ID: 1103722353

View in Genome Browser
Species Human (GRCh38)
Location 12:122981563-122981585
Sequence AGGGAGAAGGTGAGGCTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1457
Summary {0: 1, 1: 1, 2: 10, 3: 157, 4: 1288}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103722353_1103722361 12 Left 1103722353 12:122981563-122981585 CCTTCCAGCCTCACCTTCTCCCT 0: 1
1: 1
2: 10
3: 157
4: 1288
Right 1103722361 12:122981598-122981620 GAAGCAAGCAGAAGGCCCGGAGG 0: 1
1: 1
2: 3
3: 10
4: 218
1103722353_1103722359 4 Left 1103722353 12:122981563-122981585 CCTTCCAGCCTCACCTTCTCCCT 0: 1
1: 1
2: 10
3: 157
4: 1288
Right 1103722359 12:122981590-122981612 CACAGAGAGAAGCAAGCAGAAGG 0: 1
1: 0
2: 2
3: 61
4: 804
1103722353_1103722360 9 Left 1103722353 12:122981563-122981585 CCTTCCAGCCTCACCTTCTCCCT 0: 1
1: 1
2: 10
3: 157
4: 1288
Right 1103722360 12:122981595-122981617 AGAGAAGCAAGCAGAAGGCCCGG 0: 1
1: 1
2: 4
3: 58
4: 754

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103722353 Original CRISPR AGGGAGAAGGTGAGGCTGGA AGG (reversed) Exonic
900389830 1:2429046-2429068 AGGGGGTGGGTGAGGCTGGAGGG + Intronic
900864254 1:5255899-5255921 AGGGAGGAGCAGAGGATGGAGGG + Intergenic
900932844 1:5747664-5747686 AGGGAGGAGGAGAGGGAGGAAGG + Intergenic
900932867 1:5747749-5747771 AGGGAGAAAGGGAGGAGGGAGGG + Intergenic
900979076 1:6035913-6035935 ACTGAGAAGGAGTGGCTGGAGGG + Intronic
900982729 1:6055709-6055731 AGGGTGAAGGTGGGGCGGGGAGG + Intronic
901114886 1:6835405-6835427 AAGGAGAAGCTGAGCCTGGTTGG + Intronic
901180750 1:7340288-7340310 CTGGAGAAGGTAAGACTGGAGGG + Intronic
901227870 1:7624888-7624910 AAGGATAAAGGGAGGCTGGAAGG + Intronic
901419761 1:9143031-9143053 AGGGAGAAGGGAAGGAAGGATGG - Intergenic
901505291 1:9681343-9681365 CTTGAGAGGGTGAGGCTGGAGGG - Intronic
901636318 1:10671894-10671916 CGGGAGCAGGTGTGGCTGGCTGG + Intronic
902040089 1:13486204-13486226 AGACAGAGGGAGAGGCTGGAGGG - Intronic
902130516 1:14256433-14256455 AGGGAGAAAGTGAGGCAGAGGGG + Intergenic
902154131 1:14470003-14470025 AGGGAGTAAGTGAGTCTGGGTGG + Intergenic
902328103 1:15715974-15715996 AGTGACAACTTGAGGCTGGAGGG - Intronic
902407367 1:16191985-16192007 AGGGAGCAGGTGAGGAATGAGGG + Intergenic
902597932 1:17521829-17521851 ATGGTGAAGCTGAGGTTGGAAGG + Intergenic
902693271 1:18123802-18123824 AGGTAAGAAGTGAGGCTGGAGGG + Intronic
902873151 1:19326209-19326231 AGGGGGAAGCTGAGGTTAGATGG - Intronic
902940844 1:19799568-19799590 AGGGGGAAACTGAGGCTGGGCGG - Intronic
903134230 1:21298803-21298825 ATGGAGCAGGTGAGGCAGGGTGG - Intronic
903281977 1:22255293-22255315 AGGGGCAGGGTGAGTCTGGACGG - Intergenic
903377414 1:22875619-22875641 AGGGAGAAAGTGAGGAAGGAAGG - Intronic
