ID: 1103721334

View in Genome Browser
Species Human (GRCh38)
Location 12:122977076-122977098
Sequence CCAAACCAGCAGGAGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 269}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103721327_1103721334 -1 Left 1103721327 12:122977054-122977076 CCACCATCTCTGCCTCCAAAAAC 0: 1
1: 0
2: 3
3: 79
4: 898
Right 1103721334 12:122977076-122977098 CCAAACCAGCAGGAGCTGGAAGG 0: 1
1: 0
2: 0
3: 23
4: 269
1103721326_1103721334 3 Left 1103721326 12:122977050-122977072 CCAGCCACCATCTCTGCCTCCAA 0: 1
1: 0
2: 5
3: 61
4: 686
Right 1103721334 12:122977076-122977098 CCAAACCAGCAGGAGCTGGAAGG 0: 1
1: 0
2: 0
3: 23
4: 269
1103721323_1103721334 29 Left 1103721323 12:122977024-122977046 CCTGGGTGTGGGATGCTGGGGTC 0: 1
1: 0
2: 1
3: 24
4: 345
Right 1103721334 12:122977076-122977098 CCAAACCAGCAGGAGCTGGAAGG 0: 1
1: 0
2: 0
3: 23
4: 269
1103721325_1103721334 6 Left 1103721325 12:122977047-122977069 CCTCCAGCCACCATCTCTGCCTC 0: 1
1: 0
2: 5
3: 103
4: 933
Right 1103721334 12:122977076-122977098 CCAAACCAGCAGGAGCTGGAAGG 0: 1
1: 0
2: 0
3: 23
4: 269
1103721324_1103721334 7 Left 1103721324 12:122977046-122977068 CCCTCCAGCCACCATCTCTGCCT 0: 1
1: 1
2: 6
3: 80
4: 718
Right 1103721334 12:122977076-122977098 CCAAACCAGCAGGAGCTGGAAGG 0: 1
1: 0
2: 0
3: 23
4: 269
1103721328_1103721334 -4 Left 1103721328 12:122977057-122977079 CCATCTCTGCCTCCAAAAACCAA 0: 1
1: 0
2: 2
3: 52
4: 602
Right 1103721334 12:122977076-122977098 CCAAACCAGCAGGAGCTGGAAGG 0: 1
1: 0
2: 0
3: 23
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103721334 Original CRISPR CCAAACCAGCAGGAGCTGGA AGG Intronic
900204384 1:1425869-1425891 CCAGAGCACCAGGAGCTGGCTGG + Intergenic
900548210 1:3240558-3240580 CCATACCAGCGGGAGGTGGACGG - Intronic
900621753 1:3590730-3590752 CCCTGCCAGCAGGGGCTGGAGGG + Intronic
902490107 1:16775342-16775364 CCAAAGCAGAAGCAGCAGGAGGG + Intronic
902546898 1:17195818-17195840 CAAGGCCAGCAGGAACTGGAAGG + Intergenic
904776466 1:32911201-32911223 GAAAACCAGTAGTAGCTGGAGGG - Intergenic
906240978 1:44242149-44242171 CCACACCAGAAAGAACTGGATGG + Intronic
907159476 1:52360080-52360102 CCAAGGCAGGGGGAGCTGGAGGG + Exonic
907653840 1:56322171-56322193 CAAAACCAACAGGAGATAGATGG + Intergenic
907830463 1:58060037-58060059 CCAAGCCAGGAGGAGCAGGCTGG + Intronic
910481823 1:87667106-87667128 CCAAACCAGCTGGGACTTGAGGG - Intergenic
911087111 1:93988308-93988330 CTAAACCAGCAGGAGCCTGAGGG - Intergenic
912360224 1:109089045-109089067 CTAAAACAGCAGCAGCTGGCCGG - Intergenic
912431982 1:109632833-109632855 CCAGAGCAGCTGGAGCAGGAGGG + Intergenic
912524642 1:110272161-110272183 TCCAACCAGCTGTAGCTGGATGG - Intronic
913149928 1:116031486-116031508 CCCAGCCAACAGGAGCTGCAGGG + Exonic
