ID: 1103719427

View in Genome Browser
Species Human (GRCh38)
Location 12:122965529-122965551
Sequence CTCAAGTCCCAGAGTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 279}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103719427_1103719429 -10 Left 1103719427 12:122965529-122965551 CCAGCCTCACTCTGGGACTTGAG 0: 1
1: 0
2: 2
3: 26
4: 279
Right 1103719429 12:122965542-122965564 GGGACTTGAGAAGCTGTCTCAGG 0: 1
1: 0
2: 1
3: 16
4: 211
1103719427_1103719433 26 Left 1103719427 12:122965529-122965551 CCAGCCTCACTCTGGGACTTGAG 0: 1
1: 0
2: 2
3: 26
4: 279
Right 1103719433 12:122965578-122965600 AGGAGAGGCAGAGAGGCGCGAGG 0: 1
1: 0
2: 2
3: 69
4: 773
1103719427_1103719430 6 Left 1103719427 12:122965529-122965551 CCAGCCTCACTCTGGGACTTGAG 0: 1
1: 0
2: 2
3: 26
4: 279
Right 1103719430 12:122965558-122965580 TCTCAGGTGCTCTCAGCTCTAGG 0: 1
1: 0
2: 0
3: 28
4: 261
1103719427_1103719432 19 Left 1103719427 12:122965529-122965551 CCAGCCTCACTCTGGGACTTGAG 0: 1
1: 0
2: 2
3: 26
4: 279
Right 1103719432 12:122965571-122965593 CAGCTCTAGGAGAGGCAGAGAGG 0: 1
1: 0
2: 4
3: 60
4: 667
1103719427_1103719431 11 Left 1103719427 12:122965529-122965551 CCAGCCTCACTCTGGGACTTGAG 0: 1
1: 0
2: 2
3: 26
4: 279
Right 1103719431 12:122965563-122965585 GGTGCTCTCAGCTCTAGGAGAGG 0: 1
1: 0
2: 1
3: 11
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103719427 Original CRISPR CTCAAGTCCCAGAGTGAGGC TGG (reversed) Intronic
900731253 1:4262292-4262314 CTCAAGTCCCAGAAAGAGGCAGG + Intergenic
901096828 1:6688220-6688242 CTCAGGCTCCAGAGTGAGTCAGG - Intronic
901492700 1:9604654-9604676 CTCAAGTCTGAGGGTGAGGATGG - Intronic
901968951 1:12892303-12892325 CTGAAGTTCTAGAGTGATGCAGG - Intronic
902016223 1:13309478-13309500 CTGAAGTTCTAGAGTGATGCAGG + Intronic
903177162 1:21588013-21588035 CTGAAGTGCCAGAGTCAGACAGG - Intergenic
903570214 1:24298584-24298606 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
904564972 1:31423532-31423554 TTCAGGTCCGAGAGGGAGGCTGG - Intronic
905889757 1:41511638-41511660 CTCATGTCCAAGAGTGAAGCTGG - Intronic
906534341 1:46543497-46543519 CCCAAGGCCCAAAGTGAGGAGGG - Intergenic
906651041 1:47513096-47513118 CTAAGGTCCCAGAGTGGGTCAGG + Intergenic
909955645 1:81775717-81775739 CTCAAGTCCCAGAGTGCTCCTGG - Intronic
912308982 1:108599882-108599904 CTCAAGAGGCTGAGTGAGGCAGG + Intronic
914456665 1:147842905-147842927 CTGAAGTTCTAGAGTGATGCAGG + Intergenic
915098892 1:153484495-153484517 CCTAATTCCCAGAGTGAGGAGGG - Intergenic
915951601 1:160193095-160193117 CTCAAATCCCAGAAAGAGGTGGG + Intronic
916358138 1:163936251-163936273 CTCAATGGTCAGAGTGAGGCAGG - Intergenic
916792551 1:168136821-168136843 CTCCAGTCCCGGAGCGCGGCGGG - Intronic
917197407 1:172480931-172480953 CTCACCTCACAGAGTGAGACAGG + Intergenic
917646477 1:177033698-177033720 CCCAAGTCCTGGAGTCAGGCTGG + Intronic
919651550 1:200154478-200154500 CTCAAGTACCAGAGAGATGGTGG + Intronic
