ID: 1103719324

View in Genome Browser
Species Human (GRCh38)
Location 12:122965103-122965125
Sequence CAGGGTCCTCCCAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 316}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103719324_1103719331 4 Left 1103719324 12:122965103-122965125 CCCACTTCCCTGGGAGGACCCTG 0: 1
1: 0
2: 3
3: 36
4: 316
Right 1103719331 12:122965130-122965152 CATCAGCTTCGTTTTACAGCTGG 0: 1
1: 0
2: 2
3: 12
4: 154
1103719324_1103719333 6 Left 1103719324 12:122965103-122965125 CCCACTTCCCTGGGAGGACCCTG 0: 1
1: 0
2: 3
3: 36
4: 316
Right 1103719333 12:122965132-122965154 TCAGCTTCGTTTTACAGCTGGGG 0: 1
1: 0
2: 5
3: 74
4: 680
1103719324_1103719332 5 Left 1103719324 12:122965103-122965125 CCCACTTCCCTGGGAGGACCCTG 0: 1
1: 0
2: 3
3: 36
4: 316
Right 1103719332 12:122965131-122965153 ATCAGCTTCGTTTTACAGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 231
1103719324_1103719334 18 Left 1103719324 12:122965103-122965125 CCCACTTCCCTGGGAGGACCCTG 0: 1
1: 0
2: 3
3: 36
4: 316
Right 1103719334 12:122965144-122965166 TACAGCTGGGGAGACAGAAGAGG 0: 1
1: 0
2: 3
3: 59
4: 601

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103719324 Original CRISPR CAGGGTCCTCCCAGGGAAGT GGG (reversed) Intronic
900279501 1:1857191-1857213 CAAGGTTCTCACTGGGAAGTGGG + Intronic
900604196 1:3516563-3516585 CAGGCACCTCCCAGGGATGGTGG - Intronic
900950433 1:5855506-5855528 CAGGGTCCCCCCAGGAAGGAAGG + Intergenic
902049298 1:13549273-13549295 CAGTGTCCTCACAGGGTAGAGGG + Intergenic
902396246 1:16133763-16133785 CAGGGTGTTCCCAGGGCACTGGG - Intronic
904031701 1:27537140-27537162 CAGGGTTCTCTCATGGAGGTGGG + Intronic
905446438 1:38030956-38030978 CAGGACCCACCCAGGGAAGGAGG - Intergenic
905514999 1:38556146-38556168 CAGATTCCTCAGAGGGAAGTCGG + Intergenic
905748178 1:40437235-40437257 CAGGATTCTGCAAGGGAAGTTGG + Intergenic
907526218 1:55055710-55055732 CTGAGGCCTCCCAGGGAAGAAGG - Intronic
908319134 1:62963893-62963915 CAGGGTCCTGCCAGGGCAGTTGG - Intergenic
910141392 1:84030962-84030984 CAGGTCCCTCCCACGGCAGTTGG + Intergenic
911156999 1:94646722-94646744 CTGGGGCCTCCAAGGGAGGTAGG + Intergenic
913690311 1:121273538-121273560 AAGAGTCATCCCAGGGAAGCAGG + Intronic
914147231 1:145006421-145006443 AAGAGTCATCCCAGGGAAGCAGG - Intronic
915638761 1:157204897-157204919 CAAGGTCCTCCCAAGGAAGCTGG - Intergenic
916194930 1:162213693-162213715 CAGGCACATGCCAGGGAAGTTGG - Intronic
917980647 1:180266894-180266916 CAGCCTCCACCCAGGGAAGGAGG - Intronic
920477631 1:206292026-206292048 AAGAGTCATCCCAGGGAAGCAGG + Intronic
922746669 1:228048149-228048171 CAGGGTCCTCCCATGGGACAAGG - Intronic
923800550 1:237204987-237205009 CTGTGTCCTCTCAGGGCAGTGGG - Intronic
924292837 1:242555483-242555505 TAGGGTGATACCAGGGAAGTTGG + Intergenic
1062972421 10:1659490-1659512 CAGGCTCCTTCCAGGGAAGAGGG - Intronic
1063159694 10:3410178-3410200 CAGGGACCCACCAGGGAAGCTGG - Intergenic
1064213916 10:13383690-13383712 CAGGGTGCTCCGAGTGAAGAGGG - Intergenic
1065821052 10:29525938-29525960 CAGGGCCCTCCCGGAGAAGTGGG - Intronic
1065890862 10:30119874-30119896 CAGGGTCCAACCAGGAAAATGGG - Intergenic
1067415375 10:46098118-46098140 CAGCCACCTCCCAGGGAAGGAGG + Intergenic
1067435416 10:46273195-46273217 CAGCCACCTCCCAGGGAAGGAGG + Intergenic
