ID: 1103721688

View in Genome Browser
Species Human (GRCh38)
Location 12:122978751-122978773
Sequence AGGTGCTGCTGCACGAGCTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 178}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103721680_1103721688 -6 Left 1103721680 12:122978734-122978756 CCCAGGAATCCCCTCCCAGGTGC 0: 1
1: 0
2: 1
3: 19
4: 215
Right 1103721688 12:122978751-122978773 AGGTGCTGCTGCACGAGCTCGGG 0: 1
1: 0
2: 0
3: 16
4: 178
1103721673_1103721688 27 Left 1103721673 12:122978701-122978723 CCAGGGTTGCAGCCCTCTAGTTT 0: 1
1: 0
2: 2
3: 19
4: 135
Right 1103721688 12:122978751-122978773 AGGTGCTGCTGCACGAGCTCGGG 0: 1
1: 0
2: 0
3: 16
4: 178
1103721679_1103721688 -5 Left 1103721679 12:122978733-122978755 CCCCAGGAATCCCCTCCCAGGTG 0: 1
1: 0
2: 3
3: 22
4: 270
Right 1103721688 12:122978751-122978773 AGGTGCTGCTGCACGAGCTCGGG 0: 1
1: 0
2: 0
3: 16
4: 178
1103721672_1103721688 28 Left 1103721672 12:122978700-122978722 CCCAGGGTTGCAGCCCTCTAGTT 0: 1
1: 0
2: 0
3: 5
4: 221
Right 1103721688 12:122978751-122978773 AGGTGCTGCTGCACGAGCTCGGG 0: 1
1: 0
2: 0
3: 16
4: 178
1103721674_1103721688 15 Left 1103721674 12:122978713-122978735 CCCTCTAGTTTCCTTGCTGACCC 0: 1
1: 0
2: 2
3: 14
4: 170
Right 1103721688 12:122978751-122978773 AGGTGCTGCTGCACGAGCTCGGG 0: 1
1: 0
2: 0
3: 16
4: 178
1103721675_1103721688 14 Left 1103721675 12:122978714-122978736 CCTCTAGTTTCCTTGCTGACCCC 0: 1
1: 0
2: 1
3: 17
4: 164
Right 1103721688 12:122978751-122978773 AGGTGCTGCTGCACGAGCTCGGG 0: 1
1: 0
2: 0
3: 16
4: 178
1103721677_1103721688 4 Left 1103721677 12:122978724-122978746 CCTTGCTGACCCCAGGAATCCCC 0: 1
1: 0
2: 4
3: 30
4: 294
Right 1103721688 12:122978751-122978773 AGGTGCTGCTGCACGAGCTCGGG 0: 1
1: 0
2: 0
3: 16
4: 178
1103721681_1103721688 -7 Left 1103721681 12:122978735-122978757 CCAGGAATCCCCTCCCAGGTGCT 0: 1
1: 0
2: 1
3: 26
4: 236
Right 1103721688 12:122978751-122978773 AGGTGCTGCTGCACGAGCTCGGG 0: 1
1: 0
2: 0
3: 16
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103721688 Original CRISPR AGGTGCTGCTGCACGAGCTC GGG Exonic
900146417 1:1160771-1160793 AGGAGCGGCTGCACAGGCTCTGG + Intergenic
901010340 1:6197938-6197960 AGATGCTGCTGTACAAGCTTGGG + Intronic
901060922 1:6471585-6471607 CGGTGCAGCTGCGCGATCTCCGG + Exonic
902373994 1:16021746-16021768 GGGTGCTGCTGGACGAGGGCTGG - Intronic
902685991 1:18078024-18078046 AGGTGCTGATTCACGAGGCCTGG - Intergenic
904333550 1:29783094-29783116 AGGTGCTGCTGCAGGAACAGAGG - Intergenic
904971557 1:34423030-34423052 AGGTCCTCCTGCCCCAGCTCTGG - Intergenic
905058780 1:35121651-35121673 GGGTGCTGCTCCAGGAGCTGGGG - Intergenic