1064543126 10:16425244-16425266 CTGAAGTCTCAGAGAGAAGCAGG - Intergenic
1069738478 10:70672741-70672763 CCCAAGTCCCAGGCTGAGGGCGG - Intergenic
1070162977 10:73876716-73876738 CCCAAGTCCCAGTGTGGGGTAGG + Intergenic
1070242735 10:74699206-74699228 CTCAGGCCCCAGAGTGTGGTTGG - Intronic
1072740140 10:97904276-97904298 CTCAGGGCCCAGAGTGGGGGTGG - Intronic
1073293177 10:102423370-102423392 CTCAGATCCCAGAGGGATGCAGG - Exonic
1073319834 10:102608489-102608511 CTCAACTCTCAGCCTGAGGCTGG - Intronic
1073323359 10:102628778-102628800 CTCCAGCCCCAGACCGAGGCAGG + Intronic
1074064786 10:110004409-110004431 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1074274042 10:111984035-111984057 ATCATGTCCCAAAGTGAGGCAGG + Intergenic
1074979442 10:118608097-118608119 CTCAGATCCCACAGTGAGCCAGG + Intergenic
1075002363 10:118808256-118808278 GTCAAGTCCAAGGGTGAGGTGGG - Intergenic
1075258059 10:120940683-120940705 CTCAGGGCCCAGGCTGAGGCCGG - Intergenic
1077098675 11:811209-811231 CTGTAGTCCCAGACTGAGGTGGG + Intronic
1078086107 11:8233762-8233784 CTCAGGTCCCAGAGCCAGGCTGG - Intronic
1078129589 11:8602331-8602353 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
1078406222 11:11072163-11072185 CTCAGGGGCCAGAGTGATGCAGG + Intergenic
1078610624 11:12816195-12816217 CTCACGTCCCACTTTGAGGCTGG + Intronic
1080595789 11:33773851-33773873 CTGAAGTCCGAAAGTGAGCCCGG + Intronic
1080659621 11:34285289-34285311 TGCAAGCCCCAGAGTTAGGCGGG + Intronic
1080818423 11:35781388-35781410 CACAAGTCCCAGAGACAAGCTGG + Intronic
1081265500 11:41015876-41015898 CTATAGTCCCAGGCTGAGGCAGG + Intronic
1081285860 11:41269390-41269412 TTCAAGCCACAGAGAGAGGCAGG + Intronic
1081991052 11:47337825-47337847 CTCAAGGCCCTGAGCGGGGCAGG - Intronic
1082050749 11:47768498-47768520 GTCAAGTGCCAGGGAGAGGCTGG - Intergenic
1083330610 11:61896727-61896749 CTGAGGACCCAGAGTGGGGCTGG - Intergenic
1083612200 11:64009664-64009686 GTCCAGGCCCAGAGTGAGGCAGG + Intronic
1084453422 11:69253308-69253330 CTCAAATCCCAAAGTGAAGGGGG + Intergenic
1084863451 11:72037736-72037758 CTCAATTCCAAGACTGATGCTGG - Intronic
1087045969 11:93844296-93844318 ATCCAGTCCCAGAGTGAGTCTGG + Intronic
1088557918 11:111081488-111081510 CTCAAGGCCCTCAGTGAGGTAGG - Intergenic
1088984105 11:114890327-114890349 CTCATGTCCCAGGGTGAAGGTGG - Intergenic
1089402135 11:118170468-118170490 CTGAGGTCCAAGAGTTAGGCAGG + Intronic
1089637403 11:119824186-119824208 ATCAAGGCCCAGAGAGAGGGAGG - Intergenic
1089646732 11:119885317-119885339 CTCCAGGCCCACAGTGAGGGAGG + Intergenic
1090051126 11:123380832-123380854 CTCCAGTCCCAGAATGAGGAGGG - Intergenic
1090142225 11:124277346-124277368 CTCCAGTCCCATAGGGAAGCAGG - Intergenic
1090169267 11:124584465-124584487 CTCAATTCTCAGAGTGTGGAGGG - Intergenic
1091991941 12:4962558-4962580 CTCAAGCCCCAGACTGAAACAGG - Intergenic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1094339466 12:29394939-29394961 TTCAAGACCCAGAGAGAGACGGG - Intergenic
