTCCCTCAAGCCGG - Intergenic
1179818900 21:43925138-43925160 CTCTCTCCCCTCGCTGGCGCTGG + Exonic
1179888903 21:44326097-44326119 CTCCCCTGGCTCCCTGGGGCAGG + Intronic
1179954346 21:44729836-44729858 CTCCGCCCCCTCCCTGCTGCAGG - Intergenic
1180069176 21:45427582-45427604 CTCCCCGCCCGCCGTGGTGCTGG - Intronic
1180155327 21:45974677-45974699 CTCCCCTCCCTCCTTTGTGGGGG - Intergenic
1180749237 22:18112976-18112998 TTCACTTCCCTCCCTGGTGGGGG + Intronic
1180841239 22:18959844-18959866 CTCCCTTCCCTGCCGGGACCGGG - Intergenic
1181060258 22:20278950-20278972 CTCCCTTCCCTGCCAGGACCGGG + Intronic
1181157147 22:20930171-20930193 CTTCCTTGCTTCCCTGGTGAGGG - Intronic
1181173158 22:21021610-21021632 CTTCCTTGCGCCCCTGGTGCTGG + Intronic
1183087508 22:35495503-35495525 CTCCCTTCTCTCCCTGCCTCTGG - Intergenic
1183668891 22:39260547-39260569 CTCCTTTCCCTTCCTGGGCCAGG - Intergenic
1184292303 22:43503903-43503925 TCCCCTTCCCTGCGTGGTGCTGG - Intronic
1184425476 22:44406730-44406752 CTGCCCTCCCTCCCTGGGCCTGG - Intergenic
1184474340 22:44712431-44712453 CTCCCTGTCCTCGCTGGCGCAGG - Intronic
1184767217 22:46577963-46577985 CTCTCCTCCCTCCCTTGTCCAGG - Intronic
1184893650 22:47394424-47394446 CTGCCTTCCCCACCTGGAGCAGG + Intergenic
1185002366 22:48253693-48253715 CCCTCTTCCCTCCCTGGAGTTGG - Intergenic
1185015617 22:48340998-48341020 GCCCCTTCCCTCCCTGATGAAGG + Intergenic
1185096797 22:48812026-48812048 CTTCCTCCGCTCCCTGCTGCTGG + Intronic
1185194878 22:49462942-49462964 CTGCCTCCCCTGCCTGGAGCAGG + Intronic
1185408807 22:50672386-50672408 CTGCCTTTGCTCCCAGGTGCCGG - Intergenic
949490162 3:4581348-4581370 CTGACTTCACTCCCTGGTGTAGG + Intronic
950001088 3:9656825-9656847 CTTCCTACCCTCTTTGGTGCTGG + Intronic
950121115 3:10483117-10483139 CTACCTTCTCTCCCTGGTGAGGG + Intronic
950441546 3:13013703-13013725 ATCCCTTCCCTTCTTGGTGTTGG - Intronic
950452541 3:13073345-13073367 CTCCCGTCCATCCGGGGTGCGGG + Intergenic
950488416 3:13286284-13286306 CTTCTCTCCCTCGCTGGTGCTGG + Intergenic
950578051 3:13844905-13844927 CTCCCCTCCCTCCCTCTTCCCGG + Intronic
950634811 3:14307392-14307414 CTTCCCTCTCTCCCTGGTCCTGG + Intergenic
950649721 3:14399715-14399737 CTCCTTTCTCTCCTTGGGGCTGG + Intergenic
950845876 3:16015617-16015639 CCCCTTTCCCTCCCTTGTCCAGG - Intergenic
951049668 3:18080060-18080082 GTCCCTTCACTGCCTGGTACTGG - Intronic
952493801 3:33898205-33898227 GTCCCTTCCCTCCTTCCTGCTGG - Intergenic
952925449 3:38316450-38316472 TTCCCTCTCCTCCCTGCTGCCGG + Exonic
953253311 3:41265721-41265743 CACCCTTCCCTCCCTAAGGCAGG + Intronic
953449223 3:42992180-42992202 CTCACTTCCCTCCCTGGCGGTGG + Intronic
953492337 3:43362666-43362688 CTCCCTGCCCACCCTGGTGCAGG + Intronic
954314285 3:49792813-49792835 CACCCTTCCCACCCTGCTGAGGG + Intronic
954412977 3:50379228-50379250 CTCTCAGCCCTCCCTGGTCCAGG + Intronic