903384884 1:22919695-22919717 AGGGAGCAGGAGAGGGAGGAGGG + Intergenic
903486302 1:23691680-23691702 AGGGAGAAGCCGACGCTGCAGGG + Intergenic
904093100 1:27958839-27958861 AGGAAGAAGGTGAGCCTGGCAGG - Exonic
904183180 1:28681430-28681452 AGGGAGAAGATGAGGGAGAAAGG + Intronic
904384248 1:30131300-30131322 GGGGTGAAGGTGTGTCTGGAGGG - Intergenic
904652015 1:32013267-32013289 AGGGAGAAATTGAGGAAGGACGG - Intergenic
904686446 1:32264274-32264296 TAGGAGAATGTGAGGCAGGAAGG - Intronic
904721088 1:32509075-32509097 AGCAATAAGGTGAGGCTGTAAGG + Intronic
904806546 1:33136190-33136212 AGGGAGAAAGGGAGAATGGAGGG - Intergenic
904930916 1:34086881-34086903 AGGGAAAAAGTGAGGCTGGGAGG - Intronic
905106061 1:35564331-35564353 AGGGAGAAGGTGTGCATAGAGGG - Intronic
905267069 1:36761571-36761593 AGGCAGAGTGTGAGGGTGGAAGG - Intergenic
905343768 1:37297445-37297467 AGGGAGAAGGTGTATCTGGGAGG - Intergenic
905416760 1:37808940-37808962 AGGAAAAAAGTGAGGCTGGGAGG - Intronic
905520899 1:38598938-38598960 AGGGAGAGGTGGAGGCAGGAGGG - Intergenic
906108870 1:43310250-43310272 AGGCGGAAGGTGAGGCTTGATGG - Intronic
906285693 1:44586410-44586432 AGGGACAAGGTAAGGATAGAGGG + Intronic
906539162 1:46571952-46571974 CAGGAGATGGTGTGGCTGGAAGG - Intronic
906790196 1:48652478-48652500 GAGGAGGAGGTGAGGCAGGATGG + Intronic
907117176 1:51979138-51979160 AGGAAGAAAGTGAGGTTGGAAGG + Intronic
907190954 1:52648509-52648531 AGGGATAAGGAGAGGAAGGAGGG - Intronic
907456668 1:54580776-54580798 ATGGAGATGGTGAGGCTGCAGGG + Intronic
907827518 1:58033059-58033081 AGGGTGAAGGTGGTTCTGGAGGG - Intronic
907841137 1:58158546-58158568 GGGAAGAAGGTGAGACTCGAAGG + Intronic
907915103 1:58861229-58861251 AGGGAGAAAGCGAGGTAGGAAGG + Intergenic
909292754 1:73904548-73904570 AGGGAGCAGGAGAGGAAGGAGGG + Intergenic
909347803 1:74612749-74612771 AGGAAAAAGGTGAGACTGAAGGG + Exonic
909433984 1:75619107-75619129 AGGAAGAAGGGGAGGGAGGAAGG + Intergenic
909692061 1:78420714-78420736 AGGGAGGAGGGGAGGAAGGAGGG - Intronic
909897740 1:81094085-81094107 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
910593373 1:88951952-88951974 AGGGAAAAAGGGAGGCAGGAGGG + Intronic
911293850 1:96089302-96089324 AGGGAGGTGGGGAGGATGGAAGG - Intergenic
911534393 1:99082762-99082784 AGGGAGGAGGGGAGGAAGGAAGG - Intergenic
911887160 1:103317763-103317785 ATGGGGATGGTGAGGGTGGAAGG + Intergenic
912679671 1:111721126-111721148 AGGCAGACGGTGAGGCAGGCGGG + Intronic
912690003 1:111797750-111797772 AGGTGGGAGATGAGGCTGGAGGG + Intronic
912797533 1:112701908-112701930 TGGGAGGAGGTGGGGCTGCATGG - Intronic
912823703 1:112886975-112886997 AGAGAGATGGTGAGGGTGGTGGG - Intergenic