1097110257 12:56652507-56652529 CTGAAGTTCTAGAGTGATGCAGG + Intergenic
1097998997 12:65921369-65921391 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1103035247 12:117651333-117651355 CTCAAGTCCCAGAGGGTCCCTGG + Intronic
1103719427 12:122965529-122965551 CTCAAGTCCCAGAGTGAGGCTGG - Intronic
1104041209 12:125132423-125132445 CCGAAGTGCCAGAATGAGGCAGG + Intronic
1107274499 13:38662913-38662935 CTCAAGTCCTTGAGTGATGGTGG - Intergenic
1108648838 13:52455768-52455790 CACAAGGCCAAGAATGAGGCAGG - Intronic
1110859009 13:80327428-80327450 CTGTAATCCCAGGGTGAGGCAGG - Intergenic
1112384886 13:98930431-98930453 CTCAAGTTCCAAAGCCAGGCTGG + Intronic
1113557879 13:111253068-111253090 TTCTTGTCCCAAAGTGAGGCAGG - Intronic
1114668037 14:24392218-24392240 AACAAGTCCCAGAGAGAGGTGGG + Intergenic
1114751880 14:25213493-25213515 GTCAACTACTAGAGTGAGGCAGG - Intergenic
1118254805 14:64196257-64196279 ATCAAGTCTCAGAATAAGGCTGG + Intronic
1118385883 14:65255257-65255279 CTCCATTCTCAGAGTGAGACAGG + Intergenic
1119471087 14:74899711-74899733 CCCAAGTCCCTGACTGAGCCTGG - Intronic
1121665361 14:95667722-95667744 CTCTGGCCACAGAGTGAGGCAGG - Intergenic
1122760436 14:104020906-104020928 CTCATGCCCCAGAGTGGGGCTGG + Intronic
1123759399 15:23420954-23420976 CTGAGGTTCCAGACTGAGGCGGG + Intergenic
1124101400 15:26697530-26697552 CTCAAGTCCTCCAGTGAAGCAGG + Intronic
1125671048 15:41472995-41473017 TTTAAATCCCAAAGTGAGGCCGG - Intronic
1126589312 15:50323465-50323487 CTGAGGACCCAGAGTGAGGCAGG + Intronic
1127610775 15:60634316-60634338 CTCAGGTCACTGAGAGAGGCTGG - Intronic
1128127203 15:65201910-65201932 TGCAAGGCCCAGAGTGATGCTGG - Exonic
1128452171 15:67811976-67811998 CCCAAGTCCCAGGGTGAGGGAGG + Intergenic
1129230386 15:74193997-74194019 CTCAGGGCCCAGTGTGAGGTGGG - Intronic
1129265140 15:74389330-74389352 GTCCATTGCCAGAGTGAGGCAGG - Intergenic
1129383956 15:75185492-75185514 CTGAGGTCACAGAGTTAGGCTGG + Intergenic
1130928227 15:88400929-88400951 CTGAAGTCCCAAGGTCAGGCTGG - Intergenic
1131081698 15:89542054-89542076 ATCAAATCCCAGAGGAAGGCAGG + Intergenic
1131222355 15:90595447-90595469 CTATAGTCCCAGGCTGAGGCAGG + Intronic
1131443071 15:92473365-92473387 CTCAGGTTCCAGAGTGGTGCAGG + Intronic
1132289058 15:100686577-100686599 GTCAAGGCCCAGAGGGAAGCGGG + Intergenic
1133040181 16:3056517-3056539 CTCAGGTCCCAGGCTGAGGCAGG - Intronic
1133230836 16:4365770-4365792 CTCCAGTCCTGGAGTGACGCAGG - Intronic
1134269657 16:12722611-12722633 CTGTAGTCCCAGCGTGAGGCAGG + Intronic
1135325725 16:21524289-21524311 CCCACGTCCCAGCATGAGGCTGG + Intergenic
1136172445 16:28497053-28497075 CAGAAGTCCCAGAGGCAGGCGGG + Exonic
1136569305 16:31087291-31087313 TTAAAGTCACAGACTGAGGCCGG - Intronic
1136573774 16:31111477-31111499 ACCAAGTCCCAGAATGGGGCAGG - Intronic
1137756930 16:50909872-50909894 CTGTAATCCCAGCGTGAGGCAGG - Intergenic
1138459504 16:57139825-57139847 CCCAAGTCACACAGTGAGGAAGG - Intronic