954440168 3:50517415-50517437 CTCCCTTCCCTCTCTGAGGCAGG + Intergenic
954442916 3:50531463-50531485 TTCCCTAGCCTCCCTGGTGATGG - Intergenic
954486112 3:50853184-50853206 CTCCCTTCCCTTCCAGCTTCTGG + Intronic
954554919 3:51510055-51510077 CTTCTTCCCCTCCCTGGAGCTGG - Intergenic
954916206 3:54150425-54150447 CCCCCTTCCCTCTCTGGAGAAGG + Intronic
955134029 3:56198430-56198452 CTCCCTGGCCTCCCTGCTTCAGG - Intronic
955408964 3:58643605-58643627 CCCCCTACCCTCCCTGGTTCTGG + Intronic
955977094 3:64489701-64489723 CTCTCTTGCTTCCCTGGTGGAGG + Intergenic
955997096 3:64688306-64688328 CTGCTTTCCCTCCCCGGGGCAGG - Intergenic
956253846 3:67263215-67263237 CCCCCTTCCCTCTGTGCTGCTGG - Intergenic
956311043 3:67880880-67880902 CTGCCTTTGCTCCCTGGTGCTGG - Intergenic
956719548 3:72105794-72105816 TTCCCTTCCCTCCTTTTTGCAGG - Intergenic
956747660 3:72322407-72322429 CTCTCTTACCTCCCAGGGGCTGG - Intergenic
958929845 3:100197345-100197367 CCCCCTTCCCGCCCAAGTGCTGG - Intergenic
959512025 3:107224802-107224824 CTCCCCTCCTTCCCAAGTGCGGG + Intergenic
959834751 3:110905307-110905329 ATCATTTCCCTCCCTGGAGCTGG - Intergenic
960119031 3:113927690-113927712 CTCCCACCCATCCCTGCTGCTGG - Intronic
960166824 3:114411716-114411738 TACCCTTCCCTCCCTTGTGAGGG - Intronic
960616603 3:119601138-119601160 CACCCTTCCCTTCTTGGTCCAGG + Intronic
960968722 3:123124050-123124072 CTCCGCTTCCTCCCAGGTGCTGG + Exonic
961473281 3:127131861-127131883 CTCCCATCCCTCCCTGCTCTGGG - Intergenic
961473384 3:127132399-127132421 CTGCCTTCTCTCCATGGTGGGGG + Intergenic
961521431 3:127469368-127469390 TCCCCTTCCCACCCTGGTGGGGG - Intergenic
961563330 3:127746455-127746477 CTCCCTTTTCTCTCTGGTTCTGG + Intronic
961574293 3:127822520-127822542 CTCCCCTCCCTCCCCAGGGCGGG + Exonic
961824217 3:129590326-129590348 CTACCTTCCCTCCCTTCTCCTGG + Intronic
961979464 3:131061809-131061831 CTCCCTGCCATCACTGGTGCTGG + Intronic
962481971 3:135805900-135805922 CTGCCTTCCCTCCCTGCCCCAGG + Intergenic
962700928 3:137999225-137999247 CTCCTATTCCACCCTGGTGCAGG - Intronic
963060617 3:141221979-141222001 CTTTCTTCCCTCCATGGTTCTGG - Intergenic
963489695 3:145983915-145983937 TTCCCTTCCCTCCCTCCTGAGGG - Intergenic
964350606 3:155799760-155799782 CTCCATTCCATCCATGGTGTTGG - Intronic
964703620 3:159595364-159595386 TTCCCTTCCCTGGCTGCTGCTGG - Intronic
965103509 3:164332761-164332783 ATGCCCTCCCTCCCTGATGCAGG + Intergenic
965216869 3:165874807-165874829 TTCCCTACCCACCCTGGTACTGG - Intergenic
965833753 3:172828669-172828691 CTCCATGCCATTCCTGGTGCTGG - Intergenic
966669638 3:182512928-182512950 TTCCCATCCCTACCAGGTGCAGG + Intergenic
967884351 3:194322952-194322974 CTCTCTCCCCTCCCTGAGGCTGG - Intergenic
968505501 4:969279-969301 ACCCCTTCCCTCCTTGGGGCAGG + Intronic
969180506 4:5437028-5437050 CTTCCTTCCCTCCCAGGACCTGG - Intronic
