ID: 1103719020

View in Genome Browser
Species Human (GRCh38)
Location 12:122963694-122963716
Sequence TCTGAGATGCAGAGGGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 1, 2: 5, 3: 41, 4: 462}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103719009_1103719020 17 Left 1103719009 12:122963654-122963676 CCAGGAGGTAGGCACAACCCCTA 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1103719020 12:122963694-122963716 TCTGAGATGCAGAGGGGGAATGG 0: 1
1: 1
2: 5
3: 41
4: 462
1103719008_1103719020 22 Left 1103719008 12:122963649-122963671 CCTCTCCAGGAGGTAGGCACAAC 0: 1
1: 0
2: 1
3: 7
4: 117
Right 1103719020 12:122963694-122963716 TCTGAGATGCAGAGGGGGAATGG 0: 1
1: 1
2: 5
3: 41
4: 462
1103719015_1103719020 -2 Left 1103719015 12:122963673-122963695 CCTACTAATGCTGAGAAGGGGTC 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1103719020 12:122963694-122963716 TCTGAGATGCAGAGGGGGAATGG 0: 1
1: 1
2: 5
3: 41
4: 462
1103719012_1103719020 0 Left 1103719012 12:122963671-122963693 CCCCTACTAATGCTGAGAAGGGG 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1103719020 12:122963694-122963716 TCTGAGATGCAGAGGGGGAATGG 0: 1
1: 1
2: 5
3: 41
4: 462
1103719014_1103719020 -1 Left 1103719014 12:122963672-122963694 CCCTACTAATGCTGAGAAGGGGT 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1103719020 12:122963694-122963716 TCTGAGATGCAGAGGGGGAATGG 0: 1
1: 1
2: 5
3: 41
4: 462

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103719020 Original CRISPR TCTGAGATGCAGAGGGGGAA TGG Intronic
900626664 1:3611617-3611639 TAGGAGATGGGGAGGGGGAAGGG - Intergenic
900863704 1:5252024-5252046 CCTGGGATGCATGGGGGGAAAGG + Intergenic
901227845 1:7624753-7624775 TCTGGGGTCCAGAGAGGGAATGG + Intronic
901468991 1:9442559-9442581 TTTGAGATGCACAGGCAGAATGG + Intergenic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
901932132 1:12602559-12602581 TCTAATATGCAGAAGGAGAAGGG + Intronic
902264243 1:15249912-15249934 ACTGAGATGCAGAGAGGTTAAGG - Intronic
902478913 1:16701597-16701619 TCTGGGAGGCAGAGGGGGCCGGG - Intergenic
902712877 1:18252656-18252678 TCTGAGTGGAAGAGGAGGAAGGG + Intronic
903240284 1:21978233-21978255 ACTGAGGTCCAGAGGGCGAAAGG + Intronic
903244033 1:22002867-22002889 ACTGAGGTCCAGAGGGCGAAAGG + Intronic
903258490 1:22118398-22118420 TCTGAGAAGCAGATGGGTCAAGG + Exonic
903654060 1:24938208-24938230 TCTGAGGGCCAGAGAGGGAAGGG - Intronic
903848201 1:26290830-26290852 TCAGAGATGCAGAGGGTGGGGGG + Intronic
904054589 1:27661829-27661851 TCTGATCTGCAGAAGGGGTAGGG - Intergenic
904191085 1:28744275-28744297 AAAGAGATGCAGAGGGGTAATGG + Intronic
904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG + Intergenic
904644425 1:31955189-31955211 TCTAAGCTGAAGTGGGGGAAAGG + Intergenic
904807421 1:33141649-33141671 AATTAGATGAAGAGGGGGAAGGG - Intergenic
904934005 1:34113583-34113605 GCTGAGGGGCAGTGGGGGAAAGG + Intronic
905651633 1:39660801-39660823 TTTGAGCTGCAGAGGGGGGATGG + Intronic
905665217 1:39759530-39759552 TCTGCCATTCAGAGGGGAAAGGG + Exonic
906662489 1:47592988-47593010 TCTGGGAGAGAGAGGGGGAAGGG + Intergenic
906920582 1:50060397-50060419 TTTGAGCTGCTGAGGGGAAAAGG - Intronic
906937788 1:50229465-50229487 ACTGAGATTCAGAGAGGGAAAGG - Intergenic
907509489 1:54947580-54947602 ATTGAGATGCAGAGAGGGGAAGG + Intergenic
907569637 1:55470978-55471000 AGTGGGATGCAGAGTGGGAAAGG - Intergenic
908006281 1:59732519-59732541 TCAGAGATGAAGATGAGGAATGG + Intronic
908315517 1:62928272-62928294 TCTGGGAGGCCGAGGGGGGATGG + Intergenic
908512341 1:64859473-64859495 TCTGAGATGCAGGTGGGACAAGG + Intronic
908820306 1:68078830-68078852 TGGGGGATGCAGTGGGGGAAGGG + Intergenic
910535013 1:88287843-88287865 TCTGAGAGGCAAGGAGGGAAGGG - Intergenic
910882030 1:91930324-91930346 TCTGAGATGGGGAGGGGCACAGG + Intergenic
913047713 1:115088728-115088750 TCTGAGAAGGGGATGGGGAATGG - Intronic
915361801 1:155290368-155290390 TGTGAAATGGAGATGGGGAAGGG + Exonic
915731754 1:158058957-158058979 TTGGAGATGCAGAGAGGGAGTGG + Intronic
915906478 1:159881794-159881816 TCTCAGGTGCAGAGGGGCATCGG + Intronic
916461415 1:165028802-165028824 TTTGGGATGCTAAGGGGGAAAGG + Intergenic
917368089 1:174256075-174256097 TCTGAACTGGAGTGGGGGAAAGG - Intronic
917495916 1:175540072-175540094 TCTCAGATGTAGAGTGGGGAGGG + Intronic
917511383 1:175671944-175671966 TGTGTGTTGGAGAGGGGGAAAGG + Intronic
917728288 1:177848578-177848600 TCTGAGAGGGAGAGGGAGAGAGG - Intergenic
919148203 1:193661635-193661657 TCTGAGATTTAGAGGGCAAATGG + Intergenic
919793315 1:201306165-201306187 TCTCAGGTGTAGAGGGGGAAAGG + Intronic
920058035 1:203206744-203206766 TCTGAGATGCAGAATGAAAAAGG - Intergenic