917571055 1:176265878-176265900 GCAAAGAGGCAGGAGCTGGAGGG + Intergenic
917982347 1:180278163-180278185 CCCAGCCAGCAGGGTCTGGAAGG + Exonic
918719826 1:187838969-187838991 GCAAACAGGCAGGGGCTGGAGGG + Intergenic
919797715 1:201331390-201331412 TCAGACCAGCAGCAGCAGGAGGG + Exonic
920736797 1:208540132-208540154 GGACACCAGCAGGAGCTAGAGGG - Intergenic
921050655 1:211508992-211509014 CCAAAGCAGGAGGAGGTGAAGGG + Intergenic
922500783 1:226095507-226095529 CCAGGCCATAAGGAGCTGGAGGG + Intergenic
922797417 1:228347314-228347336 CCAAACCAGCCAGACCTAGATGG + Intronic
922922012 1:229313410-229313432 CCAGACCAGCAGGCAGTGGAGGG + Intergenic
923530330 1:234807188-234807210 CCAAAGCAGAAGCAGCAGGAGGG - Intergenic
923619657 1:235568066-235568088 CCAAAAAGGCAGGGGCTGGAAGG - Intronic
1064938924 10:20711565-20711587 CTAAGCCTGCAGGAGTTGGAGGG - Intergenic
1066048096 10:31611890-31611912 CCAAATTAGCAGGGGATGGAAGG + Intergenic
1067448361 10:46366809-46366831 TCACAGCAGCAGCAGCTGGAAGG + Intergenic
1067589016 10:47493957-47493979 TCACAGCAGCAGCAGCTGGAAGG - Intergenic
1067636141 10:48002048-48002070 TCACAGCAGCAGCAGCTGGAAGG - Intergenic
1067656082 10:48192633-48192655 CCAAACCACCATGTGCTTGATGG - Intronic
1067828571 10:49597028-49597050 CCACAGCAGCAGGAGCAGGAGGG - Intergenic
1067901263 10:50244087-50244109 GCAAAGAAGCAGGAGCTGGAGGG + Intronic
1070132702 10:73666053-73666075 TCACAGCAGCAGCAGCTGGAAGG - Intergenic
1071419638 10:85479242-85479264 CAAAACCACCAGGGGTTGGATGG - Intergenic
1074681075 10:115908421-115908443 CAAAACTAGCAGGATCTGGTTGG + Intronic
1075809440 10:125214326-125214348 CAAAGCCAGTAGGAGTTGGAGGG - Intergenic
1076131753 10:128018336-128018358 CCAGACCCCCAGGGGCTGGATGG + Intronic
1077315508 11:1917786-1917808 CCAAAGCTCCAGGAGCTGGGCGG + Intergenic
1078017609 11:7628578-7628600 CCACACCAGCAGGAACAGGCAGG - Intronic
1079309022 11:19348078-19348100 CCCAACCAGCAGGAAGTGGGAGG - Intergenic
1079373634 11:19872809-19872831 CCAAACCAGCAGCACCTCCATGG - Intronic
1081659546 11:44879622-44879644 CCAGAGCAGCTGGAGCTGGCTGG + Intronic
1083625589 11:64070456-64070478 CCAAACAAATAGGAGCTGGTGGG + Intronic
1084185083 11:67467316-67467338 CCCCAGCAGCAGGAGCAGGAAGG + Exonic
1084287860 11:68143270-68143292 CCTTGGCAGCAGGAGCTGGATGG + Intergenic
1084342508 11:68515402-68515424 ACAAAGAACCAGGAGCTGGAGGG + Intronic
1084356800 11:68644260-68644282 ACAAAGAACCAGGAGCTGGAGGG + Intergenic
1084432694 11:69120347-69120369 CCCCACCAGCAGGAGGTCGACGG - Intergenic
1084536888 11:69762619-69762641 CCAAGCCATCAGCAGCTGGGGGG - Intergenic
1084654613 11:70507881-70507903 CCAAAGCAGCTGGGGCTGGGAGG + Intronic
1084752742 11:71214835-71214857 CTAGACCAGCAGGTGCTCGATGG + Intronic
1085325620 11:75604346-75604368 CCAAACCAGAAGGACCTAAAGGG + Intronic
1087328679 11:96753515-96753537 GCCAACCAGCAGTAGCAGGATGG - Intergenic