969304127 4:6315776-6315798 CTCCCTTCCCTTATTGCTGCTGG + Intergenic
969350143 4:6593581-6593603 CTCTCTTCCCTGCCTGGGCCGGG + Intronic
969973206 4:11069801-11069823 TTCCCTTCTCTCCTGGGTGCTGG + Intergenic
970870856 4:20815359-20815381 ATTCCTTCCCTCAGTGGTGCAGG - Intronic
971353544 4:25873755-25873777 CTCCCTCCCCTCCCAGCTCCTGG + Intronic
972614231 4:40682885-40682907 CTCCTTTGCCACGCTGGTGCTGG - Intergenic
972983289 4:44731635-44731657 TTCCCTTTCCTCCCTGGTTAAGG - Intergenic
976751396 4:88454208-88454230 CTGCCTTGCCTCCCAAGTGCTGG + Intergenic
976839143 4:89410867-89410889 CTCCCTTCGGTGCTTGGTGCTGG - Intergenic
978102493 4:104859737-104859759 CTCCCTTCTCTCTCTAGTGCAGG + Intergenic
978721739 4:111917978-111918000 CTGCAGTCCCTCCATGGTGCTGG - Intergenic
979082318 4:116359898-116359920 CTCCCTTCCTTAAATGGTGCTGG - Intergenic
980221156 4:129917739-129917761 CTCCCTTCCATGCATGATGCTGG + Intergenic
980739696 4:136933133-136933155 CTCCCCTCCCTTCCTGCTCCTGG - Intergenic
982116063 4:152099328-152099350 CACATTTCCCTCCCTGGTTCAGG + Intergenic
982158168 4:152541001-152541023 AGCCCTACCCTCCCAGGTGCAGG - Intergenic
982241061 4:153299943-153299965 ACCCCTTCCCTCCCTTGTCCAGG + Intronic
983679770 4:170339884-170339906 CTCCTTCCCCTCCCTTGTTCAGG + Intergenic
985767538 5:1787740-1787762 CTTCCTTCCCTCCTGGGGGCGGG + Intergenic
985943947 5:3162464-3162486 CTCCATCCCCACCCTGGTCCGGG + Intergenic
988629618 5:32914824-32914846 CTGCCTTTCCTCCCTGGTGCTGG - Intergenic
988769821 5:34421352-34421374 CTCCCTTCCTCCCCTATTGCGGG + Intergenic
988872482 5:35406186-35406208 CAACCCTCCCTCCCAGGTGCAGG - Intergenic
989145943 5:38250286-38250308 CACCCTTCCTTCCCTGGGACTGG + Intergenic
989339691 5:40359471-40359493 CTCCCTTCCCTCTATGGAGGAGG + Intergenic
989715532 5:44458207-44458229 CTCCCTTTCCATCCTGGTGGGGG - Intergenic
991407979 5:66320259-66320281 CTCATTTCTCTCCCTGGTCCTGG + Intergenic
994245658 5:97472225-97472247 CGCCCTTCCCACACTGGTGGTGG + Intergenic
995886319 5:116898323-116898345 CTCCCATTCCTGCCTGCTGCTGG + Intergenic
996211609 5:120817962-120817984 CCCCCAACCCTCCCTGGTCCAGG + Intergenic
996336300 5:122387551-122387573 CTCTCTTGCCTCCCAGCTGCTGG + Intronic
996837624 5:127811236-127811258 CTCCATTCCCTCCCTTGTTGGGG + Intergenic
997676831 5:135719529-135719551 GTGCCTTCCCTCCCTGGTGTAGG - Intergenic
997847451 5:137300920-137300942 GTCCATTCCCTCCCAGGTTCTGG + Intronic
998367345 5:141639904-141639926 TTCCCTCCCCTCCCAGGTTCCGG + Exonic
998368766 5:141647919-141647941 CTCCTTTCCCTCCCTGCTGAGGG + Intronic
999657530 5:153825341-153825363 CACCTTTCCCTCCCTGGCACAGG - Intergenic
1001082392 5:168676914-168676936 CTTCCTGCCATCCCAGGTGCTGG + Intronic
1001091033 5:168741093-168741115 CTCCCTTCCTTCCCCTGGGCTGG + Intronic
1001098720 5:168796492-168796514 CTCCCTTCTCTCCGAGGTGCAGG + Intronic