913169835 1:116222012-116222034 AGGGAGGAAGTGAGGAGGGAAGG + Intergenic
913184754 1:116360094-116360116 AGGGAGGAGGTGGGGCTGTGTGG - Intergenic
914430228 1:147613937-147613959 AGGGAGGAGGGGAGGAAGGAGGG - Intronic
914879075 1:151533918-151533940 AGTGAGAAGGTGAGGGTTGAGGG - Intronic
915107858 1:153545675-153545697 AAGGAGAAGGGGAGGCTGGTGGG - Intronic
915226668 1:154416928-154416950 AGGGATAAGGGGAGGTTTGAGGG - Intronic
915384477 1:155477489-155477511 AGGTAAAAGGTAATGCTGGAAGG - Intronic
915444611 1:155967603-155967625 AGGGAGAAGGCCAGGCTTGGTGG - Intronic
915500709 1:156315051-156315073 TGGTAGAAGGGGAGGCAGGATGG - Intronic
915705371 1:157838783-157838805 AAGCAGAAGGGGAGACTGGAAGG + Intronic
915724922 1:158010707-158010729 AGGGAGGAGGGAAGGGTGGAGGG - Intronic
915994583 1:160550151-160550173 AGGGATAAGGTGGGGGTGAATGG + Intronic
916077355 1:161209587-161209609 AGGGAGAAGGTAAGAGTGGGAGG + Exonic
916521483 1:165567341-165567363 AGGGATATGGGGAGGATGGAGGG + Intergenic
916561217 1:165935337-165935359 AAGCAGGAGGTGAGGCTGGCTGG - Intergenic
916604363 1:166326400-166326422 ATGGGGAAGGTGAGGCTTGAGGG - Intergenic
916832109 1:168503676-168503698 AGGGAGTAGGAAAGACTGGAGGG - Intergenic
917418094 1:174832613-174832635 TGGGAGAAGGGGCTGCTGGAGGG - Intronic
917623899 1:176826486-176826508 TGGGTGAAAGTGAGACTGGATGG + Intronic
917748974 1:178037652-178037674 GGGGAGAAGGGGAGGGTAGAAGG + Intergenic
917896458 1:179493168-179493190 GGTGACAAGATGAGGCTGGAAGG - Intronic
918420204 1:184356608-184356630 AGTGAGAAAGGGAGGATGGAAGG + Intergenic
918469966 1:184861726-184861748 AAGGAGAAGGGGAGGGAGGAAGG + Intronic
919166847 1:193906172-193906194 AGGGAAAAGGAGATGATGGAAGG + Intergenic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919554712 1:199036237-199036259 AGAGAAAAGCTGAGGCTAGAAGG - Intergenic
919766691 1:201132063-201132085 AGGGAGACGGGGAGACAGGAAGG + Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
919829308 1:201529176-201529198 AGGGGGAAAGAGAGGCGGGAGGG - Intergenic
919981420 1:202644574-202644596 AGGGTGAAGGAGAGGCTGAGGGG - Intronic
920029844 1:203030275-203030297 AGGTGTGAGGTGAGGCTGGATGG + Intronic
920070781 1:203301510-203301532 AGGGAGAAGGAGAAGCAGGAAGG + Intergenic
920160838 1:203996665-203996687 TGGGAGAAGGAGAAGCAGGATGG + Intergenic
920183621 1:204147428-204147450 TGGGAGAAGGTGGGGGTGAATGG + Intronic
920210053 1:204321423-204321445 GGGCAGTAGGGGAGGCTGGAAGG - Intronic
920272215 1:204774446-204774468 TGGGAGAAGCACAGGCTGGAGGG - Intergenic
920679327 1:208060515-208060537 AGGGTGGAGGTGAGGGAGGAGGG + Intronic
920839861 1:209545269-209545291 AAGGAGAATGTGAGGCCTGAGGG - Intergenic
921152585 1:212414131-212414153 TGGGAGGAGGTGAGACTGGAGGG + Intronic