1067582214 10:47452885-47452907 CAGCCACCTCCCAGGGAAGGAGG + Intergenic
1069927706 10:71862553-71862575 CAGGGACATCCTAGGCAAGTCGG - Intergenic
1070801475 10:79246792-79246814 CAGGGAGCTCCCTGGGAAGCTGG - Intronic
1072492244 10:95919730-95919752 CAGGTTCCTTCCAGTGAAGCAGG + Intronic
1072723879 10:97799701-97799723 CATGGAGCTGCCAGGGAAGTTGG + Intergenic
1074009130 10:109458673-109458695 CAGTGTCATCCCATGGAAGAAGG + Intergenic
1075004992 10:118823708-118823730 CTGTGTCCTCCCTGGGAATTTGG - Intergenic
1075382510 10:122030829-122030851 CAGGGCTCTCCCAGGGAATTGGG + Intronic
1076276109 10:129200111-129200133 CAGTGTTCTCCCAGGGAAGTGGG - Intergenic
1076605317 10:131685577-131685599 CAGGGTTCTGCCAAGGCAGTGGG - Intergenic
1076726035 10:132413762-132413784 CAGAGTCCCCCCAGGGAGTTGGG - Intronic
1076767864 10:132646449-132646471 CTGGGTCCTGCCTGGGAAGAGGG + Intronic
1076995272 11:294631-294653 AAAAGTCCTCCCAGGGAACTCGG - Exonic
1077164107 11:1127394-1127416 CAGCGTCCTCCCCGGGTGGTGGG - Intergenic
1077307084 11:1873264-1873286 CAGGGTCCTGGCAGGGAGGAAGG - Intronic
1077378417 11:2216251-2216273 CAGGGTCCTCTCTGTGAAGGGGG - Intergenic
1077483017 11:2825359-2825381 CAGTGTCCTTCCAGGGAAATGGG + Intronic
1078064776 11:8071277-8071299 CACTGCTCTCCCAGGGAAGTGGG + Intronic
1078102026 11:8335516-8335538 CAGTGTCCTCCCTGTGAAGATGG + Intergenic
1078409230 11:11098144-11098166 CAGGTTCCTCCCAGGACAGGTGG + Intergenic
1079282256 11:19098004-19098026 CAGGGTTCTCCCCATGAAGTTGG + Intergenic
1081621022 11:44619212-44619234 GAGGGTCTTCGCAGTGAAGTGGG - Exonic
1081671218 11:44943652-44943674 CAGGGCCCTCCCAGGGCACTGGG + Intronic
1084209745 11:67615460-67615482 GGGGGTCCTACCAGGGAGGTAGG - Intergenic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084502653 11:69544087-69544109 CAGGGTTCTCCCATGGAAATAGG - Intergenic
1084634841 11:70384911-70384933 CAGGGCCCACCCATGGAAGTTGG + Intergenic
1085049030 11:73370433-73370455 CAGGGTCCTCCGAGTGGAGGAGG - Intergenic
1085240873 11:75054012-75054034 CAGGGTCATCCCAGGAATGTAGG + Intergenic
1085942303 11:81219821-81219843 CAGACTCATCCCGGGGAAGTTGG + Intergenic
1088923837 11:114281052-114281074 CAGGGTCCCACTAGGGACGTAGG + Intronic
1089054580 11:115575223-115575245 CAGGGTGTTGCCATGGAAGTGGG + Intergenic
1089253072 11:117179063-117179085 CAGGGTCCCCGCAGGGGAGGGGG - Exonic
1089567883 11:119381635-119381657 AAGGGACCTCCCCGGGAAATCGG + Exonic
1090265528 11:125350902-125350924 CAGGGTCCTCCTGGGGAAGGAGG + Intronic
1090750541 11:129743175-129743197 CAGGCTCCTCCCAGGGCGATCGG + Intergenic
1091181229 11:133606288-133606310 AAGGGTCTTCCCAAGGAGGTGGG + Intergenic
1091372472 11:135072546-135072568 CAGGGACCTCCCAAGGACCTAGG - Intergenic
1096226500 12:49869755-49869777 CCTGGGGCTCCCAGGGAAGTGGG - Exonic
1098245053 12:68508360-68508382 CAGGTTCCTCCCAGATATGTGGG + Intergenic
1102756811 12:115348289-115348311 CACTGTCCTCCCCGAGAAGTAGG + Intergenic
1103719324 12:122965103-122965125 CAGGGTCCTCCCAGGGAAGTGGG - Intronic
1104897519 12:132171601-132171623 CAGGGCCCTCCCAGGGCCGATGG + Intergenic
1105474720 13:20720161-20720183 CAGCCTTCTCCCCGGGAAGTCGG + Intronic
1106592219 13:31107960-31107982 CAGGCCCCGCCCAGGTAAGTGGG + Intergenic
1106620467 13:31366683-31366705 AAGGGCAATCCCAGGGAAGTAGG + Intergenic