1001744588 5:174082508-174082530 CTGGCTTCCCTCCCTGTTGCAGG + Intronic
1001934308 5:175693721-175693743 CTCCCTTCCCATCTTGGTCCGGG + Intergenic
1001956695 5:175852713-175852735 GTCCTTTGCCTCCCTGGTACTGG + Intronic
1001966652 5:175914400-175914422 CTCCCTTCCCGGCCTGGCTCAGG - Intergenic
1002063942 5:176642985-176643007 CTGCCTTCCCCTCCTGGAGCAGG + Intronic
1002250295 5:177924804-177924826 CTCCCTTCCCGGCCTGGCTCAGG + Intergenic
1002451261 5:179320114-179320136 GTCCCTGCCCTGCCTGGTGAGGG + Intronic
1002664406 5:180811661-180811683 CTCCCTACCCTCCCAGTCGCTGG + Intronic
1002670351 5:180861365-180861387 CTCCCCTCCCTCCCTCCCGCCGG - Intergenic
1003427473 6:6007280-6007302 CTCCCTTCCCCGCCAGGAGCTGG + Intronic
1004924602 6:20404153-20404175 CTGTCTTCCTTCCCTTGTGCTGG + Intronic
1005288936 6:24359729-24359751 CTTCCTTCCCTCCCTCCTTCCGG - Intergenic
1005817182 6:29563240-29563262 CTCCTTCCCCTCCCTTGTCCAGG - Intronic
1006424926 6:33957974-33957996 CTCCCTTCCTCCCCTGCTGGTGG - Intergenic
1006630567 6:35427288-35427310 CTCCCTTCCCTCCCTGAGGCAGG + Exonic
1007416369 6:41693783-41693805 CTCCCTTCCCATCCTGCAGCAGG + Intronic
1007790636 6:44306337-44306359 CTTCCTGGCCTCCCTGGAGCGGG - Exonic
1010038513 6:71354569-71354591 GTTCCTTCCTTCCTTGGTGCTGG - Intergenic
1011259739 6:85458416-85458438 CTCCCTCCCCTGCCTGAAGCTGG - Intronic
1011347499 6:86388271-86388293 CCCTCTTCCTTCCCTAGTGCTGG + Intergenic
1011559859 6:88603312-88603334 CTCCCTTCCCTTCCAGATCCAGG + Intergenic
1014458779 6:121669683-121669705 CTGACTTCCCTGGCTGGTGCCGG - Intergenic
1015315134 6:131808295-131808317 CTCCCAGCCCTCCCGGGCGCCGG - Intronic
1015455739 6:133424585-133424607 GTGCCTGCCCTCCCAGGTGCAGG - Intronic
1015606706 6:134963752-134963774 CACTCTGCCTTCCCTGGTGCTGG - Exonic
1016383755 6:143511759-143511781 CACCCTTCCCCCTCTGGGGCGGG + Intergenic
1018195014 6:161347966-161347988 CTCCTTTCCCTTCTTGGTGGTGG - Exonic
1018334975 6:162777209-162777231 CTCACTTGGCTCCCTCGTGCCGG + Intronic
1018357512 6:163034099-163034121 TTGCCTTCCCACCCTGCTGCAGG - Intronic
1018733670 6:166671768-166671790 CACCCTTCCCTCCCATGTGCTGG - Intronic
1018963437 6:168465077-168465099 TTCCCTTCCTTCCATGGGGCAGG - Intronic
1019310240 7:356937-356959 CCCCTTCCCCTCCCTGCTGCAGG - Intergenic
1019314889 7:379827-379849 CTCCCTCCCCTCCCGGGCCCAGG - Intergenic
1019544595 7:1567604-1567626 CTCACCTCCCTCCCCGGTGGAGG - Exonic
1019616599 7:1965775-1965797 CTCCCTGTCCTCCCTCCTGCAGG + Intronic
1019695936 7:2446173-2446195 CTCCCTTCCAGCCCTGCTGCTGG - Intergenic
1019769727 7:2876220-2876242 CTCCGGCCCCTCCCTGGTGCAGG + Intergenic
1019932983 7:4235901-4235923 CTTCCTTTCCTACCAGGTGCTGG + Intronic
1020008123 7:4792952-4792974 CTCCCCTCCTGCCCTGGGGCGGG + Intronic
1020192253 7:6009258-6009280 CTCCCTTCTGACCCTGCTGCGGG - Exonic
1022104725 7:27189601-27189623 CCCTCTTCTCTCCCTGGGGCTGG + Intergenic