912544517 1:110441184-110441206 AGGTGCAGCAGCAGGATCTCAGG - Intergenic
913050888 1:115115659-115115681 AGTTGCTGCTGCCAGGGCTCAGG - Intergenic
913215150 1:116613922-116613944 AGGTGCGGCTGGACAAGCTGGGG - Exonic
915585492 1:156841718-156841740 AGGGGCTGCTGCCCGTGCGCTGG - Exonic
916060892 1:161098095-161098117 AGGTGCTGCTCCACTAGGGCCGG - Intergenic
918573377 1:186025445-186025467 AGGTGCTGTTTCAGGAGATCTGG - Intronic
919989543 1:202699778-202699800 AGGTCCTGCTGCACAGGCACTGG + Intronic
922165529 1:223112798-223112820 AGCTGCAGCTGCTGGAGCTCGGG - Exonic
1062932787 10:1363694-1363716 TGGTGCAGCTGCACGAGCTGAGG - Exonic
1070374015 10:75811441-75811463 AGGTGCTGCTGCGCTCCCTCGGG + Intronic
1071363561 10:84876181-84876203 AGGTGCTGCTGCACGGTCAGAGG + Intergenic
1074587033 10:114777949-114777971 AGGTGTTGCAGCAAGAGCGCTGG + Intergenic
1074706122 10:116133436-116133458 AGGTGCTGCTGAAGGAGCCATGG + Intronic
1076523088 10:131093372-131093394 CGGTGCCGCTGCAGGATCTCTGG - Intronic
1076605820 10:131689294-131689316 AGCTGCTGCTGGAGAAGCTCGGG - Intergenic
1076719289 10:132386248-132386270 AGGTGCTGCTGGATGGGCCCTGG + Intergenic
1076771355 10:132667156-132667178 AAATGCTGCTGTACAAGCTCAGG + Intronic
1076946064 10:133651351-133651373 TGGTGCTGGTGCAGGAGCTTGGG - Intergenic
1077298378 11:1836382-1836404 AGGCCCTGCTGCCCTAGCTCAGG - Intronic
1078016682 11:7620933-7620955 AGGAGTTACTGCAAGAGCTCAGG + Exonic
1078405556 11:11067465-11067487 GGGAGCGGCTGCAGGAGCTCAGG + Intergenic
1078653753 11:13219465-13219487 AGGTGCTGGTGGAAGAGCCCAGG - Intergenic
1079108792 11:17591727-17591749 AAGTGCTGAGGCACAAGCTCAGG + Intronic
1080472938 11:32563834-32563856 AGGTTCCGCTGCAGGAGGTCAGG - Intergenic
1083061319 11:59875554-59875576 AAGTGCTGCTGTAGGAGCTGGGG - Intergenic
1083319079 11:61834380-61834402 AGGTGAAGATGCAGGAGCTCAGG - Intronic
1083959341 11:66005734-66005756 AGGTCCTGCTGCAGGTGTTCGGG - Intergenic
1084146246 11:67266791-67266813 AGATCCTGCTGCCCGAGCCCAGG + Exonic
1090146143 11:124325200-124325222 AGGTGCTGGTGCAAGAGAGCTGG + Intergenic
1090148669 11:124357910-124357932 AGGTGCTGGTGCAGGAGAGCTGG + Intergenic
1090149331 11:124365975-124365997 AGGTGCTGGTGCAGGAGAGCTGG + Intergenic
1090150331 11:124377230-124377252 AGGTGCTGCTGCAGGAGAGCTGG + Intergenic
1091321833 11:134657315-134657337 CGCTGCTGCTGCTCAAGCTCCGG - Intergenic
1091697292 12:2636451-2636473 AGGAGCTGCTGGACGGGTTCAGG - Intronic
1097376035 12:58844160-58844182 AGGTGCTGCTGCACACGCTGAGG + Intergenic
1103721688 12:122978751-122978773 AGGTGCTGCTGCACGAGCTCGGG + Exonic
1104068755 12:125327218-125327240 AGATGCTGATGCTGGAGCTCAGG - Intronic