920333800 1:205230484-205230506 AGTGAGATGGTGAGGGGGAAGGG + Intronic
920623966 1:207577905-207577927 TCTTGGAAGCAGAGGGAGAAAGG + Exonic
920636605 1:207710482-207710504 TCTTGGAAGCAGAGGGAGAAAGG + Intronic
920668731 1:207986504-207986526 TCTGAGACGCTGAGGGGTGAAGG - Intergenic
920673136 1:208020069-208020091 TCTGAGATTCAGAGAGGTTAAGG - Intergenic
920690051 1:208139365-208139387 TGTGTGATGAAGAGGGGGCAGGG - Intronic
921297028 1:213713736-213713758 TCAGAGATGCAGAGGAGGCTGGG - Intergenic
921315431 1:213886008-213886030 TCAGAGATGCAGAGAGAGGAAGG - Intergenic
922469787 1:225868946-225868968 TCTGTGCTACAGAGGGAGAAGGG + Intronic
922540819 1:226418015-226418037 TGTGAGAGGCAGAGGGGGCTTGG + Intergenic
922787149 1:228288565-228288587 TCTGGGAAGCACAGGGGGACAGG - Intronic
1063131526 10:3181996-3182018 TTTGAGACACAGAGGGGAAAAGG + Intergenic
1063328689 10:5133170-5133192 TCCGAGATGAAGTGGGGGAGGGG - Intronic
1064683682 10:17836885-17836907 TCAGAGGTGCAGAGGTGAAATGG + Intronic
1064764813 10:18659772-18659794 TCGGAGACGCGGAGGAGGAAGGG + Intronic
1065384154 10:25117034-25117056 TGTGAGATACAGAGAGGGAAGGG - Intergenic
1066498772 10:35970240-35970262 TGTGAGGAGCAGAGGAGGAAAGG - Intergenic
1066658780 10:37720096-37720118 TCTGAGATGCAGAGGGGGCTGGG - Intergenic
1067043176 10:42969338-42969360 TCTGAGATTCAGATGGGGCTGGG - Intergenic
1067386276 10:45819888-45819910 TCTGAGAGGCAGAGGGGCAGTGG + Intergenic
1067447992 10:46364677-46364699 TCTGAGAGGCAGAGGGGCAGTGG - Intergenic
1067589385 10:47496084-47496106 TCTGAGAGGCAGAGGGGCAGTGG + Intergenic
1067636512 10:48004163-48004185 TCTGAGAGGCAGAGGGGCAGTGG + Intergenic
1067876976 10:50016162-50016184 TCTGAGAGGCAGAGGGGCAGTGG - Intergenic
1068168778 10:53365891-53365913 TTTGAGAAGCAGAATGGGAATGG + Intergenic
1068267664 10:54673978-54674000 TCTGATAAGAAGAGGGGCAATGG - Intronic
1070133061 10:73668147-73668169 TCTGAGAGGCAGAGGGGCAGTGG + Intergenic
1071608609 10:87015887-87015909 TCTGAGAGGCAGAGGGGCAGTGG - Intergenic
1071758360 10:88571782-88571804 TCTGAGATCCAGAGGTGAACAGG - Intronic
1072530065 10:96310526-96310548 TCTGGGAAGCAGAGAGGTAAAGG - Intronic
1072559466 10:96557553-96557575 TCTTAAATGCAAAGGGGGCAGGG - Intronic
1073339172 10:102732041-102732063 TCTGAGATGGTAAAGGGGAAGGG - Intronic
1073716527 10:106114571-106114593 CCTGAGATCCACAGAGGGAAAGG + Intergenic
1074200205 10:111227833-111227855 TATCAGATGAAAAGGGGGAAAGG + Intergenic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1076607644 10:131700010-131700032 TTTGAGCTGCAGAGGGAGCATGG - Intergenic
1077262820 11:1632120-1632142 TCTGAGATGCAGGGGTGGGCAGG - Intergenic
1077648376 11:3946884-3946906 CCTGAGACACAGAGAGGGAAAGG - Intronic
1078064970 11:8072281-8072303 TTGGAGATGCAGAGGGGGAAGGG + Intronic
1078312155 11:10255048-10255070 TCACAGAAGCAGAGGGTGAATGG + Intronic
1078355797 11:10630573-10630595 TCTGATAGGCAGTGGGGGATGGG - Intronic
1078357210 11:10641490-10641512 TTTGAGAGGCAGAGGGTGAGAGG - Intronic
1078360104 11:10661338-10661360 CCTGAGGTGAAGAGGAGGAATGG - Intronic
1079085192 11:17440173-17440195 GCTGAGATAGAGAGAGGGAAGGG - Intronic
1079092521 11:17491128-17491150 TCTGGGAGTCAGAGGGGAAAGGG - Intergenic
1080202467 11:29688794-29688816 TCAGAGAGACAGAGAGGGAAAGG + Intergenic
1080770931 11:35340699-35340721 TCTGAGATGCCAAAGGGGAGGGG - Intronic
1081273056 11:41110999-41111021 TCAGAGATGCAGATGCTGAAGGG + Intronic
1081448876 11:43154196-43154218 TCTAATATCCAGAGGGGGAGTGG + Intergenic
1081831748 11:46120825-46120847 GGAGAGAGGCAGAGGGGGAAGGG + Intronic
1082627108 11:55499500-55499522 GCTGGGAAGCATAGGGGGAAGGG - Intergenic
1082814922 11:57501324-57501346 TCTCAGCTGAGGAGGGGGAAGGG + Exonic
1083161487 11:60857081-60857103 GCTGAGATGCTGAGGTTGAAGGG - Intergenic
1084665914 11:70576190-70576212 GCTGGGATGCAGACGAGGAAAGG + Intronic
1085457898 11:76675611-76675633 TCTGCGATGCAGTGAGGGAGGGG - Intergenic
1085641925 11:78198106-78198128 TCTGAGAGGAAGAGAGGGAGGGG - Intronic
1086039929 11:82463898-82463920 GCTGAGGTGAAGAGGTGGAAGGG - Intergenic
1087983129 11:104642204-104642226 GCTGGGAAGCAGAGTGGGAATGG - Intergenic
1088509765 11:110562371-110562393 TTTAAAATACAGAGGGGGAATGG - Intergenic
1088767604 11:112998997-112999019 TCTGAAATAAAGAGGGGGAGGGG - Intronic
1088888728 11:114028316-114028338 TCCCAGAGGCAGTGGGGGAATGG - Intergenic
1089659007 11:119973792-119973814 TCTGAGAGGCAGAGGGGGCCTGG + Intergenic
1090097456 11:123756929-123756951 TGTGAGATGCAGAGGGAGGTGGG + Intergenic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090722002 11:129483919-129483941 TCTGAGAGGCTGAGGTGGGAGGG - Intergenic
1091617285 12:2059219-2059241 GCTGAGATGCAGAAGGTGAGGGG + Intronic