1087946471 11:104165545-104165567 CCAGACTTTCAGGAGCTGGAAGG - Intergenic
1089140205 11:116278378-116278400 CCAAGTCAGCAGGGGCTGGGAGG - Intergenic
1090619798 11:128550313-128550335 CCAAGGCAGCAGGAGGTGGGAGG + Intronic
1091385904 12:94497-94519 CCCAAGGAGCAGGAGGTGGATGG + Intronic
1092223378 12:6730602-6730624 CCAGATGAGCAGGGGCTGGAAGG + Intronic
1092489035 12:8928106-8928128 CCAGACCAGCAGGAGCAACATGG - Intronic
1092728761 12:11508985-11509007 AGAAAACAGCAGGAGCAGGAAGG - Intergenic
1093394162 12:18660260-18660282 CGAAACCAGCAGGAGCCATAAGG + Intergenic
1094362813 12:29648617-29648639 CCACGCCAGAAGGAGCTAGAAGG - Intronic
1096552714 12:52383935-52383957 CTAACTCAGCAGAAGCTGGAAGG + Intronic
1097572991 12:61356463-61356485 CCAAACCTGCAGGGGCAGCAGGG + Intergenic
1103721334 12:122977076-122977098 CCAAACCAGCAGGAGCTGGAAGG + Intronic
1104696876 12:130870987-130871009 CCAAACAAGCTTGAGCTAGAGGG - Intergenic
1104969093 12:132523146-132523168 CACTCCCAGCAGGAGCTGGAGGG - Intronic
1105609008 13:21951282-21951304 CCACACCAGCAGGCACTGGCTGG + Intergenic
1108818490 13:54317985-54318007 CCAGCCCAGCAGGCGCTGGCTGG - Intergenic
1108884687 13:55165405-55165427 TCACACCAGCAGCAGCTGCATGG - Intergenic
1109944976 13:69421012-69421034 CCAAGCCTGCAGGGGCAGGAGGG + Intergenic
1111597207 13:90427581-90427603 CCAAGCCTGCAGGAGCAGGGGGG - Intergenic
1112029874 13:95447385-95447407 GCTGACCACCAGGAGCTGGAAGG - Intronic
1112078466 13:95938788-95938810 CCAATCCAGCAGCACCTGGATGG + Intronic
1112299352 13:98216243-98216265 CCAGGCCAGCAGCAGCTGAAAGG + Intronic
1113487849 13:110668134-110668156 CCAGACCAGTGGGAGCAGGAAGG - Intronic
1113961608 13:114129412-114129434 CCTCACCTGCAAGAGCTGGAAGG + Intronic
1114539954 14:23447732-23447754 CCAAACCAGAAGTGGCTGGGGGG + Intergenic
1114629796 14:24151659-24151681 CCAGACAAGCAGGTGCTGGGAGG + Exonic
1114755884 14:25259486-25259508 CCAAACTGGAAGGAGCAGGAAGG + Intergenic
1114992275 14:28301298-28301320 CGGCACCAGCAGGAGGTGGAAGG - Intergenic
1115470421 14:33763154-33763176 TCAAGCAAGCTGGAGCTGGAGGG - Intronic
1118504990 14:66401547-66401569 CAAAGCTGGCAGGAGCTGGAAGG - Intergenic
1119102819 14:71895974-71895996 CAAACCCAACAGAAGCTGGAAGG + Intergenic
1119519669 14:75276999-75277021 CCAACCCGGCAGGAGCGGGGAGG - Intergenic
1119674880 14:76546222-76546244 GCCAACCAGCAGGAGGTGGAGGG - Intergenic
1120555238 14:85921417-85921439 CCAGGCCAGCAGCAGCTGCATGG - Intergenic
1120871268 14:89339443-89339465 GCCAACCTGCAGGAGCTGGGAGG + Intronic
1121767155 14:96497797-96497819 GGAGACCAGCAGCAGCTGGAGGG + Intergenic
1122981917 14:105195927-105195949 CTGAACCAGCTGGAGCAGGATGG - Intergenic
1123432173 15:20227433-20227455 CCTAACCAGCACCAGCTGGTTGG - Intergenic
1126897357 15:53273273-53273295 CCAAAGCACCAGGAGAAGGAGGG - Intergenic