921590115 1:216993295-216993317 AGGGAGATGGTGAGGGAGGAGGG - Intronic
922464036 1:225834412-225834434 AGGGAGAAAGGAAGGATGGACGG + Intronic
922544019 1:226441734-226441756 ATGGAGAAGGCGAGGCAGGAAGG + Intergenic
922597341 1:226824127-226824149 AAGGGGAAGGTGAGAGTGGAGGG + Intergenic
922713587 1:227852768-227852790 AGGGAGTCGGTGGTGCTGGAGGG - Intergenic
922723204 1:227909586-227909608 AGGGAGGAGGGGAGGAAGGAGGG + Intergenic
922723323 1:227909896-227909918 AGGAAGAAGGGGAGGAAGGAGGG + Intergenic
922791157 1:228311833-228311855 AGGGAGGAGGAGAGTGTGGAAGG + Intronic
922878562 1:228960946-228960968 AGGGTGCAGATGAGGGTGGAGGG + Intergenic
923100906 1:230816132-230816154 AGAGAGAACTTGAGGCTGCAGGG + Intergenic
923498413 1:234544505-234544527 AGGGAGAGGGGCTGGCTGGAAGG + Intergenic
923554241 1:234988017-234988039 AGAGGAAAGTTGAGGCTGGAGGG - Intergenic
923608178 1:235464436-235464458 AGGGAGAAGGTGGTGAGGGAGGG - Intronic
924064908 1:240210998-240211020 AGGAAGAAGGGGAGGGAGGAAGG - Intronic
924149059 1:241109209-241109231 TGTGAGAAGGTGAGGCAGGCAGG - Intronic
924741110 1:246794598-246794620 CGGGAGAATGAGAGGCTGCATGG - Intergenic
924800354 1:247325267-247325289 AAGGGGAAGCTCAGGCTGGATGG + Intronic
1062928378 10:1335345-1335367 AGGATGAAGGGAAGGCTGGAAGG + Intronic
1063460659 10:6213144-6213166 AGGGACAGGGTGTGGCTGGGGGG + Intronic
1063534202 10:6866992-6867014 AGGGAGGAAGTGAGGAAGGAAGG - Intergenic
1063604092 10:7507909-7507931 AGGCAGAAGGTGCAGGTGGACGG + Intergenic
1063627684 10:7705837-7705859 AAGGAGATTGTGAGGCTGCAAGG - Intronic
1063979869 10:11444612-11444634 AGGGAGTAGGTGAGTTTGGAGGG - Intergenic
1064138995 10:12774428-12774450 AGGGAGCAGGGGAAGCAGGAAGG + Intronic
1064287292 10:14002964-14002986 TGGGAAGAGGTGAGGCTGGAGGG + Intronic
1064309631 10:14200857-14200879 AGGGAGACTGCAAGGCTGGAGGG + Intronic
1064385557 10:14888006-14888028 AGGGAGCATGTGAGGCTGGCGGG + Intronic
1064652081 10:17519589-17519611 AGGGAGAAAGAGAGGAAGGAGGG + Intergenic
1064659372 10:17591114-17591136 ATGGAGAAGAGGAGGCTGGGTGG - Intronic
1064962169 10:20977270-20977292 AGAAAGAAAGTGAGGCTGTAAGG + Intronic
1065267999 10:23997550-23997572 AGGAAGACGCTCAGGCTGGAAGG + Intronic
1065508887 10:26457637-26457659 AGGCTGAAGAGGAGGCTGGAAGG + Intronic
1065618357 10:27551964-27551986 AGTGAGAAGTTGATGATGGAGGG + Intergenic
1065694836 10:28370217-28370239 AGGGAGAAAGAGAGGATGGAAGG + Intergenic
1065768714 10:29056476-29056498 AGGGAGAAAGAGAGACTAGAGGG + Intergenic
1066045277 10:31589273-31589295 TGGGAGAGGGAGAGGCAGGAAGG - Intergenic
1066224451 10:33368629-33368651 AGGGAGCCAGTGTGGCTGGAGGG + Intergenic
1066242370 10:33550826-33550848 AGGGGGAAGGAGGGGCTGGAAGG - Intergenic