1105218882 13:18307412-18307434 AGGTGCGGCTGGACAAGCTGGGG - Intergenic
1105777972 13:23680436-23680458 AGATGTTGCGGAACGAGCTCAGG - Intergenic
1108244921 13:48504535-48504557 AGGAAGTGCTGCAGGAGCTCAGG - Intronic
1111268718 13:85853320-85853342 AGGTGCAGCTGCAGCAGCCCAGG + Intergenic
1111783866 13:92763551-92763573 ACAAGCTGCTGCAGGAGCTCTGG + Intronic
1112306645 13:98280334-98280356 AGCTGAGGCTGCACCAGCTCGGG - Intronic
1113626578 13:111852404-111852426 ATGTGCTGCTGCTCCAGCTCAGG + Intergenic
1117133348 14:52707449-52707471 GAGTGCTGCTCCACAAGCTCAGG - Intronic
1118849467 14:69573055-69573077 TGCTGCTGCTGCCCGCGCTCGGG + Exonic
1119758341 14:77134226-77134248 AGGTGCTGCCCCAGGAGCTGAGG - Intronic
1120888364 14:89469681-89469703 AGGAGCTGATGGACTAGCTCTGG + Intronic
1121970375 14:98350399-98350421 TGCTGTTGCTGCACCAGCTCAGG + Intergenic
1122574987 14:102736352-102736374 AGGTGCTTCTGGCCCAGCTCTGG - Intergenic
1122767343 14:104081541-104081563 AGGTGCTGCTGCTGGAGCGGAGG + Intergenic
1202920166 14_KI270723v1_random:23946-23968 TGGTGCTGGTGCAGGAGCTTGGG - Intergenic
1129762593 15:78139218-78139240 AGGTGGTTCTGCAAGACCTCTGG + Intronic
1129782747 15:78284598-78284620 AGATGCTGCTTCACTAGGTCTGG - Intronic
1130285311 15:82549780-82549802 AGGTGCTGTTGCCCAATCTCAGG + Intronic
1130766259 15:86874553-86874575 AGGTGCTGTGGCAGGGGCTCAGG - Intronic
1132120419 15:99170796-99170818 AGGGGCTGCAGCAGGAGCACAGG - Intronic
1132152915 15:99475134-99475156 AGGAGCAGCTGCCGGAGCTCTGG - Intergenic
1134633931 16:15777981-15778003 AGGTGCTGCTAGAGGACCTCAGG + Intronic
1135589508 16:23695057-23695079 AGCTGCTGCAGCACGACCTCGGG + Exonic
1136576969 16:31130843-31130865 AGGTGCTCCTCCACCAGCTTGGG - Exonic
1136625990 16:31462521-31462543 AGGTGCTGGTAGATGAGCTCCGG + Exonic
1136882742 16:33913007-33913029 AGGGGCTGCTCCAGGAGCACAGG + Intergenic
1137581523 16:49636437-49636459 AGGTGCTGCTGCAGAATCACCGG - Exonic
1139468416 16:67166046-67166068 AGGCGCGGCTGCGGGAGCTCAGG + Exonic
1140497326 16:75400528-75400550 AGGTGCTGCTGAAGGGGATCTGG - Intronic
1141393355 16:83682832-83682854 AGGCCCTGCTGCAGGATCTCAGG - Intronic
1142284912 16:89167722-89167744 AGGTGCAGCCGTAAGAGCTCGGG - Intergenic
1146086812 17:29837916-29837938 AACTGCAGCTGCACAAGCTCTGG + Intronic
1146952242 17:36914863-36914885 AGGTGCTGCTTCAGGGGCTGGGG + Intergenic
1147662763 17:42125785-42125807 AGTTGCTGCAGCACTGGCTCCGG + Exonic
1148978704 17:51552038-51552060 TGATGCTGCTGCACTAGCTCAGG + Intergenic
1150722481 17:67625436-67625458 AGGTGCAGCTGCCAGAGCTCTGG - Intronic
1151616014 17:75212318-75212340 AGGTGCTGTGGCATGAACTCAGG + Intronic