1022172449 7:27843043-27843065 CTTCCTGCCCTGCCTGGGGCTGG - Intronic
1022421345 7:30226452-30226474 CTCCCTTCTCTCCCTATTGCTGG - Intergenic
1022496949 7:30859337-30859359 CTCCCTCAACTCCCTGGGGCTGG + Intronic
1022526810 7:31043238-31043260 GTCCTCTCCTTCCCTGGTGCCGG + Intergenic
1023717020 7:43054941-43054963 CCACCTTCGCTCCCTGGTTCTGG + Intergenic
1023873524 7:44275135-44275157 CTCCCTCCCTTCCCTGGCTCAGG + Intronic
1023979006 7:45055163-45055185 CTCCCTGGCCTCCCTGTGGCTGG - Intronic
1024036680 7:45512718-45512740 CCCCCTCCCCTCCCTGGAGATGG + Intergenic
1024367464 7:48537494-48537516 CTCCTTCCCCTCCCTTGTTCAGG - Intronic
1024707159 7:51972908-51972930 CTACCTCCCCTCCCTGGGTCAGG - Intergenic
1024799969 7:53065346-53065368 CTCTCTTTCCTCCCTGATTCTGG + Intergenic
1024959658 7:54960806-54960828 CTCCCTTCCCACCATGGTCCAGG + Intergenic
1025705900 7:63863628-63863650 GTCCCTTCCATACTTGGTGCTGG - Intergenic
1025757850 7:64362258-64362280 CTCCCTTCCCCCCAGTGTGCAGG + Intergenic
1026524158 7:71140144-71140166 CTCCCTTCGCTCCTTCCTGCAGG - Intronic
1026745168 7:73005888-73005910 CTCCCTTCTGACCCTGCTGCGGG + Intergenic
1026807701 7:73438179-73438201 CTGCCCTCCCTCCCAGGTCCTGG - Intergenic
1026980070 7:74521186-74521208 CTTCCTTCTCTCCCTTGTCCAGG + Exonic
1027031276 7:74890558-74890580 CTCCCTTCTGACCCTGCTGCGGG + Intergenic
1027035577 7:74922791-74922813 CTCCTTCCCCTCCATGGGGCTGG - Intergenic
1027098574 7:75359217-75359239 CTCCCTTCTGACCCTGCTGCGGG - Intergenic
1027659738 7:80974973-80974995 CTCCGTTCCCTCTTTGGTGGCGG - Intergenic
1028212234 7:88088292-88088314 CTGTCTTCCCTCCCTGGGGTGGG + Intronic
1029394481 7:100298346-100298368 CTCCTTCCCCTCCATGGGGCTGG + Intergenic
1029399683 7:100336100-100336122 CTCCCTTCTGACCCTGCTGCTGG - Intronic
1032196011 7:129788962-129788984 CTCCCTTCCATCCTTGGTTTTGG + Intergenic
1032530373 7:132615142-132615164 CTCCCTTCCCGCCCCTGTGCCGG - Intronic
1032703793 7:134405021-134405043 ATCCCTTCCCACACTGGTGCAGG - Intergenic
1032889843 7:136182493-136182515 CTCCCTTCCCTGGCTGCTTCAGG + Intergenic
1033121677 7:138671948-138671970 CTCCCTTTCCTCCATCCTGCAGG - Intronic
1033222466 7:139537570-139537592 CACTCTTCCCTCCCTGGTTTAGG + Intronic
1033604360 7:142915021-142915043 CACCTATGCCTCCCTGGTGCTGG - Exonic
1034105568 7:148486872-148486894 CTCCCTTCCCACCCTGCCGCGGG + Intergenic
1034410283 7:150937608-150937630 CTCACTTCCCGTCCTGCTGCAGG - Intergenic
1034548535 7:151805327-151805349 CTCACATCACTCCCTGGGGCTGG - Intronic
1035031135 7:155861396-155861418 CTGCCATGCCACCCTGGTGCTGG - Intergenic
1035091838 7:156319283-156319305 TTCCCTTCCCTGCTTGGTCCTGG - Intergenic
1035140904 7:156759805-156759827 CTCCTTCCCCTCCCCTGTGCAGG - Intronic
1035205806 7:157293108-157293130 CTGCCTTCCTTCCCAGGGGCTGG + Intergenic
