ID: 1103717322

View in Genome Browser
Species Human (GRCh38)
Location 12:122952504-122952526
Sequence CCCTCTAGGCTGCCACCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103717322_1103717333 22 Left 1103717322 12:122952504-122952526 CCATGAGGTGGCAGCCTAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 190
Right 1103717333 12:122952549-122952571 CCAGACGAGGTCTCCAGCTGAGG 0: 1
1: 0
2: 0
3: 11
4: 142
1103717322_1103717325 -1 Left 1103717322 12:122952504-122952526 CCATGAGGTGGCAGCCTAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 190
Right 1103717325 12:122952526-122952548 GCCTGTGTCCCCACAGTCCTTGG 0: 1
1: 0
2: 2
3: 28
4: 330
1103717322_1103717330 9 Left 1103717322 12:122952504-122952526 CCATGAGGTGGCAGCCTAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 190
Right 1103717330 12:122952536-122952558 CCACAGTCCTTGGCCAGACGAGG 0: 1
1: 0
2: 0
3: 18
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103717322 Original CRISPR CCCTCTAGGCTGCCACCTCA TGG (reversed) Intronic
900463186 1:2811040-2811062 ACCTCTGGGCAGCCACCTCCAGG + Intergenic
900500330 1:3001406-3001428 CACTCTAGGCTGCCTCCGCCTGG + Intergenic
900764861 1:4497992-4498014 CCCTCCAGGCTGGCACCACCAGG + Intergenic
901678480 1:10900238-10900260 CCCTCCAGGCTGTGAGCTCAGGG + Intergenic
903351302 1:22718199-22718221 CCCTCCAGCCTGCCCACTCAGGG + Intronic
904461956 1:30685689-30685711 CCCTCTCGGGTCCCAGCTCAGGG - Intergenic
905003549 1:34692817-34692839 CCCTCTAGGCAGCCAGTACAAGG - Intergenic
905018099 1:34791342-34791364 CCCTCTAGGCCTCTCCCTCAGGG - Intronic
905380616 1:37559139-37559161 CCCACTATGCTGCCTCCACAGGG - Intronic
907045722 1:51298925-51298947 GCCTCTAGGCTGCCAGCACTGGG + Intronic
907305897 1:53513063-53513085 CCCTTCAGGCTGCCTCTTCATGG + Intronic
916580884 1:166107067-166107089 CCCTCTAAGGTCACACCTCAAGG + Intronic
918035154 1:180863359-180863381 TGCACTAGGCTGCCACCTGATGG + Intronic
920029648 1:203028852-203028874 CCCTCTGGCCTGCTAGCTCACGG + Intronic
920030566 1:203035174-203035196 CCCTCGTGGCTGCCACCTGGAGG + Intronic
920248058 1:204603103-204603125 CCATCTAGGCTGAAACCTAAAGG + Intergenic
920655295 1:207869565-207869587 CGCTCGAGGCTGGCATCTCAAGG + Intergenic
921056033 1:211543111-211543133 CACAATAGGCTGCCACCTCTGGG + Intergenic
921282998 1:213585658-213585680 ACCTCTATGCTGCCACCTCTGGG + Intergenic
922455576 1:225771108-225771130 CCCTCAATGCTGCCTCCTCTGGG - Intergenic
922597485 1:226825115-226825137 CCCTCCAGGCCCCCACCTCTTGG - Intergenic
922994361 1:229944189-229944211 GCCTCTAGACTGCCTCCTCCAGG - Intergenic
923985454 1:239376989-239377011 ACCTCTAAGCTGAGACCTCAAGG + Intergenic
924784619 1:247183775-247183797 CCATCTAGGCGGACACCACAGGG + Intergenic
1063333068 10:5181121-5181143 CCTTCTTGGCTGCCACCCCAAGG + Intergenic
1063539088 10:6914071-6914093 CCTTCCTGGATGCCACCTCATGG + Intergenic
1073446842 10:103586019-103586041 CCCCCAAGGCTGCCTGCTCAGGG - Intronic
1075469307 10:122676116-122676138 CCCTCTAGCCTGCATCCTCACGG - Intergenic
1076068466 10:127467511-127467533 GCCTCTTGACTGCCACCACAAGG - Intergenic