1106770932 13:32959958-32959980 CAGTGTCCTCCCAGGGCTGGGGG - Intergenic
1107017823 13:35721729-35721751 CAGGATTCTCCCAGAGAACTGGG + Intergenic
1107239794 13:38218740-38218762 CTGTGTCCTCACAGGGCAGTAGG + Intergenic
1107661631 13:42644779-42644801 CATGGTGCTCCCAGGGACTTAGG + Intergenic
1112405701 13:99118353-99118375 CAGGGTGATCTCAGGGTAGTTGG + Intergenic
1113284795 13:108835177-108835199 CAGGTCCCTCCCAGGGAATGCGG - Intronic
1113508428 13:110832395-110832417 GAGTGTCCTCCCAGGGCTGTGGG + Intergenic
1113782830 13:112986500-112986522 GTGGGTCCTCCGAGGGCAGTGGG - Intronic
1114269167 14:21090857-21090879 CAGGGTCCTCCCAGGGCTGGCGG + Exonic
1114486751 14:23067476-23067498 CAGAGTCCTCCCAGGGGCGCAGG + Intronic
1114617333 14:24075308-24075330 CAGGATTCTCCCAGGGATCTGGG - Intronic
1116490736 14:45499902-45499924 CTGGGACCTACCAGGGAAGATGG - Intergenic
1116979121 14:51149370-51149392 GAGGGTACTCCCAGGAAAGAAGG + Intergenic
1117483596 14:56172340-56172362 CATGGTGGTCCCAGGGTAGTCGG + Intronic
1118016795 14:61668928-61668950 CAGAGTCTTCCCAGAGAAGGTGG + Intergenic
1118482653 14:66182444-66182466 CACAGTCCTCCCCTGGAAGTGGG + Intergenic
1118490972 14:66259457-66259479 CAGTTTCCTCCCAGGGAAAATGG + Intergenic
1118586610 14:67359550-67359572 CAGGATCCTCCCAGGAAACAAGG + Intronic
1119088063 14:71754766-71754788 CAGGCTCATCCCAGAGAAATGGG + Intergenic
1119480303 14:74954483-74954505 CTGGGGACTCCCAGGGCAGTGGG + Intronic
1119556489 14:75557402-75557424 CAGGGTCATCCCATGGCAGAAGG + Intergenic
1119629053 14:76210045-76210067 CAGGGACCTCTTAGGGAAGAGGG + Exonic
1120487032 14:85126999-85127021 CAGGGTGCTAGCAGGGAAGGTGG - Intergenic
1120733456 14:88027891-88027913 CAGGGTGGCCCCAGGGAAGGAGG + Intergenic
1121739248 14:96240028-96240050 CGGGGCCCTCCCAAGGGAGTTGG - Intronic
1122792570 14:104190543-104190565 GAGGGTCCCCCCAGGGCAGATGG + Intergenic
1202903022 14_GL000194v1_random:54029-54051 GAGGGTCCTCCCAGGGAGCGCGG + Intergenic
1124137524 15:27048175-27048197 CAGCCTGCTCCCAGGGCAGTGGG - Intronic
1124355158 15:28989853-28989875 CAGGGTCCATCCTGGGACGTGGG + Intronic
1124625740 15:31306621-31306643 CAGGGCCCTCCCGGGAAAGGCGG - Intergenic
1125542278 15:40476442-40476464 CAGTGTCCACCCAGGGGGGTGGG - Intergenic
1125826312 15:42679494-42679516 CAGTCTCTTCCCAGGGAAGAAGG - Intronic
1127598135 15:60507765-60507787 AAGAGTCTTCGCAGGGAAGTAGG + Intronic
1128065004 15:64759112-64759134 GAGGGGCCTCCCGGGGAGGTGGG - Intronic
1128333564 15:66771770-66771792 CCGGCTAGTCCCAGGGAAGTGGG - Intronic
1128791097 15:70434453-70434475 CATTGTCCACCCAGGGAAGCAGG - Intergenic
1129509377 15:76109368-76109390 CAGGTTCCTCCCAAGGCTGTAGG + Intronic
1129674631 15:77625834-77625856 CAAATTCCTCCCTGGGAAGTGGG + Intronic
1130223989 15:82044542-82044564 CAGGCTCCTCCCCGCGAACTGGG + Exonic
1132558672 16:583783-583805 CATGGGCCTCCCAGGGAAGGAGG + Exonic
1132623552 16:879479-879501 CAGGGTCCTCCCAGAGAGCGGGG + Intronic
1132723921 16:1330656-1330678 TTGGGTCCTCAGAGGGAAGTTGG + Intergenic
1132908927 16:2298630-2298652 CAGGGTCCTCAGAGGAAATTAGG - Intronic
1133223379 16:4328633-4328655 CTGGGTCCTGCCAGGGAGGCAGG - Intronic
1134019385 16:10910915-10910937 CAGGATAGTCCCAGGCAAGTAGG - Intronic
1134254498 16:12600444-12600466 CAGGGACAGGCCAGGGAAGTGGG - Intergenic