1035260516 7:157658996-157659018 CTCCCTTCACCCCGGGGTGCCGG + Intronic
1035467389 7:159088715-159088737 CTGCTTTCACTCCGTGGTGCAGG - Intronic
1035670438 8:1412904-1412926 CTGACTTCCCTCCCTCCTGCTGG + Intergenic
1035727862 8:1835616-1835638 CGTCCTTCCCACCCTGCTGCTGG + Intronic
1035774355 8:2176252-2176274 GTCCCTTCCCTGCCAGGCGCAGG - Intergenic
1036038910 8:5052456-5052478 CTCTCCTCCCTGCCAGGTGCAGG + Intergenic
1036456921 8:8917608-8917630 ATCCCTTCCTTCACTGGTGGTGG + Intergenic
1038516049 8:28188468-28188490 CCCCCTTCCCTCCCCGGAGGAGG - Intronic
1038615049 8:29085989-29086011 ATCCTTCCCCTCCTTGGTGCTGG + Intronic
1038620713 8:29140191-29140213 CTGCCTTCCCTCATTGCTGCAGG - Exonic
1039860440 8:41452912-41452934 CTTCAGTCTCTCCCTGGTGCCGG + Intergenic
1039904065 8:41773395-41773417 CCCCCTTCCCTCCCTCCTCCAGG - Intronic
1040580646 8:48696161-48696183 CGCCCTCCCCTCCCTGTGGCTGG + Intergenic
1040800274 8:51331894-51331916 CTCCCTACCCACCCTGGTAGTGG + Intronic
1041548665 8:59076035-59076057 CTCCCTTCCCTCCCTCATGTAGG - Intronic
1041811797 8:61919639-61919661 CTTCCCTCCCTCCCTGTTGGTGG - Intergenic
1043917578 8:85940420-85940442 CTGCCTTCCCTCCAAGATGCTGG - Intergenic
1044061090 8:87636567-87636589 CTCCTTCCCCTCCCTTGTCCAGG + Intergenic
1044326008 8:90859125-90859147 CTCTCTTCCCTCACTGCTGCTGG - Intronic
1046727972 8:117695035-117695057 CTGCCTAACCTCCCTGGTCCAGG - Intergenic
1047251150 8:123182832-123182854 CTCCCGTCCCTGGGTGGTGCTGG - Exonic
1048195408 8:132328095-132328117 GTACCTTCCCTCACTGGTTCAGG - Intronic
1048516827 8:135118974-135118996 CACCCTTCCTTCCCTGCTACAGG + Intergenic
1048589687 8:135809947-135809969 CTCTCTTGCCTCCCTGGAGGTGG + Intergenic
1049063536 8:140295059-140295081 GGCCCTGCCCTCCCTGTTGCGGG + Intronic
1049394818 8:142395068-142395090 CCCCCTTCCCTGCCAGGAGCAGG - Intronic
1049529468 8:143147202-143147224 CTCCAATCCCTCCTGGGTGCTGG - Intergenic
1049573069 8:143378594-143378616 CTCCCCGCCCCCCATGGTGCTGG + Intronic
1049656616 8:143801805-143801827 CTCCACACCCTCCCTGGTGTTGG - Intronic
1049917457 9:332409-332431 CTCCAATCTCTCCCTGCTGCAGG - Exonic
1050013541 9:1209420-1209442 CTCCACTCCCTCCCTGGTCTGGG - Intergenic
1050431118 9:5562802-5562824 CTGCCTGCCTTCCCTGGTCCAGG - Intronic
1051170613 9:14315488-14315510 CTCCCTACCCGCCCGGGTGCAGG + Intronic
1055653464 9:78430945-78430967 CTCTCTCCCCTCCCTCCTGCAGG - Intergenic
1056132349 9:83599064-83599086 CTCTCCTCCCTCCATGGAGCAGG - Intergenic
1057019070 9:91681672-91681694 CCCACTTCCCTCCCGGGGGCTGG + Intronic
1057239848 9:93399072-93399094 CTGCCCTCCCTCCCTGATGCGGG + Intergenic
1058927665 9:109683465-109683487 CTGCCTTCTCTCCCTGCTTCTGG - Intronic
1059024761 9:110614632-110614654 CCCCTTTCCCTCCCTTGTCCAGG - Intergenic
1059405698 9:114097430-114097452 CTCCCTCCCCTCCCAGGTTCGGG - Exonic
1059646911 9:116276836-116276858 CTCCCTCCCCTCCCCTGTGAGGG + Intronic