1076381467 10:130027160-130027182 CCCTCACAGCTGCCATCTCACGG + Intergenic
1077489196 11:2852733-2852755 CCCTCTAGGCTTCCTCACCAAGG - Intergenic
1079380940 11:19936768-19936790 ACCTCTAAGCTGCTAGCTCATGG - Intronic
1082789630 11:57338437-57338459 CCCTCTAAGCTGCCCCCTCCAGG + Intronic
1083212929 11:61200216-61200238 CACTCAAGGCTGCCACCAGATGG - Intergenic
1083215873 11:61219382-61219404 CACTCAAGGCTGCCACCAGATGG - Intergenic
1083218756 11:61238208-61238230 CACTCAAGGCTGCCACCAGATGG - Intergenic
1084091655 11:66882806-66882828 CCCTCTTGGCTGCCAGCCCTGGG - Intronic
1085300840 11:75457315-75457337 CTCTCTAGGCTGCCCCTTCCTGG - Intronic
1087897610 11:103604349-103604371 AGCTTTAGGCTGCCTCCTCAGGG - Intergenic
1088810661 11:113389493-113389515 CCCCCTAGGCTGCAATCTCCCGG - Intronic
1089067062 11:115670148-115670170 CCTTATAGCCAGCCACCTCAAGG - Intergenic
1089621886 11:119727336-119727358 CCCCCTATTCTGCCACCCCAAGG + Intronic
1091274295 11:134339957-134339979 CCCTCTAGGCTGACTTCTCCAGG - Intronic
1096042361 12:48528667-48528689 CCCTCCAGCCTTCCATCTCAGGG + Intronic
1100064520 12:90625820-90625842 CTCTTTAGGCTGTCACATCAAGG - Intergenic
1101894519 12:108745891-108745913 CCTTCTCTGATGCCACCTCATGG + Intergenic
1102569774 12:113820427-113820449 CCCTGCAGGCTCCCACCCCAGGG - Intronic
1102988934 12:117300892-117300914 CCCTTGAGGCTGACATCTCAGGG - Intronic
1103717322 12:122952504-122952526 CCCTCTAGGCTGCCACCTCATGG - Intronic
1104153429 12:126107159-126107181 TCCTCTTGGCTGTCATCTCATGG - Intergenic
1108269962 13:48749882-48749904 CCGGCTCGGCTGCCACCTAATGG - Intergenic
1108548739 13:51522164-51522186 CCCCCTAGGCTACCACCCCCAGG + Intergenic
1111956935 13:94769493-94769515 TCATGTAGGCTACCACCTCAAGG - Intergenic
1112563569 13:100533895-100533917 CCCCACAGGCTGTCACCTCATGG - Intronic
1112763767 13:102719184-102719206 GCCTCTTGGTTGCCATCTCAGGG + Intergenic
1117309314 14:54506346-54506368 CCCTCCAGGCTGGAATCTCAGGG + Intergenic
1118298028 14:64588326-64588348 CCACCTGGGATGCCACCTCAAGG - Intronic
1118821820 14:69350734-69350756 CCCTCTGGGCTTCCTCCACATGG + Intronic
1123026309 14:105425899-105425921 CCCTCTAGGCTGCTCCCGCCTGG + Intronic
1125361195 15:38866547-38866569 CCCTTTAGGGAGCCACTTCATGG - Intergenic
1128934759 15:71736717-71736739 CTCTCTGGGCTGGCCCCTCAGGG + Intronic
1131055348 15:89371549-89371571 CCCTCGAGGCTGCGGGCTCAGGG + Intergenic
1132788482 16:1671442-1671464 CCCTCAAGGCGTCCACCACATGG + Intronic
1134008554 16:10834491-10834513 ACCTCTGAGCTGCCACCTGAAGG - Intergenic
1135053837 16:19214131-19214153 TCCTCTCTGCTGCCACCTCCAGG - Intronic
1135901897 16:26467828-26467850 CCCTCTAAGGTCACACCTCAAGG + Intergenic
1136777392 16:32879198-32879220 CCTCCTGGGCTGCCTCCTCAGGG - Intergenic
1136893233 16:33982315-33982337 CCTCCTGGGCTGCCTCCTCAGGG + Intergenic
1137544854 16:49395783-49395805 TCCTCTAGGCTACCTCCTCTAGG + Intronic
1139444448 16:66988238-66988260 CCCTCTGGGCTCCCACATTACGG + Intergenic
1139682289 16:68574368-68574390 CCCTCTAGCCTGCCTGCACAAGG - Intronic
1203079805 16_KI270728v1_random:1141307-1141329 CCTCCTGGGCTGCCTCCTCAGGG - Intergenic