1127131848 15:55874273-55874295 CCAAACAAGCAGAAACTGGAGGG + Intronic
1128536398 15:68493897-68493919 ACAAACAAGCAGAGGCTGGAAGG - Intergenic
1129262109 15:74374319-74374341 CCCCACCAGGAGGTGCTGGAGGG - Intergenic
1132252124 15:100341840-100341862 CCAAACCAGCAGCAGCAGCACGG + Exonic
1132284331 15:100650211-100650233 CCAAACTAGCTGGAGCCTGATGG + Exonic
1132342551 15:101087573-101087595 CCCAGCCAGGAGGTGCTGGAGGG - Intergenic
1132999455 16:2841690-2841712 CCACAGCAGCAGAAGCAGGATGG + Intergenic
1133031751 16:3014359-3014381 CCAAAACAGCAGCAGCTCGTTGG + Exonic
1133985125 16:10662551-10662573 GCAAAGAGGCAGGAGCTGGAAGG - Intronic
1134569535 16:15279519-15279541 CAAATCCAGCAGAAGATGGAGGG - Intergenic
1134732844 16:16476530-16476552 CAAATCCAGCAGAAGATGGAGGG + Intergenic
1134934598 16:18235441-18235463 CAAATCCAGCAGAAGATGGAGGG - Intergenic
1135846858 16:25926793-25926815 GCAAACCATCAGTGGCTGGAAGG - Intronic
1136360890 16:29779035-29779057 CCAGACCAGGGAGAGCTGGAGGG + Intronic
1136677119 16:31920709-31920731 GCAAAGCAGGAGCAGCTGGAAGG - Intergenic
1136852465 16:33623706-33623728 CCTAACCAGCACCAGCTGGTTGG + Intergenic
1138174446 16:54884133-54884155 AGAAAACAGCAGGAGCAGGAAGG + Intergenic
1140864736 16:79050204-79050226 CAAAACCAGCAGGACCAGTAGGG - Intronic
1141410161 16:83827741-83827763 AGGAACCATCAGGAGCTGGAGGG + Intergenic
1141451617 16:84107327-84107349 CCAAGCCACCAGTGGCTGGAAGG + Intronic
1141710817 16:85698029-85698051 CCAATCCCCCAGGAGCTGGTTGG + Intronic
1142009618 16:87707237-87707259 TGAAGCCAGGAGGAGCTGGATGG + Intronic
1142149796 16:88507656-88507678 CCACATCTGCCGGAGCTGGATGG - Intronic
1142365171 16:89646322-89646344 CCACGCCAGCCGGAGCAGGACGG + Intronic
1203114065 16_KI270728v1_random:1472174-1472196 CCTAACCAGCACCAGCTGGTTGG + Intergenic
1142491220 17:281037-281059 CCAAAACAGCAGGACGTGGCAGG - Intronic
1142592241 17:1011389-1011411 CTGAACCAGCAGGAGCAGGGAGG + Intronic
1144583120 17:16471225-16471247 CACAACCACCAGAAGCTGGAAGG + Intronic
1146520201 17:33520469-33520491 CCAACACACGAGGAGCTGGAAGG + Intronic
1146780104 17:35662609-35662631 CCAAACCAGAAGGATCTGCACGG - Intronic
1147927337 17:43953866-43953888 GCAGACGAGCAGGAGGTGGAAGG + Exonic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1150298930 17:64032344-64032366 CCAGCTCAGCAGGAGGTGGATGG - Intergenic
1150318305 17:64188295-64188317 CCAAAGCAGAAGGAGCTGGCAGG - Exonic
1150653519 17:67024899-67024921 GCCACCCAGCAGGAGCAGGATGG - Exonic
1151715308 17:75828059-75828081 CCAATCCTGCAGCTGCTGGAGGG - Exonic
1152848120 17:82615007-82615029 CCACACCAGCGGGAACTGCATGG + Exonic
1152903487 17:82958179-82958201 TCAAAGCCCCAGGAGCTGGACGG + Intronic
1157098278 18:44707099-44707121 TCAAAGGAGGAGGAGCTGGAAGG + Intronic