1066247084 10:33593896-33593918 TGGGAGAAGGCCAGGGTGGACGG - Intergenic
1066462156 10:35621586-35621608 GGGAAGAACGTGTGGCTGGAGGG + Intergenic
1066473423 10:35721727-35721749 AGGGAGGAAGGGAGGCAGGAGGG - Intergenic
1066482365 10:35809392-35809414 AGGTGGCAGGTGAGGCTGAAGGG - Intergenic
1066596194 10:37052579-37052601 AGGGAGAAAGGGAGGGAGGAGGG + Intergenic
1067273371 10:44811904-44811926 AGAGAAAAGGTTAGGCTGCAAGG - Intergenic
1067455830 10:46418717-46418739 AGGGAGACGGTGATCATGGAGGG - Intergenic
1067631370 10:47965922-47965944 AGGGAGACGGTGATCATGGAGGG + Intergenic
1068934466 10:62622399-62622421 AGGGAAAAGGAGAAGCAGGATGG - Intronic
1069282359 10:66670539-66670561 AGGTAGAAGGGGAGGTTAGAAGG - Intronic
1069319607 10:67152189-67152211 AGGTAGATGATGAGGCTGAAGGG - Intronic
1069926569 10:71854785-71854807 AGGGAGAGGGACAGGGTGGAGGG - Intergenic
1069948049 10:72000909-72000931 AGGGAGGAGGTGATGCAGCATGG + Intronic
1070144181 10:73761699-73761721 AGTGAGAAGGAGAGTCTGGTTGG + Intronic
1070144198 10:73761820-73761842 AGGGAGGGGCTGAGGCTGAATGG - Intronic
1070182258 10:74025657-74025679 AGGGAGAAAGGGAGGCAGGGAGG + Intronic
1070339217 10:75481246-75481268 AGGGTGAATGTGAGGATTGAAGG + Intronic
1070643717 10:78186962-78186984 AGGGAGATGGTCAGCCTGCAAGG - Intergenic
1070743644 10:78919381-78919403 AGGGAGTAAGTGGGGATGGAAGG + Intergenic
1070803930 10:79259449-79259471 AGGGTGAGGGTGAGTCTGCATGG - Intronic
1070826155 10:79391649-79391671 AGGGAGCAGGGGAGGAGGGAAGG - Intronic
1070906552 10:80078580-80078602 AGGGAGAAGATGGTGCTGGTTGG - Intergenic
1071270643 10:84003817-84003839 ATGGGGAAGGTGAGGAAGGAGGG - Intergenic
1071471549 10:85987373-85987395 AGGGGGAAGGTAAGGCTTGGAGG - Intronic
1071499435 10:86193050-86193072 TAGGAGATGCTGAGGCTGGATGG - Intronic
1072009083 10:91287870-91287892 AGGGAAAAGGAGAGGCTGGCTGG - Intergenic
1072287130 10:93926993-93927015 AGGGAGAAGGACTGGCAGGAAGG - Intronic
1072659868 10:97357176-97357198 AGGAAGAAGATGAAGCTGCAGGG - Exonic
1072801050 10:98392710-98392732 ATGGAGAAGCTGAGGCTTCATGG - Intronic
1073045906 10:100638032-100638054 GGGGACAATGTGAGGCAGGAGGG + Intergenic
1073290863 10:102412623-102412645 AGGCAGAAGGAGGGTCTGGATGG - Intronic
1073398609 10:103238876-103238898 AAGGAGAGAGTGAGGATGGAGGG + Intergenic
1073568439 10:104555576-104555598 AGGGAGAAGGAGAGAAGGGATGG + Intergenic
1073583221 10:104686161-104686183 TGGGAGAAGGTCAGGTTGGAGGG + Intronic
1073709636 10:106022070-106022092 AGGGAGGAATGGAGGCTGGAAGG + Intergenic
1073959590 10:108911658-108911680 AGAGGGAAGATGGGGCTGGATGG - Intergenic
1074147438 10:110729357-110729379 GGTGAGAAGGAGAGGCAGGAAGG - Intronic