1136393418 16:29979334-29979356 GAGAGACCTCCCAGGGATGTTGG + Intronic
1136501175 16:30670263-30670285 CAGGCTTCTCCCTGGGAAGGTGG + Exonic
1137317712 16:47345041-47345063 CAAGGAACTCCCAGGAAAGTGGG + Intronic
1137725440 16:50653647-50653669 CAGGGTCCACCCAGCTAAGGAGG + Intergenic
1138513998 16:57525986-57526008 CTGTGTCCTCCCAGGGTAGCCGG + Exonic
1138542337 16:57695978-57696000 CTGGCTTCACCCAGGGAAGTGGG + Intronic
1139372907 16:66479693-66479715 CGGGTTCCTCTCAGAGAAGTGGG + Intronic
1141687219 16:85577307-85577329 CGCGGTCCTCTCAGGGAAGTGGG + Intergenic
1142221279 16:88856446-88856468 CAGCGTCCTCCCTGGCAGGTGGG - Intronic
1142225534 16:88875465-88875487 CAGGGTCTTCCCTGGGGAGGAGG + Exonic
1142314174 16:89333035-89333057 CAGGGAACCCCCAGGGAAGAAGG + Intronic
1142887546 17:2922192-2922214 CAGTGTCCTCACAGGGAGGAAGG + Intronic
1143101902 17:4509120-4509142 CAGGGTCCGCTCAGGGAATGGGG + Intronic
1143135670 17:4710974-4710996 CGGGGTTCTCGCAGGGATGTGGG + Intronic
1143563102 17:7706603-7706625 CACAGTCTCCCCAGGGAAGTAGG - Intronic
1143705829 17:8697165-8697187 CAGGGACCTGCCAGGGAGGAAGG + Intergenic
1145959623 17:28879855-28879877 CAGGGGCCTCCTAAGGCAGTAGG + Exonic
1147918434 17:43901957-43901979 CAGGGATCTCCCAGGGGAGGAGG + Intronic
1148239995 17:45993989-45994011 GAGGCTGCTCCCAGCGAAGTAGG - Intronic
1149446252 17:56715594-56715616 CAGGGTCCTGTGAGGGATGTGGG - Intergenic
1151715023 17:75826947-75826969 CAGGGGCCTCCCAGGGGTGCAGG - Intergenic
1152759191 17:82099230-82099252 CAGCCTCCGCCCTGGGAAGTGGG - Intergenic
1153158933 18:2180879-2180901 CAGGCTGCTCCTGGGGAAGTGGG + Intergenic
1157272647 18:46288403-46288425 CAGAGTCCCTCCAGGGAATTTGG + Intergenic
1158149787 18:54355530-54355552 CAGTGTCCTCACATGGAAGAAGG - Intronic
1158198948 18:54918846-54918868 CAGGCTGCTCCCAGAGAAGAAGG + Intronic
1160659375 19:291165-291187 CAGGGTCCTCGGAGGGACGAGGG + Exonic
1160773366 19:843697-843719 CTGGGTCCTCCCCGGGCAGAGGG - Intronic
1160894377 19:1395795-1395817 CAGGGCCCTCCCAGGAAGGATGG - Intergenic
1161089092 19:2351361-2351383 CACGTTCTTCCCAGGGAAATGGG + Intronic
1161134919 19:2614014-2614036 CAGAATCCACCCAGGGAACTCGG + Intronic
1161200096 19:3009757-3009779 CAGGGAGCTCCCAAGGCAGTGGG - Intronic
1161395771 19:4044155-4044177 CAGGGTCTTCCCCTGGAAGTGGG - Intergenic
1161514322 19:4688433-4688455 CTGGGAGCTCCCAGGGTAGTGGG - Intronic
1161589393 19:5122293-5122315 CAGGGTCCTCACCGGGTAGAAGG - Intronic
1162621323 19:11846783-11846805 CAGGGTTTCCCCAGGGAATTTGG + Intergenic
1162936469 19:13983996-13984018 CAGGGTCACCCCAGAGAAGGTGG - Intronic
1165389455 19:35529946-35529968 CCGGGTCCTCTGAGGGGAGTGGG - Intergenic
1165475289 19:36026796-36026818 CAGGGTCCTCCCCGTGCACTGGG - Intronic
1167040110 19:47019080-47019102 CAGGGTCCTCCCTGGCATGGGGG - Intergenic
1167422540 19:49412696-49412718 CTGGGTCCTGTCAGGGAAGGGGG + Intronic
1168069767 19:53942915-53942937 ATGGGACCTTCCAGGGAAGTAGG - Exonic
1168138738 19:54370188-54370210 AAGGGTCCTCCCAGGCAGGAAGG - Intronic
1168159290 19:54498309-54498331 AAGGGTCCTCCCAGGCAGGAAGG + Intronic
925154486 2:1639170-1639192 CAGGGACGTCCCAGGGCACTGGG - Intronic
927336763 2:21933525-21933547 CAGGGTCACCACAGGTAAGTAGG + Intergenic
927347865 2:22069015-22069037 CAGTGTCCTTGCAGGGCAGTGGG - Intergenic
928200228 2:29243195-29243217 CAAGGTCCTCCCTGGGAGGGAGG - Intronic