1060205321 9:121679465-121679487 GTCCCTTCACTCCCTCGTTCAGG + Intronic
1060269112 9:122128593-122128615 CTCCCTTCCTGGCCCGGTGCTGG - Intergenic
1060411925 9:123405629-123405651 CTCCCTTCCCTGTCTTGTCCTGG - Intronic
1060604325 9:124900285-124900307 CTCCCTCCACCCCCTGCTGCTGG + Intronic
1060882755 9:127129803-127129825 CTCTCTTCCCTCCCTGGGCTGGG + Intronic
1060960820 9:127679300-127679322 CTCCCTTCTCTCCTTGTAGCGGG + Intronic
1060999686 9:127896183-127896205 CTCACTTCCCTCCATGGAACGGG - Intronic
1061298977 9:129693957-129693979 CTGCCTTCACTCCCTGCTGGGGG - Intronic
1061368817 9:130186597-130186619 CTCCCACCCCTTCCTGGGGCTGG - Intronic
1061369100 9:130187905-130187927 CTCCCACCCCTTCCTGGGGCTGG + Intronic
1061434869 9:130554792-130554814 TTCCCTTCTCTGCCTGGGGCAGG + Intergenic
1061779340 9:132986637-132986659 CTCCCATCCCTCCCCCTTGCAGG + Exonic
1061821498 9:133229388-133229410 CTCCCATCACTCCCAGGAGCTGG - Intergenic
1062033372 9:134372017-134372039 CCCACTTCCCTCCCTGGGGAGGG + Intronic
1062229713 9:135475037-135475059 GTCCCTTCCCACCCGGGTCCAGG - Intergenic
1062237748 9:135520686-135520708 CTCCCATCACTCCCAGGAGCCGG + Intergenic
1062349199 9:136130896-136130918 AGCCCCTCCCTCCCTGGGGCCGG - Intergenic
1062362642 9:136194847-136194869 CTCCCTTCCCTCCCCTTTCCTGG + Intergenic
1062456654 9:136642882-136642904 GACCCTTCCCTCCCTCCTGCAGG - Intergenic
1203654746 Un_KI270752v1:12563-12585 CTTGCCTCTCTCCCTGGTGCTGG + Intergenic
1186495176 X:10007246-10007268 CTCTCTTGGGTCCCTGGTGCTGG - Intergenic
1187547240 X:20266486-20266508 CTCGCTTCGCTCCCCGGAGCTGG - Intronic
1188007040 X:25022712-25022734 CTCCCTTCCCTCAAAGATGCTGG - Intergenic
1190726219 X:53192593-53192615 CTCCCTTCTCTCCCCAGTTCTGG - Exonic
1191728331 X:64305679-64305701 CTCTCTTACCTTACTGGTGCTGG - Intronic
1193145964 X:78076017-78076039 CTCCTTCCCCTCCCTTGTCCAGG - Intronic
1193894781 X:87099891-87099913 CTCCCTCCCTGCACTGGTGCTGG - Intergenic
1194058329 X:89164555-89164577 CCCCTTTCCCTCCCTTGTCCAGG - Intergenic
1194114024 X:89873708-89873730 CCCCATTCCCTCCCTGGCGTAGG + Intergenic
1195234153 X:102880241-102880263 CTATCTTTCCTCCCTGGAGCAGG + Intergenic
1195237678 X:102917687-102917709 TTCACTTCCCTCCTTGGTGCAGG - Intergenic
1195751687 X:108165729-108165751 CTCCCTTACCTCACTGGTAATGG + Intronic
1196298919 X:114031905-114031927 CTCCTTTCCCACCCTGATCCTGG - Intergenic
1197213886 X:123850259-123850281 CCCCTTTCCCTCCCTTGTCCAGG + Intergenic
1197653089 X:129086737-129086759 CTGCATTCCCTCCCTCATGCAGG + Intergenic
1199998141 X:153039830-153039852 CTTCCTTCCCTTCCAGGTGGTGG - Intergenic
1200064670 X:153498657-153498679 CCTCCCTCCCTCCCTGGTACAGG - Intronic
1200466764 Y:3529064-3529086 CCCCATTCCCTCCCTGGCGTAGG + Intergenic
1201278710 Y:12322025-12322047 CCACCTTCCCTGCCTGCTGCAGG + Intergenic