1152484131 17:80578686-80578708 AGGTGCTGCTGCTAGGGCTGGGG + Intronic
1152943749 17:83186950-83186972 AGGTGCTGCGACTTGAGCTCAGG + Intergenic
1154156907 18:11951044-11951066 GGGTTCTGCTGCACCTGCTCAGG - Intergenic
1157653449 18:49361164-49361186 AGTGTCTGCTGCAGGAGCTCCGG + Intronic
1157723625 18:49945478-49945500 TGGAGCTGCTGCTCCAGCTCAGG + Intronic
1157744298 18:50121180-50121202 TGGTGCTACTGCAGGAGTTCAGG - Intronic
1160322357 18:77907940-77907962 AGGTGCCGCTGCACATGCCCGGG - Intergenic
1160733560 19:651839-651861 AGGTGCTGGTCCACGTGCTGGGG + Exonic
1160807928 19:1000768-1000790 AAGTGCAGCTGCAGCAGCTCGGG - Exonic
1161636571 19:5392999-5393021 AGGTGCTATTGCACTAGTTCAGG - Intergenic
1161760160 19:6165234-6165256 AGGAGCTGCTGAACCATCTCAGG - Intronic
1162520101 19:11174607-11174629 AGGTGCCGCCGCACCAGCTCGGG + Exonic
1163142658 19:15360879-15360901 AGGTGCCGCTGGAGGAGCTGCGG + Exonic
1163562936 19:18031382-18031404 AGGTACAGGTGCATGAGCTCAGG - Intergenic
1165992592 19:39825250-39825272 AGGGGGTGCTGGAGGAGCTCTGG - Intergenic
1166144864 19:40826820-40826842 TGGTGTTGCTGCATGAGGTCTGG - Intronic
1166182879 19:41121387-41121409 TGGTGTTGCTGCATGAGGTCTGG + Intronic
1168062015 19:53898438-53898460 AGGTGATGCTGGCCGAGCGCAGG + Exonic
925354391 2:3227773-3227795 AGCTGCTGCTGCTCCAGCTGTGG + Intronic
928282911 2:29964459-29964481 AGGGGCTGCTGCTGGGGCTCAGG - Intergenic
929456372 2:42068981-42069003 ATGTGCTGCTGCCTGGGCTCTGG - Intergenic
930319863 2:49840937-49840959 AGGAGCCGCTACACTAGCTCTGG + Intergenic
931175517 2:59850628-59850650 AGGTGTTGCTATATGAGCTCGGG - Intergenic
932389670 2:71375329-71375351 TGGAGCTGTTGCACGAGCACTGG - Intronic
934295435 2:91739223-91739245 AGGTGCGGCTGGACAAGCTGGGG + Intergenic
934696636 2:96404962-96404984 AGGTGCAGCTGCCCAAGCTGTGG - Intergenic
934936617 2:98470318-98470340 AGGTGGGGCTGCACGTGCACTGG - Intronic
937975892 2:127581889-127581911 AGGTGCAGCACCAGGAGCTCCGG + Exonic
939641865 2:144649327-144649349 TGGTGCTGGTGTCCGAGCTCTGG + Intergenic
941192400 2:162401967-162401989 CGGTGCTGCTACAGGAACTCAGG + Intronic
942608534 2:177717182-177717204 AGGTGCTGCTTCAGTAACTCAGG - Intronic
948111536 2:235460143-235460165 AGGTCCTGCAGCCCGTGCTCAGG - Intergenic
948483155 2:238262990-238263012 GGGTGGAGCTGCACGAGCACTGG + Exonic
1172273532 20:33667690-33667712 AGGGCCTGCTGCAAGAGGTCAGG - Exonic
1172448032 20:35003265-35003287 AGAAGCTGATGCAGGAGCTCTGG + Exonic
1173585658 20:44181089-44181111 TGGGGCTGGTGCAGGAGCTCTGG - Intronic
1174516632 20:51097376-51097398 TGGTCCAGCTGCATGAGCTCGGG + Intergenic
1175037624 20:56015173-56015195 TGGTGCTGCAGCAGGAGCTGGGG + Intergenic