930740325 2:54825823-54825845 CATGGTCCTCTCAGAGTAGTTGG - Intronic
931880078 2:66559303-66559325 CATGAGCCTCCCAGGAAAGTGGG - Intronic
932689502 2:73900262-73900284 CTGGGTCCTCCCAGGGTAGGAGG + Intronic
934503641 2:94876364-94876386 GAGGGTCCTCCCAGGGAGCGTGG - Intronic
934609804 2:95726704-95726726 CAGGGTCCTCACATGGCAGGGGG + Intergenic
934967053 2:98731685-98731707 CGGGGTTCTCACCGGGAAGTTGG - Intergenic
935114888 2:100127060-100127082 CAGGGACCTCCCAGAGAGGATGG - Intronic
936543126 2:113368274-113368296 CAGGGTCCTCACATGGCAGAAGG + Intergenic
936835428 2:116703810-116703832 CAGGGTCCTGTGATGGAAGTTGG - Intergenic
937192487 2:120117235-120117257 CAGGTTTCTCGCAGGGAAGAAGG - Intronic
937968548 2:127533000-127533022 CAGGGTCCATCCAGGGAGGATGG + Intergenic
939140947 2:138354007-138354029 TAGCTTCCTCCCAGGGAAATAGG - Intergenic
941920228 2:170842698-170842720 CAGGGGCCTCCCAAGGAAAATGG + Intronic
942814945 2:180042032-180042054 CTGGGTCCTCACATGGAAGAAGG - Intergenic
942884439 2:180906015-180906037 CAGGGTCATCCCCAGGAAGTTGG - Intergenic
943447060 2:187999847-187999869 CGGTGTCATCCCAGGGATGTGGG + Intergenic
944213109 2:197226936-197226958 CTGGGAGCTCCCAGGGAATTGGG - Intronic
946016249 2:216606554-216606576 CAAGGTCCAGCCAGGGAAGCAGG - Intergenic
946155920 2:217806533-217806555 CAGGGCCCTGCGAGGGAAGAAGG - Intronic
947750214 2:232528180-232528202 CAGTCTTCTCTCAGGGAAGTGGG + Intronic
947984401 2:234436608-234436630 CAGGTTCCTCCCAGGCAGGCGGG + Intergenic
948439868 2:237979729-237979751 CAGGGTCCTCCCTGCCCAGTGGG - Intronic
948480571 2:238247695-238247717 CAGGGGCCTGCCAGGGCAGTCGG + Intronic
948943828 2:241209571-241209593 GCGGCTCCTCTCAGGGAAGTAGG - Exonic
1169566223 20:6856389-6856411 CAAGGTCCTCAGAGGGAAGGTGG - Intergenic
1170962433 20:21037372-21037394 CAGGGTTCTGCCAGGCAAGTGGG - Intergenic
1172639236 20:36431145-36431167 CAGGGTCCTCCCGTGGGAGGTGG + Intronic
1173575938 20:44113046-44113068 CTGAGGCCTCCCAGGGAAGCTGG - Exonic
1174424605 20:50423244-50423266 CAGGCCCCTCCCAGGGATTTGGG - Intergenic
1174565723 20:51463206-51463228 CTGGGTCTTCCCTGGGAAGTGGG + Intronic
1174685039 20:52446512-52446534 CAGAGTCCTGGCAGTGAAGTTGG + Intergenic
1175315729 20:58045313-58045335 CAGCCTCCTCCCAGGGCAGCAGG + Intergenic
1176047486 20:63100426-63100448 GAGGGTCCGCCCAGGGCAGGCGG + Intergenic
1176196057 20:63836720-63836742 GAGGGTCCTCCCAGCCATGTTGG + Intergenic
1176622385 21:9068796-9068818 GAGGGTCCTCCCAGGGAGCGCGG + Intergenic
1178821528 21:35979504-35979526 CTGGGTCCTCACAGGGCAGAAGG - Intronic
1178891212 21:36522553-36522575 CAGGGTCCTCCAAACGCAGTGGG - Intronic
1178958639 21:37044492-37044514 CAGGGCCCTCACAGGGAATCTGG + Intergenic
1179890198 21:44331386-44331408 CCGGCGCCTCCCAGGGCAGTTGG - Intronic
1179979856 21:44890248-44890270 CAGGCTCCCCCCAGTGATGTGGG + Intronic
1180212210 21:46301840-46301862 CAGGCTCCTCCTGGGGAAGCTGG - Exonic
1180825433 22:18857919-18857941 CAGGGCCCTCCCAGGGATGCTGG + Intronic
1180877729 22:19182620-19182642 GAGGGGCCTCCCAGGTGAGTGGG - Intronic
1180958647 22:19752261-19752283 CAGGGTCTGCCCAGAGCAGTGGG + Intergenic
1181168127 22:20994124-20994146 CGGGGGCCTCCCTGGGAACTGGG - Exonic
1181187298 22:21116628-21116650 CAGGGCCCTCCCAGGGATGCTGG - Intergenic