1157661839 18:49452408-49452430 CCAAATCAGCAGGATGTGGGTGG - Intronic
1158246584 18:55439159-55439181 CCAAAACAGTAGGAGGTTGAGGG + Intronic
1160431334 18:78814853-78814875 CCCAAACAGCAGGAACTGGAGGG + Intergenic
1162432559 19:10637775-10637797 CTCACCCAGCAGGAGCTGGCGGG - Intronic
1162790067 19:13058124-13058146 CCAGAGAAGCAGGAGCTGGGAGG - Intronic
1163002778 19:14379176-14379198 GAACACCAGCAGAAGCTGGAAGG - Intergenic
1163063972 19:14779563-14779585 GAACACCAGCAGAAGCTGGAAGG + Intergenic
1164144379 19:22502491-22502513 CCAAACCAGATGGAGTTTGAAGG - Intronic
1166368854 19:42290671-42290693 CCAAACAAGGAGGAGCAAGAGGG + Exonic
1166817156 19:45553262-45553284 CCAAACCAGGACGACCTGCAAGG - Intronic
1168444708 19:56402047-56402069 GCAAAGAGGCAGGAGCTGGAAGG - Intronic
1168689560 19:58368605-58368627 CCCAACCAGCAGCAGCAGGCGGG - Exonic
925514591 2:4666478-4666500 CCAAACCAGCAGCACTTGGATGG - Intergenic
926700378 2:15799512-15799534 CCAGACCAGTAGGAGCAAGAGGG - Intergenic
927285673 2:21354455-21354477 CCAAAGAGGCAGGGGCTGGAGGG - Intergenic
927725323 2:25417785-25417807 TGAGACCATCAGGAGCTGGAAGG + Intronic
930094693 2:47558278-47558300 CCAAACCAGCAGGAAGTGTGGGG + Intronic
931769585 2:65486196-65486218 AGAAAACAGCAGAAGCTGGAAGG - Intergenic
932742834 2:74304853-74304875 CCAAATCAACAGTTGCTGGAGGG + Intronic
934711977 2:96522363-96522385 CACACCCAGCAGAAGCTGGAGGG - Intergenic
935411527 2:102769349-102769371 CCAAACAAAAAAGAGCTGGAGGG + Intronic
939568079 2:143808310-143808332 AGAACCCAGCAGGAGCTGAATGG + Intergenic
940050537 2:149458096-149458118 CCATACCAGCAGAGGCTGAATGG + Intronic
942328118 2:174792672-174792694 CCAACCCAGCAGGGTCTGGCAGG + Intergenic
942444565 2:176069522-176069544 CCAAAGCAGCACCAGCTGCATGG + Intergenic
942482883 2:176407745-176407767 CCAAATGAGCAGGATCTGAAGGG - Intergenic
942496892 2:176549359-176549381 TAAAACCAGCAGAAGCTGGTGGG - Intergenic
942959636 2:181814410-181814432 CCAGGCCAGCATGTGCTGGATGG - Intergenic
943524712 2:189002318-189002340 GGAAACCAGCAGGTCCTGGAGGG - Exonic
944079525 2:195771116-195771138 CAAAACCAGCCTGAGCAGGATGG + Intronic
944130893 2:196346621-196346643 CCCAACCTACAGGAGCTGGTGGG - Intronic
944253830 2:197604350-197604372 GCAAACCACCAGCAGCTGAATGG + Intronic
946157011 2:217813611-217813633 CTAAACCTGGAGGTGCTGGAGGG - Intronic
946310449 2:218880182-218880204 ACACACCTGCAGGGGCTGGAGGG - Intergenic
947328671 2:229005069-229005091 GCAAACCAGCAGAAGCTAGGAGG + Intronic
947572838 2:231249411-231249433 ACAAACCAGCAGGAGGTGTAAGG - Intronic
948953204 2:241268528-241268550 CCATACCAGCAAAAGCTGGCAGG - Exonic
1170724756 20:18916543-18916565 GCAAAACAGAAGGAGCAGGAAGG - Intergenic
1171370190 20:24657406-24657428 TCAGACCAGCAGGAGGCGGAGGG + Intronic
1171753416 20:29078244-29078266 CCAAACCACCAACACCTGGAAGG + Intergenic