1142546705 17:709067-709089 CCCTCTAAGCTGAGACCTGATGG - Intronic
1144850323 17:18240912-18240934 CCCTCCAGGCCCCAACCTCATGG + Intronic
1146641001 17:34541437-34541459 CCCTGTAAGCAGCCACCCCAAGG - Intergenic
1147609030 17:41790723-41790745 CCTTCTATGCTCACACCTCAGGG + Intergenic
1147701950 17:42401875-42401897 TCCCCTAGGCTGCCTCCTCTAGG + Intergenic
1150716855 17:67579464-67579486 CCCATTGGGCTGCCACTTCAAGG - Intronic
1151745614 17:76010207-76010229 CCTTCTGGGCTGCCACTTCCAGG + Exonic
1152606707 17:81295101-81295123 CCTTCGAGGCTGCCTCCTCCAGG - Exonic
1152677850 17:81650872-81650894 CCCTCTAGGATGCCCCCTCAGGG - Exonic
1156471753 18:37381479-37381501 CCTGCAAGGCTCCCACCTCAAGG - Intronic
1158097165 18:53786222-53786244 CCCTTTAGGCTTGTACCTCAGGG - Intergenic
1160514781 18:79472263-79472285 CCCTCTAGGAAGCCCCCTCCAGG + Intronic
1161313310 19:3606776-3606798 CCCTCCAGGCCGCGACCCCAGGG - Intronic
1162372737 19:10289030-10289052 CCTTCCCGGCTGCCACCACATGG - Intergenic
1163500085 19:17671122-17671144 CCCTCTGGGCTATGACCTCATGG - Intronic
1164526182 19:29015216-29015238 GCCTCTTTGCTGCCACCTTATGG + Intergenic
1165243487 19:34484344-34484366 CCCTCTGGGCTGCAACCCCAGGG - Intronic
1165701212 19:37939577-37939599 ACCTGTATCCTGCCACCTCATGG + Intronic
1168666603 19:58209532-58209554 CCCTCTCTCCTCCCACCTCATGG - Intronic
925425276 2:3744224-3744246 CCCTCTCTGCTCTCACCTCATGG - Intronic
925716838 2:6791833-6791855 CTCCCTAGGCTGCCACCTGTGGG - Intergenic
926265272 2:11311311-11311333 CCCACCACCCTGCCACCTCAAGG - Intronic
929312274 2:40439090-40439112 CCCTCTAGTCCCCCACCTCCTGG - Intronic
929347438 2:40903183-40903205 GCCTCTTAGCTTCCACCTCAGGG - Intergenic
929767524 2:44859523-44859545 CCCTCTAGGCTTCCACGTAGGGG + Intergenic
931142810 2:59482261-59482283 CCCCCAAGGCCACCACCTCATGG - Intergenic
931248919 2:60513444-60513466 CCCTCAAGCCAGCCACCCCATGG + Intronic
932455832 2:71849409-71849431 CCCTGTATGCAGCCACATCAAGG - Intergenic
933771590 2:85748094-85748116 CCCAGCAGGCTCCCACCTCAGGG - Intergenic
934555244 2:95283570-95283592 CCCTCCAGGCTGCCTTCTCCTGG - Intronic
934557619 2:95295868-95295890 CCTTCATGGCTGCCAGCTCAGGG - Intergenic
937160316 2:119754939-119754961 CCCTAGAGCCTGCCTCCTCAAGG + Intergenic
937408086 2:121649201-121649223 CTCGCCAGGCTCCCACCTCAGGG + Intronic
938110933 2:128564442-128564464 CCCTCCATGCAGCCACCTCTTGG - Intergenic
938478337 2:131635863-131635885 CCCACGTGGCTGCCACCTGATGG + Intergenic
938572186 2:132570787-132570809 TCCTCTAGGCTGCTGCCTCAGGG - Intronic
943416351 2:187610674-187610696 TCCCCTAGGCTGCCTCCTCTAGG - Intergenic
944191574 2:197009725-197009747 CCCCCTCGGCTTCCAGCTCAAGG + Intronic
944844471 2:203655097-203655119 CCCACTGTGCTGCCTCCTCAGGG - Intergenic
945032582 2:205679827-205679849 CCCTCTAGACTGGGATCTCAGGG - Intergenic
945949247 2:216023221-216023243 TCCTCTGTGCTGCCACCTCCTGG + Intronic
946571052 2:221024743-221024765 CCCCCTGGGCTGCACCCTCATGG - Intergenic
948756961 2:240165590-240165612 CCCTCAAGGCTGCTTCCTTACGG - Intergenic