1178511235 21:33206855-33206877 AGGGGCTACTGCAGGAGTTCAGG - Intergenic
1178882835 21:36462369-36462391 AGGAGCTGCGGCAGGAGCACGGG + Intronic
1179559054 21:42201229-42201251 AGGTGCTGGTGCTCGTGCTGGGG - Intronic
1179926617 21:44538532-44538554 AGGGGCTGCTGCACCTGCGCAGG - Intronic
1179932326 21:44579010-44579032 AGGGGCTGCTGCACCTGCGCAGG - Intronic
1179937290 21:44613631-44613653 AGGGGCTGCTGCACCTGCGCAGG + Intronic
1183950442 22:41349585-41349607 AGGTCCTGCTGCAGGAGCCCAGG - Intronic
1185384607 22:50526086-50526108 CGCTGGTGCTGCACGAGCTCGGG - Exonic
950103928 3:10376590-10376612 AGGTGCTACTGCAGGTGCTGCGG + Intronic
952635291 3:35522133-35522155 AGGGGCTGCTGCAAGGGCTTTGG - Intergenic
960738777 3:120809943-120809965 TGGTGCTTCTATACGAGCTCTGG - Intergenic
964623384 3:158736566-158736588 AAGTGCTGCTGTGTGAGCTCAGG + Intronic
965719096 3:171641616-171641638 TGGAGCTGCTGCAGGAGGTCTGG - Intronic
966367350 3:179204158-179204180 AGGTACTGCTTCACCAGCTAAGG + Intronic
967855844 3:194116931-194116953 AGGTGCGACTCCAGGAGCTCAGG + Intergenic
968647695 4:1748659-1748681 AGGGGCTTCTGCCCGAGCCCAGG + Intergenic
969456193 4:7301039-7301061 AGATGCTGCTAAACCAGCTCTGG - Intronic
969484451 4:7464361-7464383 AGGAGAGGCTGCCCGAGCTCTGG + Intronic
970333157 4:15004261-15004283 TGGTGCTGCTGCTGGAGCTGCGG - Exonic
970419400 4:15891233-15891255 AGGAGCTGATGCACCAGCCCTGG + Intergenic
971748304 4:30612949-30612971 AGGTGCTGATTCACTAGGTCTGG + Intergenic
976083558 4:81383733-81383755 AGGTGATGCTGCACCTGCTCAGG + Intergenic
979122792 4:116925476-116925498 AGATGCTGCTGCACTAGGGCTGG - Intergenic
982326558 4:154135239-154135261 TGGTGCTGCTGGACTAGCTCAGG - Intergenic
985282755 4:188303220-188303242 AGGTGCTGCTCCAAGTGCTAAGG + Intergenic
985449474 4:190052005-190052027 TGGTGCTGGTGCAGGAGCTTGGG - Intergenic
985672737 5:1214606-1214628 AGGTCCTGATGCACCAGGTCGGG - Intronic
987050370 5:14143444-14143466 GCGTGCTGCTGCCCGCGCTCCGG + Intergenic
990101868 5:52201084-52201106 AGGCGCTGCAGCACTAGTTCAGG - Intergenic
990538292 5:56746503-56746525 GGGAGCTGCAGCAGGAGCTCAGG + Intergenic
990779015 5:59337153-59337175 AGTGACTGCTGCAGGAGCTCAGG - Intronic
991399040 5:66234660-66234682 AGGTTCTGCTTCAGGAGGTCTGG + Intergenic
992231394 5:74667631-74667653 AAGTGCTGCTGCAAAGGCTCGGG + Intronic
995525315 5:113046242-113046264 TGGTGCGGCTGCACGACCTTGGG + Intronic
997754796 5:136386406-136386428 AGGTGCTACTGCAGCAGCTGTGG - Intronic
997821475 5:137069994-137070016 AGGTGCTGCTGCAAGACATGGGG - Intronic
998088683 5:139348092-139348114 AAGTGCAGCTGCACGATCTCGGG - Intronic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