1092569479 12:9707464-9707486 AATGATATGCAGTGGGGGAAGGG + Intergenic
1094006510 12:25758213-25758235 TATGTGATGCAGAGTGGGGAAGG + Intergenic
1095425459 12:42070043-42070065 TCTGGGGTCCAGTGGGGGAAAGG + Intergenic
1095808376 12:46345720-46345742 TCTGAGAGGCCAAGGCGGAAGGG + Intergenic
1096482257 12:51950406-51950428 TCTGAGATCTAGGGGTGGAAAGG - Intergenic
1096623338 12:52878146-52878168 GCTGAAAGGCGGAGGGGGAAGGG - Intergenic
1096882207 12:54682346-54682368 TCTTGGATGTAGAAGGGGAAGGG + Intergenic
1097051944 12:56229016-56229038 TCTGAGAACCAGAATGGGAATGG + Exonic
1099980724 12:89598875-89598897 TTTGAGATGAAGTGGGGGATGGG + Intronic
1101276211 12:103204114-103204136 TGGGAGATGCACAGGGGAAAAGG + Intergenic
1101972855 12:109328597-109328619 CATGAAATGCAGAAGGGGAAAGG - Intergenic
1102020595 12:109679668-109679690 ACTAAGGTCCAGAGGGGGAAAGG + Intergenic
1102654811 12:114473151-114473173 TCTGAGAGACAGAGAGAGAAAGG - Intergenic
1103033978 12:117641521-117641543 ACAGAGATGCACAGGGAGAAAGG - Intronic
1103719020 12:122963694-122963716 TCTGAGATGCAGAGGGGGAATGG + Intronic
1103727290 12:123004462-123004484 TCTGAGATGCTGTGGCGGGAAGG + Exonic
1103926068 12:124423875-124423897 ATTGAGGTTCAGAGGGGGAATGG + Intronic
1104684932 12:130778608-130778630 TCTGAGAAGGAGAGGAGGCAAGG - Intergenic
1105045060 12:132995990-132996012 TCTGTCATGCAGTAGGGGAATGG + Intronic
1105203327 13:18197413-18197435 TCTGGGAGACAGAAGGGGAATGG - Intergenic
1106169668 13:27278140-27278162 TCTGAGTTAAAGAAGGGGAAAGG - Intergenic
1106186258 13:27412533-27412555 ACTGAGATGGAGAGGGCCAAGGG + Intergenic
1106259452 13:28052544-28052566 TTTGCGATTCACAGGGGGAAAGG - Exonic
1106726459 13:32491132-32491154 TCTGAGATTCTGAAGGGAAAAGG + Intronic
1107715053 13:43191789-43191811 TCTGAGAGGCGGAGGGGGAGGGG + Intergenic
1109835336 13:67849709-67849731 TGTGAGATACAGAGCAGGAAAGG - Intergenic
1110732036 13:78889811-78889833 TTTGAGATGAAGAGGTGGCATGG - Intergenic
1111188728 13:84780157-84780179 TCTGAGTTTCAGAGGTGGAGGGG - Intergenic
1112262070 13:97886143-97886165 TCTCTGAGGCAGAGGGGGAATGG + Intergenic
1113050290 13:106203835-106203857 TTGGAGACTCAGAGGGGGAAGGG - Intergenic
1114320777 14:21545554-21545576 TCTGAGAGGCAGAGGTTGCAGGG - Intergenic
1114437046 14:22715006-22715028 TCTAATATGCAGAAGGGGAGAGG + Intergenic
1115238341 14:31230113-31230135 TCTGAGGTGCAGAGGCTGAGAGG + Intergenic
1116519029 14:45828888-45828910 TCTGATATTTAGAGGGGGAGAGG + Intergenic
1116569712 14:46499857-46499879 TCTGTCATGCTGAGGGGGAGGGG + Intergenic
1117092247 14:52262881-52262903 TCTGAGATGGAGATGAGGATAGG - Intergenic
1117178143 14:53165978-53166000 TCTGCCATCCAGAGGGGAAAAGG + Intergenic
1117355339 14:54918676-54918698 TCTGAGCTTCAAAGGAGGAATGG + Intergenic
1117863287 14:60116213-60116235 GGCGAGATGGAGAGGGGGAATGG - Intronic
1118990097 14:70790165-70790187 CCTGAGCAGCAGTGGGGGAAGGG + Intronic
1119080409 14:71687833-71687855 TCTAAGCTGCAGAGGTGAAAGGG + Intronic
1119154096 14:72392626-72392648 TGTGAGATTCAGAGGAGGCAGGG - Intronic
1119319453 14:73720985-73721007 TCTGAGATTCAGAGGGAAAAAGG - Intronic
1119438074 14:74611093-74611115 TCTGAGAGGCAGCGGGGAGAGGG - Intronic
1119878961 14:78085045-78085067 GCTGAGATGCAGAGAGAGTAAGG - Intergenic
1121627682 14:95398568-95398590 TCTGAGGTACAGAGAGGGAATGG + Intergenic
1121724294 14:96135316-96135338 CCTGAGATGGAAATGGGGAAAGG - Intergenic
1122025958 14:98876301-98876323 TCTCAGATGCGGAGAGGGAAAGG + Intergenic
1122209831 14:100166879-100166901 TTTGAGATGCCGAGGCGGGAGGG + Intergenic
1122273749 14:100580610-100580632 TCTGAGGGACAGAGGGGGACAGG - Intronic
1122363917 14:101183267-101183289 CCAGAGATGCAGAGGAGGGAGGG - Intergenic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1125717512 15:41827637-41827659 TCAGACATGCAGAAGGGGACGGG - Exonic
1126450841 15:48807127-48807149 TCTGAGAAGCAGAGGCTGGAGGG - Intronic
1126894280 15:53241572-53241594 ACTGATATGCAAAGGAGGAAGGG + Intergenic
1127060463 15:55177494-55177516 TTTGAGAGGCAAAGGCGGAAGGG - Intergenic
1127400849 15:58584490-58584512 TCTGAGATGAAGAGAGAGACTGG - Intergenic
1128334248 15:66775896-66775918 ACTGAGAGGCACAGGGGGAGGGG + Intronic
1128515845 15:68341455-68341477 GTTGAGGTTCAGAGGGGGAAGGG + Intronic
1128760312 15:70212328-70212350 TCTGAGAGGAAGAAGTGGAAAGG - Intergenic
1128925309 15:71649961-71649983 TCTGACATCCAGAGGAGGGACGG + Intronic
1129342980 15:74898131-74898153 CCTCAGCTGCAGAGGAGGAAAGG + Exonic
1130086564 15:80782483-80782505 CCTGAAATGCAGAGCTGGAAGGG - Intronic
1131147667 15:90024653-90024675 TATGAGAGGAAGAGGGGGCATGG - Intronic
1131714794 15:95096691-95096713 TCTGCCAGGCAGAAGGGGAATGG - Intergenic
1131804758 15:96109805-96109827 TTTAAGATGCAGAGAGGGAGAGG + Intergenic