1181211900 22:21293865-21293887 CAGGGCCCTCCCAGGGATGCTGG + Intergenic
1181397598 22:22633021-22633043 CAGGGCCCTCCCAGGGATGCTGG - Intergenic
1181437893 22:22921011-22921033 CAGGACCCTCCCAGGGAACTCGG + Intergenic
1181500346 22:23312391-23312413 CAGGGCCCTCCCAGGGATGCTGG - Intronic
1181651808 22:24263037-24263059 CAGGGCCCTCCCAGGGATGCTGG + Intergenic
1181675056 22:24445885-24445907 CAGGGTCCTCTGAGGGAGGTGGG + Intergenic
1181705568 22:24647702-24647724 CAGGGCCCTCCCAGGGATGCTGG - Intergenic
1182057674 22:27372650-27372672 CAGGGTCCTCAGAGTGAAGGTGG + Intergenic
1182293297 22:29298560-29298582 CACGCTCCTCACAGGGAAGGGGG + Intronic
1182763115 22:32738870-32738892 CTGGGACCTCCCAGGTGAGTGGG + Intronic
1183390852 22:37545160-37545182 TGGGGTCTTCCCAGGGCAGTAGG + Intergenic
1183808090 22:40229395-40229417 CAGGGTTCTGCCAGGGAAATGGG + Intronic
1184168222 22:42743240-42743262 CAGGGTCCTCCCAGGACCCTAGG - Intergenic
1184225454 22:43126988-43127010 GGGGGAACTCCCAGGGAAGTGGG - Intronic
1184604578 22:45564941-45564963 CAGGGTTCTTCCATGGAAGCAGG + Intronic
1184666124 22:45990018-45990040 CAGGGGCCGCCTAGGGAGGTTGG + Intergenic
1184706385 22:46216512-46216534 CATGCTCCTGCCAGGGAAATTGG + Intronic
1184913362 22:47550630-47550652 CAGGGCCCTGCCAGTGATGTGGG + Intergenic
1203275580 22_KI270734v1_random:83822-83844 CAGGGCCCTCCCAGGGATGCTGG + Intergenic
949480138 3:4485891-4485913 TAGGGTCAGCCCAGGGAAGTGGG - Intergenic
949877480 3:8635642-8635664 CAGGGCCCCCCCAGGGAAAGGGG + Intronic
950107420 3:10397033-10397055 TATTGTCCTCCCAGGGAAATGGG + Intronic
950331070 3:12156726-12156748 CAGGGTCTTCCTTGGGCAGTAGG - Intronic
950447328 3:13045797-13045819 CAGGGTGGCCCCAGGGAAGGAGG - Intronic
952155000 3:30633562-30633584 CAGGGGCCTGGCAGGGGAGTAGG + Intronic
953702522 3:45207829-45207851 CAGGCTATACCCAGGGAAGTGGG - Intergenic
953904313 3:46860881-46860903 GAGGGTCCTGCCAGGGGTGTGGG - Intronic
954435556 3:50493997-50494019 CAGGGGCTAGCCAGGGAAGTGGG + Intronic
954596180 3:51826938-51826960 GAGAGTCCTCACAGGGAAGAAGG + Exonic
954735803 3:52705808-52705830 CGGGGTCCTCGCAGGGAAAAAGG + Exonic
955331321 3:58049913-58049935 CGGGGTCCTCCCACAGTAGTGGG - Intronic
956019666 3:64920775-64920797 CAGGGTACTCACAGGCATGTGGG + Intergenic
956362061 3:68459122-68459144 CAGGGTGCTCCCTGGGAGGGGGG + Intronic
959568006 3:107852501-107852523 CTGTGTCCTCCCATGGAAGAAGG - Intergenic
960171913 3:114472362-114472384 CTGGGTCCTCCCTGGGAAAAAGG + Intronic
960643151 3:119848217-119848239 CAGGGTTATCCCAGGTAACTGGG - Intronic
961100362 3:124193333-124193355 CAGGGTCATACCATGGAAGCTGG - Intronic
962660084 3:137593223-137593245 CAGCGTTCTCCCTGAGAAGTAGG + Intergenic
963972310 3:151443562-151443584 CAGAATCATCCCAGGGAAGTAGG - Exonic
966228847 3:177628409-177628431 CAGGTTCCTCCCAGGGCACATGG + Intergenic
968309702 3:197673334-197673356 AAGGAGTCTCCCAGGGAAGTGGG - Intronic
968448041 4:662324-662346 GGGGGTCCTCCCAGGGCAGAAGG + Intronic
968506050 4:971997-972019 CAGGGTCCACCGAGAGAAGGGGG + Intronic
968978798 4:3835662-3835684 CACGGTCCCACCAGGAAAGTCGG - Intergenic
969284556 4:6194817-6194839 CCAGGTCCTCCCAGGCCAGTTGG + Intronic
969432015 4:7160942-7160964 CAGGGGGCTCCCAGGCTAGTGGG + Intergenic
969531840 4:7734658-7734680 CAGTGTCCTCCCTGTGAGGTGGG - Intronic