1139517846 16:67462266-67462288 CCCACCTCCCAGGGTGAGGCTGG - Intronic
1140802808 16:78504708-78504730 CTCAATTGCAAAAGTGAGGCTGG + Intronic
1141968929 16:87466791-87466813 CTCAATTCCCAGTTAGAGGCTGG + Intronic
1142038738 16:87878934-87878956 CCCATGTCCCAGCATGAGGCTGG + Intergenic
1142395794 16:89830528-89830550 CTTAAGTCCCAGAGAAAGGCTGG - Intronic
1142797321 17:2318574-2318596 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1143319787 17:6060728-6060750 CACAAGTACCAGAGTCAGCCTGG + Intronic
1143347012 17:6257169-6257191 CCCAAGCCCCAGAATCAGGCAGG - Intergenic
1143455690 17:7066103-7066125 CTGAATTCCCAGGGTGAGCCTGG - Intergenic
1145285456 17:21502945-21502967 GGCAAATCCAAGAGTGAGGCAGG - Intergenic
1145392069 17:22462799-22462821 GGCAAATCCAAGAGTGAGGCAGG + Intergenic
1146476014 17:33163342-33163364 CTCCAGGCCCACAGAGAGGCAGG - Intronic
1146730989 17:35193858-35193880 CTCAAGGCAGAGAGTGAGGACGG + Exonic
1147147029 17:38491338-38491360 CTCAGGTGCCAGAGTGAGGGAGG + Intronic
1147914624 17:43879070-43879092 CCAAAGTCTCAGAGTGAGCCAGG - Intronic
1150646052 17:66978125-66978147 CCCAGATCCCAGAGTGAGTCAGG + Intronic
1151269616 17:72984059-72984081 CTCATGGCTCAGAGTGGGGCTGG + Intronic
1151314883 17:73315709-73315731 CCCAAGTCCCAGAGGCAGGCAGG - Intergenic
1151368242 17:73630838-73630860 CCCAAGGCCCAGGCTGAGGCTGG + Intronic
1151439568 17:74119443-74119465 CTCAGGTCACAGAGAGAGGGTGG - Intergenic
1151624860 17:75270507-75270529 CTCCAGTCCCAGCAGGAGGCAGG + Intronic
1151861089 17:76762542-76762564 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1152037797 17:77883933-77883955 CTGTAGTCCAAGAGAGAGGCAGG - Intergenic
1152563874 17:81091585-81091607 CTGAAGACCCTGAGAGAGGCAGG + Intronic
1153290790 18:3499595-3499617 CTTAAGGCCCAGGGTAAGGCTGG + Intronic
1156871959 18:41955458-41955480 CTCAAGGCCCAGATTGGGGGCGG + Intronic
1157335465 18:46734194-46734216 CGTAAGTCACAGAGTGAGTCAGG - Intronic
1158712013 18:59845996-59846018 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
1159573627 18:70148461-70148483 CTCAAATACCAGAGTTATGCAGG - Intronic
1159794214 18:72822228-72822250 CTCAAGTCTCAGAGGGTGGAGGG + Intronic
1160006917 18:75074850-75074872 CTCCAGGCCAAGAGTGAGGATGG + Intergenic
1160116023 18:76080415-76080437 CTCACCTCCCACACTGAGGCTGG + Intergenic
1160656686 19:275851-275873 CTCAAGATCCAAAGTGTGGCTGG + Intergenic
1160763899 19:798618-798640 CTCGCCTCCCGGAGTGAGGCAGG + Intronic
1161218147 19:3105012-3105034 CTCCAGACCCAGTCTGAGGCAGG + Intronic
1161978532 19:7619135-7619157 CTCAAGTCTTGGAGTCAGGCAGG - Intergenic
1163364043 19:16866281-16866303 GTCAAGTCCCAGAGGAAGACAGG + Intronic
1163559939 19:18013079-18013101 ACCAAGTCTCAGAGTGAGGCGGG + Exonic
1163865766 19:19772095-19772117 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
1164222044 19:23203796-23203818 CTCCTGACCCAGAGTGAGGCTGG + Intergenic