1132028970 15:98425278-98425300 TCTGATATGCAGGGGAGGGAAGG + Intergenic
1132478273 16:153333-153355 TCTGACAAGCAGAGGGTGAAAGG + Intronic
1132480358 16:163923-163945 TCTGACAAGCAGAGGGTGAAAGG + Intronic
1132725330 16:1335926-1335948 TCTGAGATGCAGGGAGCAAAGGG + Intronic
1133469258 16:6058341-6058363 TCTGAGAAGGAGAGGGAGGAAGG - Intronic
1133971551 16:10571760-10571782 ACTGAGATGAAGAGAGGGGATGG + Intronic
1134167348 16:11941337-11941359 TCTGAGTTGGGGAGGGGGAGGGG + Intronic
1134493346 16:14712344-14712366 TCTGAGTTGGGGAGGGGGAGGGG - Intronic
1134498727 16:14751468-14751490 TCTGAGTTGGGGAGGGGGAGGGG - Intronic
1134525281 16:14938098-14938120 TCTGAGTTGGGGAGGGGGAGGGG - Intronic
1134547612 16:15122810-15122832 TCTGAGTTGGGGAGGGGGAGGGG + Intronic
1134581846 16:15377617-15377639 TCTGAGTTGGGGAGGGGGAGGGG + Intronic
1134712869 16:16336582-16336604 TCTGAGTTGGGGAGGGGGAGGGG - Intergenic
1134720735 16:16379900-16379922 TCTGAGTTGGGGAGGGGGAGGGG - Intronic
1134946692 16:18331985-18332007 TCTGAGTTGGGGAGGGGGAGGGG + Intronic
1134953951 16:18372100-18372122 TCTGAGTTGGGGAGGGGGAGGGG + Intergenic
1135312775 16:21418979-21419001 TCTGAGTTGGGGAGGGGGAGGGG + Intronic
1135446116 16:22519903-22519925 TCTGAGTTGGGGAGGGGGAGGGG - Intronic
1135584566 16:23658970-23658992 TCTCAGATACAGAGAGGGATAGG - Intronic
1136173227 16:28500659-28500681 TCAGAGAATCAGAGGGAGAAAGG + Intronic
1136194821 16:28644473-28644495 TCTGAGTTGGGGAGGGGGAGGGG - Intronic
1136309451 16:29397738-29397760 TCTGAGTTGGGGAGGGGGAGGGG + Intronic
1136322892 16:29499493-29499515 TCTGAGTTGGGGAGGGGGAGGGG + Intronic
1136437576 16:30239461-30239483 TCTGAGTTGGGGAGGGGGAGGGG + Intronic
1136619672 16:31419985-31420007 TTTTAGAGGGAGAGGGGGAAAGG - Intronic
1137521214 16:49196882-49196904 ACTGAGGAGCAGAGAGGGAAAGG - Intergenic
1137625483 16:49905371-49905393 TGTGGGAGGCAGAGGGGGAGAGG - Intergenic
1138528668 16:57623092-57623114 ACTGAGACTCAGAGAGGGAAAGG - Intronic
1139857140 16:69990125-69990147 TCTGAGTTGGGGAGGGGGAGGGG + Intergenic
1140408728 16:74728351-74728373 GCTGAGATCCAGAGGCAGAATGG + Intronic
1140919224 16:79521399-79521421 TCTCAAATGCAGATGAGGAAAGG + Intergenic
1141434970 16:83994771-83994793 TCTGGGCTGCAGAGGGGCCAGGG + Intronic
1141915177 16:87091505-87091527 AAAGAGATGCAGAGGGGCAAAGG - Intronic
1143784405 17:9245803-9245825 TCTGAGAGGCAGAGGGGAATGGG - Intergenic
1144080862 17:11762696-11762718 TCTGAGGTGAAGAGGTAGAAGGG + Intronic
1144126874 17:12211026-12211048 TCTGAGAAGCAGAGAGAAAATGG + Intergenic
1144754131 17:17669270-17669292 TCAGGGATGCAGAGGCGGGAGGG - Intergenic
1145028451 17:19486798-19486820 TGGCAGATGCAGAGGTGGAAGGG - Intergenic
1146022666 17:29293000-29293022 ACTGAGGAGCGGAGGGGGAAGGG - Intronic
1146558298 17:33846474-33846496 TCTGATCTGCAGAGTGGGATGGG + Intronic
1146905091 17:36613057-36613079 CCTGAGATGCCGAGATGGAAAGG + Intergenic
1147262855 17:39218803-39218825 TCTGAGAGGCTGAGGCGGGAGGG + Intronic
1147332666 17:39708059-39708081 ACTGAGATACAGAGAGGGCAGGG + Intronic
1147768325 17:42851460-42851482 TGGGAGATACAGAGGGGCAATGG - Exonic
1148080712 17:44966655-44966677 TCTGAGATGGGGACGGAGAATGG + Intronic
1148154008 17:45412328-45412350 TCTGAGAGGCACAAGGGGGAGGG + Intronic
1148516123 17:48219475-48219497 GCTGAAATCTAGAGGGGGAAGGG - Intronic
1148819671 17:50353382-50353404 TCTGAGAGCCAGTGGGGGACGGG + Intronic
1149522882 17:57331357-57331379 TCTGAGCTGGGGAGGGGGCAGGG + Intronic
1151813643 17:76460065-76460087 TGCTGGATGCAGAGGGGGAAGGG - Intronic
1152223395 17:79081658-79081680 TCTGAGATCTAGGAGGGGAAAGG + Intronic
1153016764 18:589720-589742 TCTAACATGCAGAAAGGGAAAGG - Intergenic
1153378255 18:4406259-4406281 TCTGTGATGCAGAAAGGGAGGGG + Intronic
1154173278 18:12066397-12066419 TCTGGGAGGCCGAGGGGGAGCGG - Intergenic
1155481039 18:26287919-26287941 AATGAGATGCAGAGTGGGAAGGG - Intronic
1156110525 18:33720476-33720498 TGTGTGTAGCAGAGGGGGAAGGG - Intronic
1156445121 18:37230951-37230973 TGTGAGCTGCAGAGGGGAGAAGG - Intronic
1156530084 18:37806487-37806509 CCTGAGAGGCACAGGGGGCAGGG - Intergenic
1156985770 18:43349852-43349874 TCTGAGAACCAGAGGGACAAAGG + Intergenic
1157269932 18:46265572-46265594 ATTAAGATGCAGAGGGGGAGGGG + Exonic
1157437102 18:47679998-47680020 TCTGAGAAACAGAGAGGGAGAGG - Intergenic
1157459472 18:47874769-47874791 CTTGAGGTGCAGAGTGGGAAGGG + Intronic
1157676119 18:49569833-49569855 TCTGAGATGCCTATAGGGAAGGG - Intronic
1160135782 18:76270457-76270479 TCTGACATGCAGAGGGGCTTAGG - Intergenic
1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG + Exonic
1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG + Intronic
1162968833 19:14168127-14168149 CCAGGGATGCAGAGGGGGAGCGG - Intronic