1003319083 6:5036472-5036494 ATGTGCTGCTCCAGGAGCTGGGG + Intergenic
1003533100 6:6954112-6954134 AGGTGCTGCTGTTTGAGCTATGG + Intergenic
1006168848 6:32081622-32081644 AGGGGCTGCTCCAGGAACTCAGG + Intronic
1007257023 6:40536615-40536637 AGGTGCAGCTGGAGGAACTCAGG + Intronic
1008968739 6:57341795-57341817 AGGTGCTGCTGCATAAGTTGAGG + Intronic
1009157724 6:60243613-60243635 AGGTGCTGCTGCATAAGTTGAGG + Intergenic
1009385222 6:63079089-63079111 GGGTGCTGCTGCAGGAGGTCTGG + Intergenic
1010883947 6:81214875-81214897 AGCTGCTGCTCCACCAACTCGGG - Intergenic
1012961878 6:105630720-105630742 AGGTGCTTCTTCAGGAGCTTGGG + Intergenic
1015121960 6:129709894-129709916 TACTGCTGCTGCACGAGCTCAGG + Intronic
1017446302 6:154510158-154510180 AAGTGCTGCTGCCTGCGCTCCGG + Exonic
1018990974 6:168673716-168673738 AGGTGCTGTTGCTCAAACTCTGG - Intergenic
1019808945 7:3149992-3150014 AGGGGCAGCTGCAGGAGCTCTGG - Intronic
1020513591 7:9089894-9089916 AGCTGCTGATGCTGGAGCTCTGG - Intergenic
1022481919 7:30749827-30749849 ACGTCCTGCTGCAGGGGCTCTGG + Intronic
1023990490 7:45125617-45125639 AGGAGCGGCTGCAGGAGCTGGGG + Intergenic
1026470661 7:70692295-70692317 AGGGGATGGTGCAGGAGCTCAGG + Intronic
1028697518 7:93732492-93732514 AGGTGCTGATTCACTAGCACTGG + Intronic
1029144372 7:98435263-98435285 AGGTGCAGATGCAAGAGATCCGG - Intergenic
1035198080 7:157239851-157239873 GGGTGCAGCTGCATGAGCTGGGG + Intronic
1035270318 7:157715929-157715951 AGGTACAGCTACACCAGCTCTGG + Intronic
1036915560 8:12800157-12800179 AGCTGCAGCTGCCCAAGCTCTGG - Intergenic
1042648788 8:71016427-71016449 AGGTGCTGCTTCCTGTGCTCTGG + Intergenic
1045501717 8:102748845-102748867 AGGAGCTGCTGCAGGAGTGCAGG + Intergenic
1049237975 8:141522165-141522187 AGGGGCTACAGCACGGGCTCTGG + Intergenic
1049461001 8:142727824-142727846 AGGTGCTGCACGACGCGCTCGGG - Exonic
1049658961 8:143811256-143811278 AGGCGCTGCCGCCCGAGATCGGG - Exonic
1052801641 9:32973577-32973599 AGGGGCAGCTTCAAGAGCTCAGG + Exonic
1052976917 9:34418085-34418107 AGGAGCTGCTGCCCTAGCTGGGG - Intronic
1056269437 9:84932359-84932381 AGGTGAAGCTGAACAAGCTCTGG + Intronic
1059993009 9:119882960-119882982 AGAAGCTCCTGCATGAGCTCAGG - Intergenic
1061052549 9:128204859-128204881 AGGTTCTGCTGCAAAACCTCAGG + Intronic
1061315264 9:129791724-129791746 ACGTGGTCCTGCAAGAGCTCTGG + Intergenic
1185561370 X:1062792-1062814 AGGAGCTGCTCCCTGAGCTCGGG + Intergenic
1185652663 X:1660255-1660277 AGGAGCCGTTGCACGATCTCCGG + Intergenic
1189923132 X:45923228-45923250 AGGTGCTGATGCAGAAGCTGTGG + Intergenic
1198203897 X:134448271-134448293 AGATGCTGCACCAGGAGCTCTGG - Intergenic