1164921068 19:32089077-32089099 CTCATGTCCCAGAGCATGGCAGG - Intergenic
1165003838 19:32788232-32788254 CTGTAATCCCAGACTGAGGCAGG - Intronic
1166203430 19:41253410-41253432 ATCAAGTCCAAGAGGAAGGCTGG + Intronic
1168293554 19:55368653-55368675 CTCAGGTGGCAGAGTGAGGGAGG - Intronic
1168628325 19:57936349-57936371 CTAATGCCTCAGAGTGAGGCAGG - Intergenic
925341696 2:3142459-3142481 CTCAGGTCTCAGAGGGAGTCAGG + Intergenic
926140850 2:10367014-10367036 CTGAGATCCCACAGTGAGGCTGG + Intronic
926951924 2:18252450-18252472 CTCTAGTCCCTGACTGTGGCAGG - Intronic
927562371 2:24083099-24083121 CTCAAGTCCCAAAATGTTGCTGG + Exonic
928939904 2:36717288-36717310 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
929178820 2:39010586-39010608 CTCAAACCACAGAGTGAGGTTGG + Exonic
930019512 2:46992990-46993012 ATCAAGGCCCAAGGTGAGGCAGG + Intronic
931876949 2:66524232-66524254 TTCAAAACCCAGAGTCAGGCTGG - Intronic
934136027 2:88997346-88997368 CTCAGGTCCTGGAGTGAGGAGGG - Intergenic
935560780 2:104557489-104557511 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
936286173 2:111183004-111183026 ATGAAGTCCAAGAGTGGGGCTGG - Intergenic
936288703 2:111201117-111201139 CATAAGCCCCAGAGTGAGTCAGG - Intergenic
936619734 2:114082926-114082948 CCCAGGGCCAAGAGTGAGGCAGG - Intergenic
937029059 2:118722886-118722908 AGCAAGTTGCAGAGTGAGGCAGG + Intergenic
937150404 2:119682280-119682302 CTCAAGACCAAGAAGGAGGCTGG - Intronic
938251842 2:129821656-129821678 CTCAATTCCCAGAGTGCTGGGGG + Intergenic
940805936 2:158186479-158186501 CTCAAGTCACAGATTGAGTAAGG - Intronic
943337224 2:186631067-186631089 CTCCATTCCCAGAGTGATGGGGG - Intronic
946148253 2:217747112-217747134 TGGCAGTCCCAGAGTGAGGCAGG - Intronic
946163110 2:217847935-217847957 CACAAGTCCCAGAGTGTCCCCGG - Exonic
946537082 2:220642714-220642736 CTCAAATGCCAGAATGAGGAGGG - Intergenic
947524077 2:230868059-230868081 GTCCAGGCCCAGAGTGAGGGCGG + Intronic
947752870 2:232541862-232541884 CTCCAGGCCCACAGGGAGGCAGG + Intronic
947942733 2:234072686-234072708 CTGAAATCACAGAATGAGGCTGG + Intronic
948485297 2:238276970-238276992 CTGAAAGGCCAGAGTGAGGCTGG + Intronic
948614087 2:239187199-239187221 CTCATGTCCCCGAGGCAGGCGGG + Intronic
948627022 2:239275676-239275698 GTCCAGCCTCAGAGTGAGGCTGG + Intronic
948790061 2:240372422-240372444 CTCAAGTCCCTGAGAGGGGCAGG + Intergenic
948830920 2:240597883-240597905 CTCAGGTCCCAGAGGGTGGAAGG + Exonic
1172436337 20:34931338-34931360 CTAAAGCCCCAGAGAGAGGGTGG - Exonic
1172477900 20:35252734-35252756 CTGAAGCACCGGAGTGAGGCTGG + Intronic
1172483679 20:35286441-35286463 CTCAGGTCCCAGACTGGGGAAGG - Exonic
1173802305 20:45902076-45902098 CACATGTCCCAGAGGCAGGCAGG - Intronic
1174356997 20:50005351-50005373 CCCAAGTCCCAGAGGAAGGAGGG + Intergenic
1174637439 20:52013805-52013827 CTATAGTCCCAGGCTGAGGCAGG + Intergenic
1176857118 21:13981882-13981904 CTCCAGCCCCAGCGTGTGGCGGG + Intergenic