969584669 4:8084857-8084879 CAGGGTCCACCCAGGGTATCTGG + Intronic
969636788 4:8374032-8374054 CTGGGACCACCCAGGGGAGTTGG + Intronic
969793625 4:9509146-9509168 CTGGGACATCCCACGGAAGTCGG + Intergenic
971370814 4:26017362-26017384 GAGGGGCCTCCCAAGGAAGAGGG - Intergenic
973763993 4:54147351-54147373 CAGGGTTCTCCGAGTGAAGCTGG + Intronic
974450335 4:62048079-62048101 CAGTCTCCTCCCAGGGCTGTTGG + Intronic
975053382 4:69894920-69894942 CAGCTTCCTCCCTGGAAAGTGGG - Intergenic
975523928 4:75328811-75328833 CTGGGTCCTCACAGGGTAGCAGG - Intergenic
978331448 4:107617367-107617389 CTGGTTCCTCACTGGGAAGTTGG - Intronic
979456238 4:120928604-120928626 GAGGGTCCTCCCATGGTAGAAGG - Intergenic
979855811 4:125632626-125632648 CAGGGCCATCCCAGGCAGGTGGG - Intergenic
981591944 4:146374028-146374050 CAGGTTCCTCCTAGGAAAATGGG + Intronic
981833967 4:149033275-149033297 AAAGTTCCTCCCAGGCAAGTAGG - Intergenic
986264887 5:6182799-6182821 CAAGGTCCTCCCAGGGCAGTGGG - Intergenic
991032942 5:62101427-62101449 CAGGGTCCTGAGAGAGAAGTGGG + Intergenic
992030489 5:72716509-72716531 TAGGGCCCTCCCAGAGCAGTTGG - Intergenic
994153236 5:96473910-96473932 CAGTGTCCTCCCAGTGCAGAGGG + Intergenic
997345592 5:133189723-133189745 CAGTGGCCTCACAGGGAAATGGG - Intergenic
998176321 5:139904257-139904279 CAGGTTTCTCCCAGGGAAACCGG + Intronic
1001641895 5:173250219-173250241 CTGGCTACTCCCAGGGAAGAAGG + Intergenic
1002432406 5:179211158-179211180 CAGGGAGCTCCCAGGGGAGGAGG - Intronic
1002459903 5:179368156-179368178 CCAGGTCCTCCCAGGGAGGAGGG + Intergenic
1003778777 6:9399031-9399053 CAGCGTCCTCGGAGGGAAGGAGG - Intergenic
1005562366 6:27053921-27053943 CAGGGAATTCCCAGGGAAGCAGG - Intergenic
1006153675 6:32002552-32002574 CAGGTTCCTCCCAGCGGAGGTGG - Exonic
1006159983 6:32035289-32035311 CAGGTTCCTCCCAGCGGAGGTGG - Exonic
1006512680 6:34530148-34530170 CAGAGTCCACTCAGGGAAGCAGG - Intronic
1006908726 6:37550130-37550152 CTGGCTCCTGCCAGGGGAGTCGG + Intergenic
1007095056 6:39207889-39207911 CAGCTTCCTCCCAGGGAGGTAGG - Intronic
1007432271 6:41783566-41783588 CAGGGTCCTCCCCCGGCAGGTGG - Exonic
1010863055 6:80937519-80937541 CTGTGTCACCCCAGGGAAGTGGG + Intergenic
1013470034 6:110455841-110455863 CAGTGTCCTCACATGGAAGAAGG - Intronic
1015405562 6:132833639-132833661 CAGGGTCCTACCAGTCCAGTAGG - Intergenic
1018564151 6:165133794-165133816 CTGTGTCCTCCCAGTGGAGTGGG - Intergenic
1018619525 6:165716365-165716387 CCTGGGCCTCCCAAGGAAGTGGG + Intronic
1019371432 7:663985-664007 CAGGGTCCCCCCCGACAAGTGGG + Intronic
1019409817 7:901574-901596 CAGGCTCCTCCCATAGCAGTGGG + Intronic
1019567105 7:1689692-1689714 CTGGGCCATGCCAGGGAAGTTGG - Intronic
1019625522 7:2013956-2013978 CAGGGTTCTCCCAGGAGAGGTGG - Intronic
1020804532 7:12772374-12772396 CAGGTTACTCTGAGGGAAGTGGG + Intergenic
1021484219 7:21149112-21149134 CAGAGTCCTCTCATGGAATTTGG + Intergenic
1022327644 7:29346452-29346474 TAGGCTTCTTCCAGGGAAGTTGG - Intronic
1023989767 7:45121775-45121797 CAGGGCCCAACCAGTGAAGTGGG - Intergenic
1025036213 7:55593971-55593993 CAGATTCCTCCCAGGGAACTCGG - Intergenic
1026483879 7:70801146-70801168 CTGTGTCCTCCCAGGACAGTAGG - Intergenic
1026973076 7:74479592-74479614 CGGGACCCTCCCAGGGGAGTTGG - Intronic
1029613803 7:101643863-101643885 CAGGATCCTCCCAGAGAGGGCGG - Intergenic