1074370251 10:112894928-112894950 AGAAAGAGGGTGAGGCAGGAAGG + Intergenic
1074419928 10:113299745-113299767 AGGAGGAAGGTGAGGGAGGAAGG + Intergenic
1074610501 10:115016813-115016835 GAGGAGAAGGAGAGTCTGGAGGG + Intergenic
1074753996 10:116611006-116611028 AGGGAGGGGGTGTGGCTGGTTGG + Intergenic
1074780412 10:116798195-116798217 AGGGAGCAGGGGTGGCAGGAGGG + Intergenic
1074809853 10:117092803-117092825 AGGGAGAGACTGAGGCTGAAGGG + Intronic
1074827975 10:117228417-117228439 AGGGAGGAAGTGAGGAAGGAAGG - Intergenic
1074892993 10:117750714-117750736 TGGGACTGGGTGAGGCTGGAGGG + Intergenic
1075065674 10:119287410-119287432 AGGGAGAAGGTAAGGAGGGAGGG + Intronic
1075151246 10:119934724-119934746 AGGTAGAAGATGAGGCTGAAGGG - Intronic
1075166052 10:120069420-120069442 AGACTGGAGGTGAGGCTGGAGGG + Intergenic
1075198351 10:120380226-120380248 AGGGAGGAGCTAAAGCTGGAGGG + Intergenic
1075221435 10:120588354-120588376 GGGGAGCAGGTGAGGCAGGGGGG - Intronic
1075265486 10:120997137-120997159 AGGGAGAAGGTCAGGCTTGTGGG - Intergenic
1075401593 10:122164776-122164798 TGGGGGCAGGTGAGGCTGGGAGG - Intronic
1075541608 10:123318582-123318604 AGGGAGCAGGTGTGGGTGGGAGG + Intergenic
1075650918 10:124128076-124128098 AGGGACCAGGGGAGGCTGCAGGG - Intergenic
1075672175 10:124270303-124270325 TTGGGGAAGGTGAGGCTGGAGGG - Intergenic
1075715068 10:124551165-124551187 AGGGAGGAGGCGAGGCTGGGGGG - Intronic
1075717617 10:124566148-124566170 CTGGAGAAGGTGATGCTGGGAGG - Intronic
1076128120 10:127992150-127992172 GGTGAGAAAGGGAGGCTGGAGGG + Intronic
1076166435 10:128286374-128286396 CGGAAGAGGGTGTGGCTGGATGG - Intergenic
1076204723 10:128587904-128587926 AGTGGGAAGCTCAGGCTGGATGG + Intergenic
1076215092 10:128686994-128687016 AGGGAGAAGGCAGGACTGGATGG + Intergenic
1076237829 10:128879536-128879558 AAGAGGAAGGTGAGGCTGGAAGG + Intergenic
1076587847 10:131561356-131561378 AAGGAGCAGGAGAGGCTGGCAGG - Intergenic
1076668219 10:132104794-132104816 TTGGACATGGTGAGGCTGGATGG - Exonic
1076713240 10:132350584-132350606 ACGGGGAAGATGAGGGTGGAAGG + Intronic
1077101338 11:823877-823899 GGGGAGGAGGGGAGGCAGGAGGG + Intronic
1077142444 11:1030537-1030559 AGGGAGAGGGAGGGGCAGGAAGG - Intronic
1077308912 11:1879927-1879949 ATGGACAAGGTGAGGCCTGAGGG + Intronic
1077376024 11:2205458-2205480 TGGGAGGTGGGGAGGCTGGAAGG - Intergenic
1077376059 11:2205553-2205575 AGGGAGGTGGAGAGGCTGGGAGG - Intergenic
1077376121 11:2205744-2205766 AGGGAGGTGGGGAGGCTGGGAGG - Intergenic
1077376136 11:2205784-2205806 AGGGAGGTGGGGAGGCTGGGAGG - Intergenic
1077376153 11:2205832-2205854 AGGGAGGTGGGGAGGCTGGGAGG - Intergenic
1077376187 11:2205943-2205965 AGGGAGGTGGGGAGGCTGAAAGG - Intergenic