1171788844 20:29499317-29499339 CCAAACCACCAACACCTGGAAGG - Intergenic
1171948152 20:31396816-31396838 CCAAGGTAGCAGGTGCTGGACGG - Intergenic
1172636593 20:36414249-36414271 CCATTCCAGCAGGGTCTGGATGG - Intronic
1173320815 20:41985343-41985365 CCACACCAGCAGGAGGTGAGTGG + Intergenic
1173419039 20:42884361-42884383 CCAAAACAGGAGGCACTGGATGG - Intronic
1173747780 20:45451313-45451335 CCAAACCAGCCTGAGCAGCATGG - Intergenic
1174183391 20:48688938-48688960 CCACGCCAGCAGCAGCTAGAGGG + Intronic
1174532442 20:51224814-51224836 GAAAGCCACCAGGAGCTGGAAGG + Intergenic
1174606825 20:51767714-51767736 CCGAACCAGCAGTCGCAGGAGGG - Intronic
1175996165 20:62813186-62813208 CCAGCCCAGCAGGACCTGCAGGG + Exonic
1176519137 21:7811985-7812007 ACAAGGCAGCAGGAGCAGGAGGG - Intergenic
1178653165 21:34441998-34442020 ACAAGGCAGCAGGAGCAGGAGGG - Intergenic
1180119237 21:45735720-45735742 GTAGACCAGCAGGAGCTGGAGGG + Intronic
1180410211 22:12600304-12600326 CCAAACCACCAACACCTGGAAGG + Intergenic
1182335582 22:29581219-29581241 CCAACTCCGCAGGTGCTGGACGG + Exonic
1182898797 22:33880857-33880879 CCAACCCAGCAGCAGAGGGATGG + Intronic
1183815020 22:40292575-40292597 CCAATCCAGCAGGAGATTGAAGG + Intronic
1184684307 22:46089202-46089224 CCCAGGCAGCAGGAGCTGGAAGG - Intronic
1184730713 22:46369635-46369657 CCAAACATGCATGAGCTGGAAGG - Intronic
1184742041 22:46434261-46434283 CCACTCCAGCAGGAGCTCAAGGG - Intronic
1185021775 22:48380626-48380648 ACAGGCCTGCAGGAGCTGGAAGG + Intergenic
1185219727 22:49623325-49623347 CAAATCCAGCAGGCCCTGGATGG + Intronic
952981914 3:38742948-38742970 CCCAACCAGCTGGACCTGGCTGG + Intronic
954111842 3:48438031-48438053 CCAGATCAGAGGGAGCTGGACGG - Intronic
954148573 3:48646397-48646419 GCAGCCCAGCAGAAGCTGGAGGG - Intronic
956728971 3:72179119-72179141 GAAAACCAGCAGAAGCGGGAAGG + Intergenic
958877639 3:99634009-99634031 CAAAGCCAGCAGGAGCTGTGAGG + Intergenic
958959532 3:100495690-100495712 CCCAACCTGCAGGACCTGGATGG - Intronic
959957273 3:112252870-112252892 ACACACCAGCAGGAGGTGGCTGG - Intronic
960818900 3:121705941-121705963 TCAAAGCAGCAGGATCTGAAAGG + Intronic
960944360 3:122956155-122956177 CCAAAATAGCAGGAGTTGGCTGG - Intronic
962281037 3:134052053-134052075 CCACTCCAGCCTGAGCTGGAGGG + Intronic
963383535 3:144560990-144561012 CCAAACAACCCAGAGCTGGAAGG + Intergenic
965606334 3:170501139-170501161 CCACACCATCAGCCGCTGGATGG - Exonic
966867947 3:184271095-184271117 CCAGCTCAGCAGGAGCTGGATGG - Intronic
968706856 4:2082759-2082781 ACAAAGCAGCAGAAGCTGAAAGG - Intronic
970941759 4:21642218-21642240 TCAAACCAGCAGCATCAGGATGG - Intronic
970941773 4:21642352-21642374 TCAAACCAGCAGCAACAGGATGG - Intronic
973187340 4:47345823-47345845 TCACAGCAGAAGGAGCTGGAAGG - Intronic
975465303 4:74702365-74702387 CCAAACAACCAGCAGCTGAAGGG - Intergenic