1163152666 19:15424378-15424400 TCTAAGGTGGAGAGGGGGACGGG + Exonic
1163526600 19:17825167-17825189 ACTGAGACCCAGAGAGGGAAAGG + Exonic
1164158690 19:22612296-22612318 TGGGGGATGCAGAGGGGGTAGGG - Intergenic
1164994373 19:32708884-32708906 TGGGAGATGCAGAGAGGGTAAGG - Intronic
1165718799 19:38064102-38064124 TTTGAAATGCAGAAGTGGAATGG - Intronic
1165728504 19:38129293-38129315 TCTGAGGAGGAGATGGGGAAAGG + Intronic
1165745685 19:38228693-38228715 AGCGAGATGGAGAGGGGGAAGGG + Intronic
1165982770 19:39738535-39738557 TCTGAGAGACAGAGTGGGAGTGG - Intergenic
1166109745 19:40614659-40614681 CTTCAGCTGCAGAGGGGGAATGG - Intronic
1166237360 19:41466259-41466281 TCTAATATACAGAGGGGGAGAGG - Intergenic
1166317442 19:41997130-41997152 TCTGAGACGCAGAAGGGGACGGG + Intronic
1167019449 19:46862521-46862543 TGTGAGATGCAGAACAGGAAGGG - Intergenic
1167217170 19:48172165-48172187 CCAGAGATGCAGAGGGGGAGAGG + Intronic
1167571358 19:50290888-50290910 TGAGAGATGCAGAGGTGGAGCGG + Exonic
1167684931 19:50950214-50950236 TCTGACATGCTGAGGGGGCAGGG + Intronic
1167963074 19:53123032-53123054 CCTGGGATCCAGAGAGGGAAAGG - Intronic
1168115750 19:54220679-54220701 TCTCAGACGCAGTGGGGGATGGG + Exonic
1168118736 19:54240425-54240447 TCTCAGACGCAGTGGGGGATGGG + Exonic
1168181265 19:54664312-54664334 TCTCAGATGCAGTAGGGGATGGG - Exonic
1202712954 1_KI270714v1_random:27504-27526 TCTGGGAGGCAGAGGGGGCCGGG - Intergenic
925059054 2:876880-876902 TCCGAGCTGCAGAGAGTGAAAGG - Intergenic
925943891 2:8843088-8843110 TCAGATCTGCAGTGGGGGAAGGG - Intergenic
925947790 2:8881558-8881580 TGTGAGAGGCACAGGGGAAATGG + Intronic
927207669 2:20620264-20620286 ACTGAGGTGCAGAGAGGCAAAGG + Intronic
927720689 2:25379984-25380006 GAGGAGATGCAGAGGAGGAAGGG + Intronic
928023698 2:27723000-27723022 CCTGGGATGCAGAGGTTGAAGGG - Intergenic
928387458 2:30882688-30882710 TCTGAGTTGCAGAGGGGCAAGGG - Intergenic
929262750 2:39883884-39883906 TTTTAGATGCAGAGGAAGAAGGG + Intergenic
930000962 2:46861228-46861250 ACAGAGATGGAGAGGGAGAAGGG - Intergenic
931250437 2:60526450-60526472 TCTGCGATGCAGAGGGGGTGGGG - Intronic
934522846 2:95030726-95030748 TCTGAGGCACAGAGGAGGAAGGG - Intronic
934555910 2:95286924-95286946 TCTGAGGTGCAGAGTGAGATGGG - Intronic
935228973 2:101079616-101079638 TTTGAGAGGCTGAGGTGGAAGGG - Intronic
935301119 2:101694877-101694899 TCTGGTATGCAGAGGAGGAAAGG + Intergenic
935840490 2:107104310-107104332 TCTGAAATGTAGAGAGGAAAGGG - Intergenic
938108277 2:128547860-128547882 CCTGGGAAGCAGAAGGGGAAAGG + Intergenic
938157273 2:128952220-128952242 TCTGGAGTGCAGAGGGGGAGTGG - Intergenic
939176689 2:138757298-138757320 TCTGAGATGTAGAAGGCGTAAGG + Intronic
940859994 2:158761541-158761563 GCTGGGATGGGGAGGGGGAATGG + Intergenic
941857045 2:170241921-170241943 TGTGAGATGCAGAGGCAGCAGGG + Intronic
944217210 2:197268304-197268326 TCTGAGATGCACTGGGGCACGGG + Intronic
944589381 2:201202777-201202799 GCTGAGAGTCATAGGGGGAAGGG + Intronic
944648669 2:201806606-201806628 TAGGAGAGGCAGTGGGGGAAAGG + Exonic
944721720 2:202429363-202429385 ACTGGAATGCAGAGTGGGAAAGG - Intronic
945309842 2:208298916-208298938 TCTGAGAGGCAGAGGTTGCAGGG - Intronic
945670762 2:212800296-212800318 GATGAGATGCAGAGGATGAAGGG - Intergenic
946104433 2:217356842-217356864 GCTGAGAGGCCAAGGGGGAAGGG - Intronic
946239233 2:218343769-218343791 TGTGAGAAGCAGAGGTGGTACGG - Intronic
947131508 2:226931477-226931499 TTTGAGACTCAGAAGGGGAAAGG + Intronic
947661165 2:231869656-231869678 TCTGTGATGGAAAGGGGGAAAGG - Intergenic
947713390 2:232328365-232328387 CCTGAGATGCAGAGGAAGAAGGG - Intronic
947931867 2:233971502-233971524 TCTGAGGTGCAGATGGGGAATGG + Intronic
948546730 2:238737635-238737657 ACTGAAATGCAGAGAGGAAAAGG - Intergenic
948947604 2:241229012-241229034 CCTGAGAGGCAGAGGGTGACGGG - Exonic
1168912070 20:1456201-1456223 TCTGAAATGCTGAGGGGTCAAGG + Intronic
1169081327 20:2799282-2799304 GCTGAGATGCAAAGGAAGAATGG - Intronic
1170015106 20:11771623-11771645 TCTAACATGAAGAGGAGGAACGG - Intergenic
1170579647 20:17688144-17688166 TCTCAGGTGCAGATGGGGATGGG + Intergenic
1170814968 20:19706068-19706090 TCTGAGATGCAATGGAGGGAGGG + Intronic
1171727916 20:28642767-28642789 TCTGTGATACAGAAGGGAAAAGG + Intergenic
1171777034 20:29378425-29378447 TATGTGAAGCAAAGGGGGAAGGG + Intergenic
1172225357 20:33301923-33301945 ATTGAGGTCCAGAGGGGGAAAGG + Intronic
1172484793 20:35291726-35291748 ACTGAGGTCCAGAGAGGGAAGGG - Intronic
1172616254 20:36287061-36287083 CCTGAAATTCAGTGGGGGAAAGG - Intergenic
1173193488 20:40894894-40894916 AATGAGGTTCAGAGGGGGAAAGG + Intergenic
1173333917 20:42098013-42098035 GCTGCATTGCAGAGGGGGAAGGG + Intronic