1177975069 21:27838142-27838164 CCCAGGTCCCAGAGGAAGGCTGG + Intergenic
1178613397 21:34107873-34107895 CCCAATCCCCAGACTGAGGCAGG - Intronic
1179515057 21:41900562-41900584 CCCACGTCCCAGAGGCAGGCGGG - Intronic
1181043342 22:20203264-20203286 GTCAAGGCCCAGAGGGAGGGAGG + Intergenic
1181529274 22:23507301-23507323 GTCAAGTCACAGAGTGTGACTGG - Intergenic
1182393896 22:30021507-30021529 CTCAAGTACAAGTGTGAGCCTGG + Intronic
1183030198 22:35098090-35098112 CACAAGTCACATATTGAGGCTGG + Intergenic
1184289848 22:43492774-43492796 CTCAAGGCCCAGAGCTTGGCTGG + Intronic
1184432895 22:44451957-44451979 CTCAGGACCCAGAGTCAAGCTGG + Intergenic
1184605782 22:45574080-45574102 CTCAGAGCCCACAGTGAGGCTGG - Intronic
1184674644 22:46034727-46034749 CTCAAGACCAAGGCTGAGGCGGG - Intergenic
1184918090 22:47587042-47587064 CACCATTCCCACAGTGAGGCAGG + Intergenic
1184952110 22:47850827-47850849 CTCCAGTCTCAGAGTGGGACAGG + Intergenic
950080213 3:10216583-10216605 CCCCAGTCCTAGAGTCAGGCAGG + Intronic
951564746 3:24002159-24002181 CCCAAGTCTGGGAGTGAGGCGGG + Intergenic
952443709 3:33359734-33359756 CAGAAGCCCAAGAGTGAGGCTGG + Intronic
952632595 3:35487546-35487568 CTAGAGTTCCAGAGGGAGGCTGG - Intergenic
953716902 3:45323396-45323418 CTAAAGTCCCAGGCTGAGGTGGG + Intergenic
954134713 3:48576645-48576667 CTGAAGTCCCAGAATGACCCAGG + Intronic
954792977 3:53146480-53146502 CTCAAGTCTCGGATGGAGGCGGG + Intergenic
961128322 3:124442024-124442046 CTCGGGTCCCCGAGTGTGGCTGG - Exonic
961381628 3:126499480-126499502 CACAGGGCCCAGAGGGAGGCTGG + Intronic
961658100 3:128454248-128454270 AGCCAGTCCCAGAGAGAGGCAGG + Intergenic
961783667 3:129336583-129336605 ATCAAGTCCCAGAGTTCAGCGGG - Intergenic
966189847 3:177262251-177262273 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
967423668 3:189301689-189301711 CTCCAGGCCAAGAGTGGGGCTGG - Intronic
967823845 3:193862952-193862974 TTGGAGTCCCAGACTGAGGCAGG - Intergenic
969397394 4:6931193-6931215 CAGACGACCCAGAGTGAGGCCGG - Intronic
971071393 4:23096724-23096746 GTCCAATCACAGAGTGAGGCAGG + Intergenic
972545901 4:40080457-40080479 CTGTAGTCCCAGACAGAGGCAGG - Intronic
974895431 4:67932456-67932478 CTCAAATCCAGGACTGAGGCAGG - Intronic
975735093 4:77373068-77373090 CTCAATCCCCAGAGTAAGGAGGG + Intronic
978835528 4:113145487-113145509 CTTAAGTCCATGTGTGAGGCAGG + Intronic
980131881 4:128824306-128824328 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
981484960 4:145276290-145276312 CTCCAGTCTCAGAGTGGGGTGGG - Intergenic
982273024 4:153610772-153610794 CTCAAGTCCCACAGAAGGGCTGG + Intronic
984490912 4:180433354-180433376 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
984664942 4:182416875-182416897 ATCAAAACCCAGTGTGAGGCAGG - Intronic
985588038 5:751024-751046 CTCTTGTCCCAGGGAGAGGCCGG - Intronic
985589041 5:755374-755396 GCCATGGCCCAGAGTGAGGCTGG - Intronic
985602707 5:843491-843513 CTCTTGTCCCAGGGAGAGGCCGG - Intronic
985603721 5:847890-847912 GCCATGGCCCAGAGTGAGGCTGG - Intronic