977558630 4:98510002-98510024 CCACACCATCAGCAGCAGGAGGG - Intronic
980450030 4:132958760-132958782 CAAAGCCGGCAGGAGCTGGGAGG + Intergenic
981102289 4:140842585-140842607 GCCACCCAGCAGGAGATGGATGG - Intergenic
985041208 4:185893531-185893553 TCAAACCTTCAGAAGCTGGAGGG - Intronic
985491579 5:182787-182809 CCAAGTCAGCAGGAGTTGGCAGG + Exonic
988334768 5:29892793-29892815 AGAAAGTAGCAGGAGCTGGATGG - Intergenic
988454436 5:31374626-31374648 CCAAAACAGCGGCTGCTGGAAGG - Intergenic
988604882 5:32670440-32670462 GAAACCCAGCAGGAGCAGGAAGG - Intergenic
988781741 5:34528783-34528805 GGAAACCAGCAGAAGCTAGAAGG + Intergenic
991049414 5:62256440-62256462 CCTAACCAGCACCAGCTGGTTGG - Intergenic
991078628 5:62570095-62570117 TTAATCCAGCAGAAGCTGGAGGG + Intronic
991950171 5:71939479-71939501 CCAGATCAGCAGGAGCTGAGAGG + Intergenic
995837326 5:116411531-116411553 ACAAGCCAGCAGGAGGAGGAAGG - Intronic
997163130 5:131630442-131630464 CCAAACCTGCAGTATCTGGGAGG + Intronic
997342334 5:133154426-133154448 GGAAACCAGCAGGTGCTGGTAGG + Intergenic
998869237 5:146536169-146536191 CTAAACCACTAGGAGCAGGAAGG - Intergenic
1001932241 5:175681482-175681504 AAAAACCAGGAGGAGCTGGTAGG + Intronic
1002632192 5:180589675-180589697 CAAAACCAGCAGAAACTGCAGGG + Intergenic
1003801102 6:9668416-9668438 CCAATTCAGCAGGAGGTGGGTGG + Intronic
1007780878 6:44253934-44253956 TGAAAACAGCAAGAGCTGGAGGG - Intergenic
1008446548 6:51598469-51598491 CAAGCCCAGCAGGAGCCGGAAGG - Intergenic
1012239909 6:96860082-96860104 CCAATCCAGCAGTGGCTGAAAGG + Intergenic
1014309992 6:119787792-119787814 CCAAATCAGCAGGATGTGGGCGG + Intergenic
1015069776 6:129077951-129077973 CCAAACCCGCAGGACGTGCAAGG + Intronic
1017702759 6:157091489-157091511 TCAAACAAGCAGAATCTGGAAGG + Intronic
1017823462 6:158064905-158064927 CCCAACCAGCAGCAGCTTGATGG - Exonic
1018282754 6:162205597-162205619 GCAAAACAGCAGGAACAGGACGG + Intronic
1019056175 6:169225144-169225166 CCAGACCAGGAGGACTTGGACGG - Exonic
1020083960 7:5300641-5300663 CCCAAGCAGCGGGAGCTGGCAGG + Exonic
1020962169 7:14819050-14819072 GAAAACCAGCAGGAAGTGGAAGG - Intronic
1023879318 7:44309391-44309413 CTGAGCCAGCAGGAGCAGGAGGG + Intronic
1027189265 7:75988305-75988327 CCAGACCAGCAGGAAGTTGAAGG + Exonic
1027882178 7:83854618-83854640 CAAAATCAGGAGGGGCTGGAAGG + Intergenic
1029309130 7:99644935-99644957 CCCACCCAGCAGGAGCAGGATGG + Intergenic
1031372647 7:120986509-120986531 CCAAACCAGCATCTGCTGGTGGG + Intergenic
1032270586 7:130400954-130400976 TCACACCAGCAGGGACTGGATGG + Intronic
1033773427 7:144579830-144579852 ACAACCCAGCTGGAGCTGTATGG + Intronic
1034166415 7:149028370-149028392 CAAGAGCAGCAGGAGCAGGAAGG + Exonic
1037005154 8:13768863-13768885 CCAAACCAGCAGAGGATGGGGGG + Intergenic
1039609528 8:38908232-38908254 CCACACCAGCAGGAGAAAGAGGG + Intronic