1168808742 20:688963-688985 CCCTCACGGCAGCCACCACAAGG + Intergenic
1168910017 20:1440175-1440197 CCCTTTAGGACGCCCCCTCATGG + Intergenic
1169928831 20:10810356-10810378 CCACCTAGTCTGCCACCTCTGGG - Intergenic
1170199116 20:13723341-13723363 CCCTCTAGGCTACCACATTCTGG + Intronic
1171343366 20:24447399-24447421 GCCTGTAGTCTCCCACCTCATGG - Intergenic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1171455772 20:25271308-25271330 CCCTGTGGGCTGCCTCCGCATGG + Intronic
1172009001 20:31835614-31835636 CCCTCTGGGCTGCCCCCAGATGG - Intergenic
1174087259 20:48018197-48018219 CCCTCCAGGCTGCCCTCCCAAGG - Intergenic
1175390892 20:58626662-58626684 CCCCCCAGGCTCCCAGCTCAAGG + Intergenic
1179362765 21:40727922-40727944 CCCTGCAGGCTCCCACCTCTGGG + Intronic
1180009583 21:45040609-45040631 CCTTCAGGGCTGCCACCTCCTGG + Intergenic
1183253078 22:36744021-36744043 CCCTCCATACTCCCACCTCAGGG + Intergenic
1183324411 22:37183676-37183698 CTCTCTGGGCTTCCACCTCAAGG - Intronic
950630443 3:14278589-14278611 ACCCCTAGGGTGCCTCCTCAGGG - Intergenic
952829092 3:37548711-37548733 CCCTCCATGCTGCCCTCTCAGGG - Intronic
953032055 3:39185737-39185759 CCCTCTAGGCCGCCACATTCTGG - Exonic
953384569 3:42499279-42499301 CCTTCAAGGCTTCCAGCTCAGGG - Intronic
953438665 3:42899472-42899494 CCCTCTCTACTGCCACCTCCTGG - Intronic
954187256 3:48927111-48927133 CCCTCTGGGCTGCCAGCTGTGGG + Intronic
957223326 3:77412265-77412287 CCCTCTGGGCATCCACCTCTGGG - Intronic
959302378 3:104619367-104619389 CTCTCTATGCTGCCTCCTCTTGG + Intergenic
960525583 3:118706033-118706055 CCCTCCAGGCTGCCCCATAATGG + Intergenic
961628047 3:128277063-128277085 CCCTCTGGCCTGGCACCTCAGGG + Intronic
962416431 3:135186875-135186897 CCCTCAAGGCTGTCAGCTGAGGG - Intronic
966744436 3:183262621-183262643 CCTTCTGGGCCGCCTCCTCATGG - Intronic
967728991 3:192889529-192889551 CCCTAGAGGCTGCAGCCTCAGGG - Intronic
968441585 4:627062-627084 CCCACCAGGCTGCCAGCCCAGGG + Intronic
974610282 4:64207714-64207736 CCCTCCAGGATGACACATCACGG - Intergenic
978617147 4:110609259-110609281 CCCTCTAGTCTGTGACCTCTTGG + Intergenic
982171759 4:152668690-152668712 CGCTGTGGGCTGCCACCCCAGGG + Intronic
986824316 5:11504542-11504564 CCCTCGTGGATGCCAGCTCAGGG - Intronic
986827036 5:11533045-11533067 CCCCCTGGGCTGCCACTTCATGG - Intronic
987150726 5:15036808-15036830 TCCTCTTGCCTGCCACCCCAAGG - Intergenic
994517562 5:100790221-100790243 CCCTCTAGGATGGCACTGCAAGG - Intergenic
995744720 5:115391666-115391688 CCTTATAGGCTGCAACATCAGGG + Intergenic
997524674 5:134544582-134544604 CCATCCAGGCTTCCAGCTCAGGG - Intronic
997997394 5:138597570-138597592 CCCTCTTGGCTGAAACCTGAAGG - Intergenic
998026863 5:138824634-138824656 CCTTATAGGCTGCGACATCAGGG - Exonic
1000377005 5:160592113-160592135 CCTCCTAGGATGCCACCTGATGG + Intronic
1001858291 5:175031783-175031805 CCCTCTAGCCTTCTCCCTCATGG + Intergenic
1002969315 6:1997608-1997630 CCCTTTAGGAAGCCACCACAGGG - Intronic
1006644860 6:35509131-35509153 CCCTCTAGGCTCCCAAGTCCAGG + Intronic
1008363816 6:50651983-50652005 CCCCCTAGCCTACCACCCCAGGG - Intergenic