986002638 5:3642361-3642383 GGCCACTCCCAGAGTGAGGCAGG + Intergenic
989404315 5:41043245-41043267 CTCAACTCCCAGAGTGACAGTGG + Intronic
990197388 5:53334063-53334085 CTCAAATACAAGAGAGAGGCTGG - Intergenic
991170433 5:63618485-63618507 CTAAGGTCCCAAAGTGAGGATGG + Intergenic
994232586 5:97324973-97324995 CTCATGGGCCCGAGTGAGGCGGG + Intergenic
996409023 5:123136836-123136858 CTCACTTCCCAGAGTCTGGCTGG + Intronic
997585507 5:135040762-135040784 CTCCAGTCCCTGAGAAAGGCAGG - Intronic
999765978 5:154741171-154741193 CTCAAGCCCAGGAGTGAGCCTGG - Intronic
999887249 5:155936972-155936994 CTCTAATCTCAGAGTGAGGGCGG - Intronic
1001530083 5:172455177-172455199 CCCATGTCCCAGACTGAGGCTGG - Intergenic
1002374340 5:178777472-178777494 CGAAAGTTCCAGAATGAGGCAGG - Intergenic
1002640256 5:180627322-180627344 CTGGGGTCGCAGAGTGAGGCAGG + Intronic
1002784211 6:389464-389486 CTCAAGTCTCAGTGTGTGGAGGG + Intergenic
1003075092 6:2976612-2976634 CTCCGGACCCAGAGTGAGGAAGG + Intergenic
1006238066 6:32653147-32653169 CTTCAGTCCCAAAGGGAGGCAGG + Intergenic
1006722949 6:36171616-36171638 CTCAAATTCCAGAATGAGGAGGG + Intergenic
1006822852 6:36912210-36912232 CTGAGGTGCCAGAGTGTGGCAGG - Intronic
1007222513 6:40290334-40290356 ATCAAGGCCCAGAGAGAGGATGG + Intergenic
1007222748 6:40292071-40292093 CTCAAGTCCCCCAGTCAGGCAGG - Intergenic
1007369080 6:41414412-41414434 CTCTAGTCCAAGAGTCTGGCTGG + Intergenic
1010809964 6:80289922-80289944 CTCTAGTCCCACAGGGAAGCTGG - Intronic
1012137614 6:95578039-95578061 CTCAAGGCCCAGAGGCAGTCTGG - Intronic
1012290358 6:97448022-97448044 GTAAAGTCACAGAGTGAGGCAGG - Intergenic
1012390290 6:98730272-98730294 CTCCAGACCCAGAGGGAGACAGG - Intergenic
1013156602 6:107497019-107497041 TTCAAGTTCCAGAGTGAAGCAGG - Intronic
1013209547 6:107974375-107974397 CCCAAGCCCCAGAGTGGGGCAGG - Intergenic
1013391049 6:109686836-109686858 GTCAAGTCCTAAAGTCAGGCAGG + Intronic
1013943020 6:115688547-115688569 CTGAAGTCTCAGGGTGAGCCAGG + Intergenic
1014820845 6:125986858-125986880 ATCAAGTACCGGAGTTAGGCAGG + Intronic
1017315618 6:153027970-153027992 CTCAAGTGCAAGCGTGAGGACGG + Intronic
1017491932 6:154952610-154952632 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1017711599 6:157173919-157173941 CACAAGTTACAGAGTGAAGCAGG - Intronic
1018501523 6:164415711-164415733 CTCCAATCCCAGAGTTTGGCAGG - Intergenic
1019409483 7:900358-900380 CTGAAGTTCTAGAGTGAGGCAGG + Intronic
1019429619 7:992665-992687 CCCAGGTCCCAGAGTGAGGCCGG - Intergenic
1021245123 7:18252230-18252252 CTCAAGTCCTGAAGTGGGGCAGG + Intronic
1021890140 7:25179841-25179863 CCCAAGTCCGAGAGAGAGGTGGG - Intronic
1022232770 7:28429911-28429933 GTCATGTCCCAGGATGAGGCTGG - Intronic
1023497403 7:40813058-40813080 CTGTAGTCCCAGAGTGTGGTTGG + Intronic
1023595980 7:41829866-41829888 CACAGGTCCCAGAAGGAGGCTGG - Intergenic
1026467352 7:70665805-70665827 CTCAAGTCCCACAGTTGGCCCGG - Intronic