1173648255 20:44647103-44647125 TCTCTGATGCAGAGGGGAATTGG - Intronic
1175201831 20:57283376-57283398 TCTGAGATGGAAAAGGGGGAGGG + Intergenic
1175225705 20:57442694-57442716 CCTGAGCTGCAGAGGGGCAGAGG - Intergenic
1176314490 21:5229299-5229321 TCTGTGATACAGAAGGGAAAAGG + Intergenic
1176711390 21:10152769-10152791 TGTGAGTTGCAGAGGGAGACTGG + Intergenic
1178251167 21:31004611-31004633 TCCAAGATGCAGAGGGAGCAAGG + Intergenic
1178504102 21:33149322-33149344 TATGAACTGGAGAGGGGGAAAGG - Intergenic
1179640587 21:42745155-42745177 TCTCAGAGGCAGAAGGTGAAGGG + Intronic
1180392278 22:12295273-12295295 TCTGTGATACAGAAGGGAAAAGG + Intergenic
1180407467 22:12569499-12569521 TCTGTGATACAGAAGGGAAAAGG - Intergenic
1180594031 22:16962131-16962153 TGGGAGAGGCAGAGAGGGAAGGG - Exonic
1181465730 22:23109672-23109694 TCTGAGATGCTGAGGGAGACAGG - Intronic
1182120685 22:27784442-27784464 TCTCAGACGCAGAGGAGGGAAGG + Intronic
1182558501 22:31141617-31141639 ACTGTGTGGCAGAGGGGGAAGGG + Intergenic
1182674899 22:32031512-32031534 GCTGAGAAGCAGAGAGGGGAGGG - Intergenic
1183138431 22:35913229-35913251 TTTGAGAGGCAGAGGAGGAAAGG + Intronic
1183465097 22:37975873-37975895 TGTGAGATCCAGAGGTGGCATGG - Intronic
1183543439 22:38443122-38443144 TCAGAGCTGCTGAGAGGGAAGGG - Intronic
1183929227 22:41226624-41226646 GCTCAGATGCAGAGGGAGAGGGG - Intronic
1184206451 22:43007036-43007058 TCAGGGATGCAGATGGGGGAGGG - Intronic
1184502015 22:44880064-44880086 TCTGAGATGGGGAGGTGGGAGGG + Intergenic
949441490 3:4085893-4085915 TTTGAGAGGCAGAAGAGGAAAGG - Intronic
949890558 3:8730778-8730800 TCAGAGAGGCAGAGAGGAAAGGG - Intronic
950229718 3:11265942-11265964 TTTGGGATGCAGAGGTGGGAGGG + Intergenic
953533875 3:43762212-43762234 TCTGAGATGATGAGGGCGAGGGG + Intergenic
954439790 3:50515625-50515647 ACTGAGAGGCAGAGGAGAAATGG - Intergenic
954505760 3:51071084-51071106 TCTGTGGTTCAGATGGGGAAAGG + Intronic
955573919 3:60338079-60338101 CCTGAGATGCAGCAGGGGACAGG + Intronic
958535310 3:95395565-95395587 TGTAAGATCCAGAGGGGGCAGGG - Intergenic
959207353 3:103327031-103327053 TCTGAGATGTAAAGGAAGAAAGG + Intergenic
961110022 3:124276026-124276048 TCTCAGATGTAGAGGGTGCATGG - Intronic
961497647 3:127306151-127306173 TCTGCCATGCAGAGGAGGAGTGG - Intergenic
964888846 3:161515213-161515235 TCTAATATGCAGAGGGGGAGAGG - Intergenic
964889071 3:161516594-161516616 TCTGATATCCAGAGGGGAAGAGG - Intergenic
965317052 3:167205246-167205268 TGGGAGATGCAGAGGGAGAAGGG + Intergenic
965483107 3:169244442-169244464 GCTGAGAAGCTGAGGGGGACAGG - Intronic
965571363 3:170177081-170177103 CCTTAGGGGCAGAGGGGGAAGGG - Intronic
967038133 3:185663354-185663376 ACTGAGAGGCAGAGGGAGATGGG + Intronic
967081026 3:186049597-186049619 CTGGAGACGCAGAGGGGGAAGGG + Intronic
969244797 4:5925199-5925221 TCTGAGATGGGCAGAGGGAAGGG + Intronic
969484536 4:7464840-7464862 TGAGAAATGCAGATGGGGAATGG + Intronic
970531107 4:16985365-16985387 TCTCAGCTGCTGAGGTGGAAGGG - Intergenic
971154110 4:24064064-24064086 TCTGGGAAGGAGATGGGGAAAGG - Intergenic
971325313 4:25638670-25638692 TGTGAGGGGCAGAGGGGGGAAGG + Intergenic
971827384 4:31643535-31643557 TCTGAGATGCAGGCAAGGAAAGG + Intergenic
972456712 4:39262626-39262648 TATGAGATGCAGAGGTGCAGCGG - Intronic
974671058 4:65030842-65030864 TGGAAGCTGCAGAGGGGGAAAGG - Intergenic
975856236 4:78627486-78627508 TCTGGGATGGGGATGGGGAAGGG + Intergenic
977297089 4:95222776-95222798 TTTGAGATGGAGCGGGGGAGAGG - Intronic
978068169 4:104432125-104432147 ACTTAGAGGCAAAGGGGGAAGGG - Intergenic
979749663 4:124263152-124263174 TCTGATATACAGAGGAAGAAAGG - Intergenic
980459680 4:133092279-133092301 TCTGAGAAGCAGAAGTGCAAAGG - Intergenic
982200505 4:152955853-152955875 TCTGGGAAGAAGAGTGGGAAAGG - Intronic
985432624 4:189896099-189896121 TCTGTGATACAGAAGGGAAAAGG - Intergenic
985682193 5:1261886-1261908 CCTGAGAGGTAGAGGAGGAAAGG - Intronic
985896926 5:2754217-2754239 ACTGAGCTAAAGAGGGGGAAGGG - Intronic
985964221 5:3327565-3327587 TCTGAGTTTCAGAGAAGGAAAGG - Intergenic
986134515 5:4962433-4962455 AGTGAGTTGTAGAGGGGGAATGG - Intergenic
986221090 5:5769473-5769495 TCTGAGAAGCAGAAGATGAAGGG - Intergenic
986231316 5:5867058-5867080 ACTGAGAGGTACAGGGGGAAAGG - Intergenic
986646036 5:9916880-9916902 TGTGAGATAAGGAGGGGGAAAGG + Intergenic
986797044 5:11222848-11222870 TTGGAGATGGGGAGGGGGAAAGG - Intronic
986806130 5:11310668-11310690 ACTGAGATGCCGCTGGGGAAAGG - Intronic
987938157 5:24496409-24496431 TCTGAGATGGAAAAGGTGAAGGG + Intronic
988356489 5:30183125-30183147 TCTGTGTTGGAGAGAGGGAAAGG + Intergenic
988588858 5:32531486-32531508 TTTGGGATGCAGAGGTGGGAGGG - Intergenic
988785315 5:34561389-34561411 TCTTAGATCCAGAGGGAGGAAGG - Intergenic