1041766787 8:61427277-61427299 CCAAGAAAGCAGGTGCTGGAAGG - Intronic
1042924307 8:73951691-73951713 CAAAACCAGAAAGAGCTGCAAGG + Intronic
1044792038 8:95857717-95857739 GCAGACCAGCAGGAGCAGAAGGG + Intergenic
1045460077 8:102417814-102417836 ACAACCCAGGAAGAGCTGGATGG - Intergenic
1045542022 8:103095581-103095603 AGAAAACAGCAGGAGCAGGAAGG - Intergenic
1046337519 8:112809207-112809229 CAAAACCATAAGGACCTGGAAGG + Intronic
1048465137 8:134659300-134659322 TCAAACCAGCAGGAGCGAGGTGG - Intronic
1048752932 8:137700115-137700137 CCAAACCAGAAAGACCTGGGTGG + Intergenic
1049675974 8:143889320-143889342 GCCAAGCAGCAGGAGCTGCAGGG - Intergenic
1050057440 9:1670519-1670541 CCCAACAAGCAGGAGCTTGAAGG + Intergenic
1051149195 9:14062154-14062176 ACAAAAAAGCAGCAGCTGGATGG + Intergenic
1051877353 9:21806451-21806473 CCTAACCAGCAGTATCTGGGAGG - Intronic
1052837283 9:33260891-33260913 TCTAACCAACAGGAGCAGGAGGG + Intronic
1053466466 9:38312143-38312165 CTGAACCAGCAGGGGCTGGGAGG + Intergenic
1057138910 9:92715084-92715106 CTAACCCAGCAGCAGCGGGACGG - Exonic
1057140090 9:92721357-92721379 CCAGACCTGGAGGAGCTCGAAGG + Intronic
1057560990 9:96127642-96127664 CCAAATCAGCAGGTGCCTGAGGG + Intergenic
1059941966 9:119368148-119368170 CAAAACCAACAGAAGCCGGAGGG + Intronic
1060406832 9:123376982-123377004 CCAAGCCAGCAGGAGGTGGCTGG + Exonic
1060416210 9:123432515-123432537 TCAGAGCAGGAGGAGCTGGAGGG + Intronic
1062173163 9:135146544-135146566 AGGAACCACCAGGAGCTGGAGGG - Intergenic
1062285103 9:135769410-135769432 GCACACCAGGAGGTGCTGGAGGG + Intronic
1203449859 Un_GL000219v1:101622-101644 CCAAACCACCAACACCTGGAAGG - Intergenic
1186423498 X:9444922-9444944 CAAAGGCAGGAGGAGCTGGATGG + Intergenic
1188099942 X:26071363-26071385 CCAGACCTCCAGGAGCTGGCAGG + Intergenic
1188522079 X:31049974-31049996 ACAAAGCAGCAGGAGCTGCCTGG + Intergenic
1188985031 X:36761481-36761503 ACAAACCAACAGGAGATGCATGG - Intergenic
1190470554 X:50775092-50775114 CCAAAGCAGCAGCATCAGGAGGG - Intronic
1191215926 X:57932434-57932456 CCAAAATAGCAGGTGCTTGATGG - Intergenic
1192208192 X:69109960-69109982 GGAAGGCAGCAGGAGCTGGAAGG + Intergenic
1193006071 X:76619112-76619134 CCTAACCAGGATGAACTGGATGG + Intergenic
1194077704 X:89417199-89417221 CAAACCCAGCAGGTGCTGGCAGG - Intergenic
1194195222 X:90883696-90883718 CTACACCAGCAGAAGCTGCAAGG + Intergenic
1194867396 X:99085951-99085973 CCAAACCAACCAGAGGTGGAAGG + Intergenic
1195077163 X:101338240-101338262 CTAAATCAGCAAGGGCTGGAAGG - Intergenic
1196719408 X:118839629-118839651 CGAAACAAGCAGGCGGTGGAGGG - Intergenic
1197354354 X:125418577-125418599 CAAAACCAGCAGAGGCTGGGTGG + Intergenic
1199974791 X:152887007-152887029 CCACAGCAGCAGGGGCTGGCAGG + Intergenic
1200097539 X:153671231-153671253 CCAACCCAGCAGGGGCAGGCAGG + Intronic