1015444275 6:133285386-133285408 CCCTGCATGCTACCACCTCACGG - Intronic
1017511896 6:155121933-155121955 CCATCTGGGCAGCCAGCTCAGGG + Intronic
1018629441 6:165809560-165809582 GCCTCTAGCCTGCCAACTCCTGG + Intronic
1018643228 6:165924250-165924272 CCCTCTAGGCATACAACTCATGG + Intronic
1019262122 7:87574-87596 TCCTCTAGGCTGCATCCTGATGG + Intergenic
1019268469 7:132309-132331 CCCTGTGGGCTGTCAGCTCAAGG + Intergenic
1022955002 7:35372642-35372664 CCCCCTAGTCTGCCTGCTCATGG + Intergenic
1023134556 7:37038265-37038287 CCCACTTGGCTCCCACCTAAGGG + Intronic
1024119287 7:46220857-46220879 CCCTCTTCCCTCCCACCTCAGGG - Intergenic
1025025395 7:55512610-55512632 CCCTCCAGGCTGCAACCCGAAGG + Intronic
1034578917 7:152025892-152025914 CCCTCTAGGCGGCGGCCTCCCGG + Intronic
1034886279 7:154801513-154801535 CCCTAGAGGCTGTCACCCCACGG - Intronic
1035045769 7:155964343-155964365 CTCTCCAGGCAGCCACCTCCTGG + Intronic
1036033095 8:4993477-4993499 GCCTACAGGCTGCGACCTCAAGG - Intronic
1036228626 8:6981316-6981338 CCCTCTAGGCTGCCAGGCCTGGG + Intergenic
1036231078 8:7000426-7000448 CCCTCTAGGCTGCCAGGCCTGGG + Intronic
1036233526 8:7019525-7019547 CCCTCTAGGCTGCCAGGCCTGGG + Intergenic
1037370592 8:18173359-18173381 CCCTCTTGTTTTCCACCTCATGG + Intronic
1037516784 8:19639674-19639696 CCCTCTCTTCTTCCACCTCAAGG + Intronic
1041464954 8:58148569-58148591 CCCTCTCTGCTGCCACATCATGG - Exonic
1044457079 8:92401360-92401382 CCCTCTGGGCTGCCAGCTGCTGG - Intergenic
1047492653 8:125387351-125387373 CCCTCTGGGATCCCACCTCTGGG - Intergenic
1050674954 9:8041765-8041787 TCCCCCAGCCTGCCACCTCAAGG + Intergenic
1051345229 9:16145295-16145317 CCCTCTCTGCTTCCACCTCCTGG + Intergenic
1056482165 9:87016600-87016622 CCATCTAGGTTGGCACCTGAGGG + Intergenic
1057955832 9:99407090-99407112 CTCTGTTGGCTTCCACCTCACGG - Intergenic
1058720300 9:107758233-107758255 CCCTCTAGACTGTGAGCTCACGG + Intergenic
1060987200 9:127826573-127826595 CCCTCTCAGCTGCCCACTCAAGG + Exonic
1062355746 9:136161213-136161235 CCCACCAGGCTGCCTCCTGATGG - Intergenic
1185616735 X:1426512-1426534 CCTTCTAGGCTGCCACCGTGAGG + Intronic
1186404000 X:9285680-9285702 TCCTCTAGCCTGGCACCCCAGGG - Intergenic
1186718965 X:12282209-12282231 CCCTCCAGGCTGCCTGCTGAAGG + Intronic
1190054594 X:47174375-47174397 CTCGCTAGGGAGCCACCTCAGGG - Intronic
1191050258 X:56183878-56183900 CCATCTTGGCTGCCACCTCCGGG - Intergenic
1192100656 X:68261061-68261083 CCCTCTTGCCTGCCATCTCTTGG + Intronic
1196234359 X:113261630-113261652 CCCGCTATGCTGGCACCTCCAGG - Intergenic
1197489551 X:127100780-127100802 CCCTCTAGTCTGCCAACACCAGG + Intergenic
1199466725 X:148146357-148146379 CCCTCTAGGGTCCAACTTCAAGG - Intergenic
1199626983 X:149750340-149750362 CTCTCCCGACTGCCACCTCATGG + Intergenic
1199849470 X:151715176-151715198 CCCTGCAGGCTGGCAACTCAAGG + Intergenic
1199991079 X:152988104-152988126 CCATCTAGGCTTCCTGCTCATGG + Intergenic
1200102462 X:153694847-153694869 CCTCCTGGGCTGCCTCCTCAGGG + Exonic
1201364279 Y:13186435-13186457 CCCACAAGGCTGCAGCCTCATGG - Intergenic
1201888699 Y:18917562-18917584 CCCTGAAGCCTGCCACCTGAAGG + Intergenic