990168892 5:53025586-53025608 CCTGAAATGCAGAGGCGCAATGG + Intronic
990508949 5:56472392-56472414 TTTGAGAGGCCGAGGGGGACGGG + Intronic
992076728 5:73198763-73198785 TGTGGGATGCAAAGGGTGAAAGG - Intergenic
992374506 5:76175043-76175065 TGAGAGAGGCAGAAGGGGAAGGG + Intronic
992399609 5:76400583-76400605 TCTGAGATGCTGAGGTGAAGTGG + Intergenic
994394894 5:99219473-99219495 TCTAATATCCAGAAGGGGAAAGG - Intergenic
994395896 5:99225550-99225572 CCTGATATGCAGAGGGGGAAAGG - Intergenic
996023561 5:118618501-118618523 ACTGAGATCCAGAGAGGTAAGGG + Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996893585 5:128453716-128453738 GCTGAAATGCAGAGTGGGGAAGG + Intronic
997229157 5:132230203-132230225 TCTGGGGTGGGGAGGGGGAATGG - Intronic
997255504 5:132425028-132425050 TGTGAGAGGCAGAGGGGGTTAGG + Intronic
997661803 5:135594923-135594945 ACTGAGGTGCAGTGAGGGAAAGG + Intergenic
997683666 5:135773823-135773845 TCTAATATCCAGAGGGGGGAGGG + Intergenic
997777581 5:136624848-136624870 TGTGAGTTACACAGGGGGAAGGG + Intergenic
998669752 5:144340431-144340453 TCTGAGAGGCAGAGTTGGAGAGG + Intronic
999772385 5:154785381-154785403 TCTGAGATAGAGATGGGGATGGG - Intronic
999869595 5:155735482-155735504 ACTGAGGCTCAGAGGGGGAAAGG + Intergenic
1001163952 5:169346644-169346666 TCTAAGGGGCAGAGGGAGAAGGG - Intergenic
1001280046 5:170380304-170380326 TCAGTGATGCAGAGTGGGTAGGG - Intronic
1001489981 5:172148451-172148473 TCTCACATGCAGAGGAGCAAGGG - Intronic
1002043952 5:176531937-176531959 TCTGAGAGGCAGAGGCAGCAAGG - Intronic
1002062903 5:176636926-176636948 GCTGAGTTCCAGAGGGGCAAGGG - Intronic
1003093759 6:3126149-3126171 ACTGAAATGCAGAAGGGGTATGG - Intronic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1004193707 6:13486543-13486565 TCTGGGATGCGGAGAGGGAAAGG + Intronic
1004580560 6:16947028-16947050 TCTGAGATGGAGGGAGGGAGGGG + Intergenic
1004622909 6:17346999-17347021 TCTGAGAGGCACAAGAGGAAGGG - Intergenic
1007040357 6:38715747-38715769 TCGGAGACTCAGAAGGGGAAGGG + Intronic
1007662183 6:43493609-43493631 TCAGAGATGCAGAAGAGGAAAGG - Intronic
1007823540 6:44580052-44580074 TCTGAGAGGGAAAGGGGGACAGG + Intergenic
1008444160 6:51569186-51569208 TCAGAAATGCAGAGGTGGTATGG - Intergenic
1009046356 6:58241186-58241208 TCTAATATCCAGAGGGGGAGAGG + Intergenic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010662077 6:78583369-78583391 TCTGAGCTGAAGATGGGGATTGG + Intergenic
1011413371 6:87090016-87090038 TCTGAAATGCTGAGGATGAAAGG - Intronic
1012773789 6:103478570-103478592 TCTGATATCCAGAGTGGGAGAGG + Intergenic
1012775208 6:103488092-103488114 TCCGATATCCAGAGAGGGAAAGG + Intergenic
1013983244 6:116158904-116158926 TTTGAGACGCAGATGGGGATTGG + Intronic
1014372823 6:120633899-120633921 TCACAGAAGCAGAGAGGGAATGG + Intergenic
1014588585 6:123232513-123232535 TCTGAGAAGCAGAAAGGGCAAGG + Intronic
1016638941 6:146326435-146326457 TTTGAGGGGCAGAGGGTGAAAGG + Intronic
1017822419 6:158059308-158059330 TCTGGGAAGCAGAGGCGGAGAGG + Exonic
1018927437 6:168216131-168216153 TCTAAGATGCAGAGCATGAAAGG - Intergenic
1019081065 6:169430058-169430080 TCTGAGCTGCAGAAGGGCACAGG + Intergenic
1019607902 7:1919198-1919220 GCTGAGATGCAGAGAGAAAAGGG + Intronic
1019642104 7:2109049-2109071 TCTGAGCTGCAGAGCGGGTGCGG - Intronic
1019705292 7:2494547-2494569 GCTCACATCCAGAGGGGGAAGGG + Intergenic
1019706954 7:2501516-2501538 TCTCAGCTGCAGAGGGGGTATGG + Intergenic
1020181516 7:5926242-5926264 CCTGAGATGCAGTGGGCCAAGGG + Exonic
1020301417 7:6798647-6798669 CCTGAGATGCAGTGGGCCAAGGG - Exonic
1020351378 7:7223021-7223043 ACTGAAATGGAGAGGGGGATAGG - Intronic
1021402525 7:20225987-20226009 ACTGAGATGCATAGGTAGAAAGG - Intergenic
1022524519 7:31028628-31028650 ACTGAGGTGCAGGGGGTGAAGGG - Intergenic
1022681545 7:32551970-32551992 TCTAAAATGTAGAGGGAGAAAGG + Intronic
1022834852 7:34103595-34103617 TCCTTGAGGCAGAGGGGGAAGGG + Intronic
1023055168 7:36285044-36285066 TCTGAGCAGGAGAGGGGGGAAGG + Intronic
1023993128 7:45142041-45142063 TCTGAGACCCAGAGAGGGGACGG - Intergenic
1024189618 7:46992920-46992942 TCTAACATGTAAAGGGGGAATGG + Intergenic
1024783312 7:52876973-52876995 TATGAGATGCAAAGAGGCAAGGG - Intergenic
1024887065 7:54155542-54155564 TGTGAGTTGCAGATGTGGAAAGG + Intergenic
1025072822 7:55915915-55915937 TGTGAGAGGCAGAGGTTGAAAGG + Intronic
1026165741 7:67907701-67907723 GCGGAGATGCATAAGGGGAAAGG + Intergenic
1027138469 7:75640279-75640301 ACTGAGATCCAGAGAGGGAGAGG + Intronic
1027192282 7:76003696-76003718 TCTGGGAAGCAGAGGGGCAGTGG - Intronic
1027736588 7:81939962-81939984 CCTGAGATACAGAGGGCAAAAGG + Intergenic
1028624612 7:92863707-92863729 TCTCAGATGGAGATGAGGAAGGG - Intergenic