1026657643 7:72271217-72271239 CTAAAATCCAAGAGGGAGGCAGG + Intronic
1029272400 7:99385075-99385097 CTGTAGTCCCAGCCTGAGGCAGG - Intronic
1030924686 7:115437550-115437572 CTGTAGTCCCAGCCTGAGGCAGG - Intergenic
1032715211 7:134503323-134503345 CTCAAGGAGCAGAGTGAAGCTGG + Intergenic
1032778863 7:135145485-135145507 GTCAAGCCCCAGACTGGGGCAGG + Intronic
1034740674 7:153470849-153470871 CTGAAGTCAGAGAGAGAGGCAGG + Intergenic
1035230067 7:157460013-157460035 CAAAAGCCCCAGAGAGAGGCCGG - Intergenic
1035324178 7:158054318-158054340 CTGAAGTCCCAAAGTGGGACAGG + Intronic
1036695460 8:10971720-10971742 CTAAAGTCCCAAAGAGAGGACGG + Intronic
1037833754 8:22204272-22204294 CTCAAGTCCCTGGTAGAGGCAGG - Intronic
1038947245 8:32374883-32374905 CCCAAGTCCTTGAGTGAGGATGG + Intronic
1041789233 8:61673320-61673342 CTCATGTCCCAAAGCAAGGCAGG + Intronic
1042079794 8:65039039-65039061 CTGAAATCACAGAGTGAGTCAGG - Intergenic
1044924132 8:97195449-97195471 CTCTGGACACAGAGTGAGGCTGG + Intergenic
1045348415 8:101315924-101315946 CTCAAGAGGCTGAGTGAGGCAGG - Intergenic
1048355747 8:133652824-133652846 ATTAAGTCTCAGAGTCAGGCAGG + Intergenic
1053018092 9:34675531-34675553 CTGCAGTCCCAGAGTGTGGGTGG + Intergenic
1053561475 9:39200321-39200343 ATCATGTCCCAGAACGAGGCTGG - Intronic
1053825572 9:42020567-42020589 ATCATGTCCCAGAACGAGGCTGG - Intronic
1054135644 9:61418626-61418648 ATCATGTCCCAGAACGAGGCTGG + Intergenic
1055294940 9:74824635-74824657 GTAAGGTCCCAGGGTGAGGCAGG + Intronic
1055569633 9:77603346-77603368 CTCAAGTTCCAGGGTAAGCCTGG + Intronic
1056762021 9:89422471-89422493 CTGAAGTCCAAGAGAGAGGCTGG + Intronic
1057930021 9:99185141-99185163 CTCAAGGGCGAGAGGGAGGCAGG + Intergenic
1058791929 9:108456166-108456188 CTCAATTCCCTTAGTGAAGCAGG + Intergenic
1059027317 9:110648999-110649021 CTCAAGTCCCCAAGTGTGGGAGG + Intergenic
1059258777 9:112955933-112955955 CTGGAGTCTCAGAGAGAGGCTGG - Intergenic
1059328668 9:113520612-113520634 CTCCAGACCCAGAGGGAGGCTGG - Intronic
1060793090 9:126498665-126498687 CTGAGGTCCCAGAGTGAGCTGGG - Intronic
1061092371 9:128433919-128433941 CTCAAATGCCAGAGCGAGGTTGG + Intronic
1062113000 9:134792276-134792298 CTCTGGTCCCAGTGTGGGGCAGG + Intronic
1062238590 9:135524244-135524266 CACATGTCCCAGAGTGGGCCAGG + Intronic
1188342476 X:29021099-29021121 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1190832599 X:54072860-54072882 CTGAAGTCCCAGAAACAGGCAGG + Exonic
1193494088 X:82188480-82188502 CACAACTACCAGACTGAGGCAGG - Intergenic
1194373707 X:93107189-93107211 CTGTAGTCCAAGAGTGTGGCTGG + Intergenic
1196176165 X:112641310-112641332 GTCAAGTCCCAGCCAGAGGCAGG + Intronic
1197326758 X:125103876-125103898 CTCAAGAGGCTGAGTGAGGCAGG + Intergenic
1197727893 X:129788369-129788391 CTCAAGTCCCGGACCTAGGCAGG + Intronic
1199591236 X:149470007-149470029 CCCAGGTCCCAGAGTGAACCTGG - Intergenic
1200681736 Y:6221223-6221245 CTGTAGTCCAAGAGTGTGGCTGG + Intergenic