1030306752 7:108026696-108026718 CAGGGTCCTTCCACAGAACTTGG - Intronic
1031619020 7:123913619-123913641 CAGGGTCCTCCCAGATAATCAGG - Intergenic
1032279008 7:130486282-130486304 CCGGGTCCTCCCTGGGAACAGGG + Intronic
1032501848 7:132405547-132405569 CTCGGTCCTCCCAGGGGAGGAGG + Intronic
1036136538 8:6166767-6166789 CAGGGGCTTGTCAGGGAAGTGGG + Intergenic
1037316001 8:17600071-17600093 GAGACTCCTCCCAGGGAACTGGG - Intronic
1037849411 8:22314416-22314438 CAGTGCCCTCCCAGGTGAGTGGG + Exonic
1038247360 8:25871175-25871197 CAGAGAACGCCCAGGGAAGTAGG - Intronic
1039800779 8:40952638-40952660 GAGGGTCCTTCTAGGGGAGTGGG + Intergenic
1040104922 8:43536128-43536150 CAGGGTGTTCCCAGGCAAGGTGG + Intergenic
1040562666 8:48538256-48538278 CAGGGTCTGCCCAGGCATGTGGG + Intergenic
1044170880 8:89050179-89050201 TATGGAGCTCCCAGGGAAGTGGG - Intergenic
1044663476 8:94613451-94613473 AGGGATCCTCCCAGGAAAGTTGG + Intergenic
1049385070 8:142339018-142339040 AAGGGTCCTCCCAGGGTGGGAGG - Intronic
1049459942 8:142721884-142721906 CAGGGCCTTCCCAGAGAGGTAGG - Intergenic
1049782745 8:144436263-144436285 CAGGGTCTCCCCAGGGCAGGCGG - Exonic
1050267722 9:3908165-3908187 CAGGTTGCTGTCAGGGAAGTTGG - Intronic
1051326946 9:15982354-15982376 CAGATTCCTCTCAGGGAAGAGGG + Intronic
1052766380 9:32645312-32645334 CACGGTCCTACAAGGGAATTAGG - Intergenic
1056083983 9:83126640-83126662 GAGAGTCCTCCCAGGGAAAGTGG - Intergenic
1056534624 9:87516855-87516877 CAGGGTGCTGGCAGGGAACTGGG + Intronic
1056666962 9:88588805-88588827 CAAGGCCCTGCCAGGGAGGTTGG + Intergenic
1057192194 9:93094480-93094502 CAGGGCCGTCCCAGGGCAGGAGG - Intergenic
1057243068 9:93429637-93429659 CAGATTCCTCCCAGGAAAGGTGG - Intergenic
1057937968 9:99256704-99256726 CAGGAGCCTCCCAGAGAAGCAGG - Intergenic
1061677964 9:132229082-132229104 CCGGGGACTCCCAGGGAAGCAGG - Intronic
1061754742 9:132804549-132804571 CAGGCTCTTCCCAGGGAGGGGGG + Intronic
1062461010 9:136662600-136662622 CAGGGCCCTCCCAGGACCGTGGG - Intronic
1062516103 9:136937268-136937290 CCGTGGCCTCCCAGGGAACTAGG + Intronic
1203745583 Un_GL000218v1:39225-39247 GAGGGTCCTCCCAGGGAGCGCGG + Intergenic
1203564525 Un_KI270744v1:80258-80280 GAGGGTCCTCCCAGGGAGCACGG - Intergenic
1185518074 X:715657-715679 CTGGGTCCTCCCAGGGAGGAGGG - Intergenic
1185877525 X:3712982-3713004 CAGGGCCCTCCCCAGGAGGTCGG + Intronic
1186410236 X:9340392-9340414 AGGGCTGCTCCCAGGGAAGTGGG - Intergenic
1186485827 X:9933656-9933678 CAGCCTCCTCCCTGGGAAGCTGG - Intronic
1187334588 X:18371119-18371141 CAGGGTCATCCCATGGCAGAAGG - Intergenic
1189583512 X:42432836-42432858 CAGAATCCTACCAGGGAAGGAGG - Intergenic
1190164403 X:48060612-48060634 CAGGGGCCTCCCAGCAAAGTTGG + Intronic
1192161725 X:68793376-68793398 CAGGAGTTTCCCAGGGAAGTGGG + Intergenic
1195990362 X:110676460-110676482 CATGGACCTACCAGGGAATTTGG + Intronic
1196281991 X:113832861-113832883 CTGTGTCCTCCCAGGGCAGAAGG + Intergenic
1197708188 X:129648683-129648705 CAGGGCCCTGGCAGGGAGGTCGG - Exonic
1200787783 Y:7274562-7274584 CAGGGCCCTCCCCAGGAAGCGGG - Intergenic
1201158907 Y:11154237-11154259 TAGGGTCCTCCCAGGGAGCGCGG + Intergenic
1201592209 Y:15627860-15627882 CAGGTTCCTCCCAGGGCATGTGG - Intergenic
1202368005 Y:24179879-24179901 CAGGGTCCTCTGAGGGAACCTGG + Intergenic
1202502778 Y:25490238-25490260 CAGGGTCCTCTGAGGGAACCTGG - Intergenic