1029475308 7:100779792-100779814 TCAGGGAAGCAGAGAGGGAAAGG - Intronic
1029928469 7:104344418-104344440 TTGGAGATTCAGAAGGGGAAGGG - Intronic
1029971227 7:104791436-104791458 TCTGTGATGCAAAAGGAGAATGG - Intronic
1030224471 7:107133869-107133891 TCTGAGAGGCAAAGGTGAAAAGG - Intronic
1030278731 7:107747193-107747215 TCTGTGAAGCAGAGTGGGAAGGG + Intronic
1031430473 7:121662329-121662351 TCTGAAATGGAGAGGAGAAAAGG - Intergenic
1031571909 7:123369680-123369702 TGTGAGATAGAGAGAGGGAAGGG - Intergenic
1032704427 7:134409699-134409721 GCTGAGATGCAGTGGATGAACGG - Intergenic
1032863780 7:135905729-135905751 TTGGAGATGCAGATGGGGATTGG + Intergenic
1033418583 7:141185811-141185833 TGTGATATGGAAAGGGGGAAGGG - Intronic
1033621114 7:143062732-143062754 TCTGGCATCCAGAGGAGGAAGGG + Intergenic
1034517958 7:151595925-151595947 TCTGGGAGGCTGAGGTGGAAGGG + Intronic
1034528555 7:151681386-151681408 TCTGGACTACAGAGGGGGAAGGG + Intronic
1035279928 7:157771377-157771399 TCAGAGATGGAGACAGGGAATGG - Intronic
1036771655 8:11582681-11582703 TCTGTGATGGCGATGGGGAAGGG - Intergenic
1036963971 8:13276240-13276262 GGTGAGAGGCAGAGGGGGATTGG - Intronic
1038037386 8:23698044-23698066 TTTGAGAGGAGGAGGGGGAAAGG + Intergenic
1038973427 8:32663845-32663867 TTTGAGAAGCAGAGGAGGACAGG - Intronic
1039983680 8:42429835-42429857 CCTGAGATGAGGAGTGGGAAGGG - Intronic
1041015845 8:53592525-53592547 ACTGAGATGAAGAGGGAGAGAGG + Intergenic
1042067850 8:64898624-64898646 TCTGAGAGGTGGAGGGGAAATGG - Intergenic
1042374813 8:68038339-68038361 TCTGGGAAGCACAGAGGGAAAGG - Intronic
1042401505 8:68353953-68353975 CCTCAGATGCAGAAGGGGATTGG - Intronic
1042604601 8:70532943-70532965 GCTGAGATGCATAGGGTGAGTGG + Intergenic
1043053132 8:75406930-75406952 TCTGGGAAGAGGAGGGGGAATGG - Intergenic
1043633792 8:82367072-82367094 CCTAATATCCAGAGGGGGAAAGG + Intergenic
1044288659 8:90441163-90441185 TCTGAGATGTAGAAGGAAAAAGG - Intergenic
1044526249 8:93254909-93254931 TCTGAGATTTAGATTGGGAATGG - Intergenic
1045007783 8:97931253-97931275 TCTCAGAAGCAGAGGGGGCCCGG + Exonic
1045927060 8:107586484-107586506 TCTGATATCCAGAGAGGGAGAGG - Intergenic
1046368764 8:113272258-113272280 TGTGAGATTCGGAGGGGCAAAGG + Intronic
1048294024 8:133201035-133201057 GATGAGATGAAGAGGGGAAAGGG - Intronic
1048923718 8:139252438-139252460 GCTGAGAACCAGTGGGGGAAGGG + Intergenic
1049220527 8:141426834-141426856 TCTGAGAGGCAGAGGGTGCCAGG - Intronic
1049532320 8:143160563-143160585 TCAGCCAAGCAGAGGGGGAAGGG - Exonic
1050010823 9:1184411-1184433 TCTGAGGTGCAGAGAGAGAAGGG - Intergenic
1050160270 9:2711604-2711626 TCTGAAAGGCAGAGGGAGAGAGG - Intergenic
1051232246 9:14965848-14965870 TCTAATATACAGGGGGGGAAAGG - Intergenic
1052084066 9:24241998-24242020 GCTGAGATGCAAAGGAGCAAAGG - Intergenic
1054822024 9:69532165-69532187 TGTGTGTAGCAGAGGGGGAAGGG + Intronic
1058582076 9:106469222-106469244 TCGGAGGCTCAGAGGGGGAAAGG - Intergenic
1058814520 9:108670977-108670999 CCTGAGATGCAGGTGGGGAGGGG - Intergenic
1059682499 9:116599796-116599818 TCTGACATGGGGAGGTGGAAGGG - Intronic
1061253043 9:129437629-129437651 TCTGGGTGGCAGAGGGGGGAAGG + Intergenic
1061998758 9:134205145-134205167 TCAGAGAGGGAGAGGGAGAAGGG - Intergenic
1062137586 9:134937973-134937995 TTGGAGAGGCAGAGGGGGAAAGG - Intergenic
1062497688 9:136839346-136839368 GCTGAGATGGAGCCGGGGAAGGG + Exonic
1202796143 9_KI270719v1_random:121758-121780 TGTGAGTTGCAGAGGGAGACTGG + Intergenic
1203421066 Un_KI270448v1:6577-6599 TCTGTGATACAGAAGGGAAATGG - Intergenic
1203421637 Un_KI270521v1:6092-6114 TCTGTGATACAGAAGGGAAAAGG - Intergenic
1185546275 X:948085-948107 TTTTAGATGTAGAGAGGGAAAGG - Intergenic
1185695691 X:2192783-2192805 TCTGGGATGCAGAGGCGTAGAGG - Intergenic
1186649483 X:11542987-11543009 TTTAGGATGCAGAGTGGGAAGGG + Intronic
1189230255 X:39446511-39446533 ACTGAGATGGAGAGGATGAACGG - Intergenic
1190114326 X:47616300-47616322 TCTGAGATGCAGAAGGGGAAGGG + Intronic
1190459747 X:50660613-50660635 TCAGAGATGGAGAGGGGAAGAGG - Intronic
1192224237 X:69217415-69217437 TCTGAGATAAGGTGGGGGAATGG - Intergenic
1192235014 X:69290027-69290049 TCTGGGAGGCAGGGTGGGAAAGG + Intergenic
1193405491 X:81096014-81096036 TTGGAGATGCAGAAGGGGTAAGG + Intergenic
1193689350 X:84622034-84622056 TCTGTGATGCAGAGTAGGAGAGG + Intergenic
1194975596 X:100393456-100393478 TGGGAGAGGGAGAGGGGGAAAGG - Intronic
1196607446 X:117672227-117672249 TCTGAGAGACACACGGGGAAGGG - Intergenic
1197125972 X:122946681-122946703 TCTAAGAGGCAGCAGGGGAAAGG - Intergenic
1199110821 X:143931843-143931865 TTGGAGATTCAGAAGGGGAAGGG - Intergenic
1199143394 X:144336352-144336374 TCTGATATGGAAAGGGGGCAAGG - Intergenic
1200123454 X:153802198-153802220 CTTGAGATGCAGGGGGGGAAGGG + Exonic