1077376195 11:2205967-2205989 AGGGAGATGGGGAGGCTGGGAGG - Intergenic
1077376217 11:2206031-2206053 AGGGAGATGGGGAGGCTGGGAGG - Intergenic
1077376249 11:2206119-2206141 AGGGAGGTGGGGAGGCTGGAAGG - Intergenic
1077376935 11:2209551-2209573 AGGGAGGAGGGCAGGCAGGAGGG - Intergenic
1077417838 11:2433099-2433121 AGGCAAAAGGTGATGCTGCAAGG - Intergenic
1077478201 11:2800890-2800912 GAGGAGAAGGTGTGGCTGGCAGG + Intronic
1077523245 11:3048808-3048830 AGGGGCCAGGTGAGGCTGGCTGG - Intronic
1077907421 11:6545224-6545246 GGGGAGGAGGTGAAGCTGCAGGG + Exonic
1078151616 11:8764475-8764497 ATGAAGAAGCTGAGGCTGAAAGG + Intronic
1078605750 11:12774066-12774088 AGTGACAGGGTGAAGCTGGAGGG + Intronic
1078706098 11:13745633-13745655 AGAGAAAAGGGGAGACTGGAGGG + Intergenic
1078731003 11:13974001-13974023 AGTGAGCAGGTGAGGATGGTGGG - Intronic
1078855602 11:15204479-15204501 AGGGAGGGGGTGTGGGTGGAGGG - Intronic
1079340220 11:19605600-19605622 AGGGAGCATGTGAGGATGGAAGG + Intronic
1079452514 11:20609614-20609636 AGAGAGAAGGTGAGACTGGAAGG - Intronic
1079761591 11:24336001-24336023 AGGGAGGGGGTGAGGGAGGAAGG - Intergenic
1080198068 11:29634945-29634967 AGGAAGAAGGTATGACTGGAGGG + Intergenic
1080605558 11:33862135-33862157 AGGCAGCAGGGGAGGCTGGAGGG + Intronic
1081678569 11:44985881-44985903 AGGGAGAACTTGGGGCTGGAGGG + Intergenic
1082772543 11:57219616-57219638 TGACAGGAGGTGAGGCTGGAGGG - Intergenic
1082809178 11:57468197-57468219 ATGGAGATGCTGAGGCAGGAAGG - Intronic
1083187123 11:61024236-61024258 AGGGAGAAAGGGAGGGAGGAGGG - Intergenic
1083258970 11:61513037-61513059 AGGGGGCAGGGGAGACTGGAAGG + Intergenic
1083539645 11:63503655-63503677 AGGAAGGAAGTGAGGCTGGATGG + Intergenic
1083599701 11:63939200-63939222 AGGGGTCACGTGAGGCTGGAGGG - Intronic
1083731655 11:64655552-64655574 AGAAAAAAGGGGAGGCTGGATGG + Intronic
1083790566 11:64982653-64982675 AGGGGGCTGGTGTGGCTGGAGGG - Intergenic
1083821250 11:65172597-65172619 TGTGAGGAGGTGAGGCTGGGAGG + Exonic
1083864289 11:65445399-65445421 AGGTAGGAGGTGAGCCTGGGAGG + Intergenic
1083902867 11:65652180-65652202 AGGGAAAAGGAGAGGCAGGCTGG + Intergenic
1083970511 11:66071016-66071038 AGGCAGAAGGTGGGGCTGCCAGG - Intronic
1084032506 11:66489214-66489236 GGGGACAAGGAGAGGCTGGAGGG - Intronic
1084515430 11:69635785-69635807 AGTGAGAAGATGAGGATGGGTGG + Intergenic
1084735686 11:71103845-71103867 AGGGAGAAGGGGAGGGGGGGAGG - Intronic
1084964351 11:72736664-72736686 AGAGAGAAGGAGAGGCAGGATGG - Intronic
1085051088 11:73380614-73380636 AGGCAGGAGGTGAGGGTCGAGGG + Intronic
1085286337 11:75364091-75364113 AGGGATATGATGGGGCTGGATGG - Intergenic
1085445797 11:76599775-76599797 GGGGAGCAAGTGAGGCAGGAAGG + Intergenic
1085531617 11:77195238-77195260 AGGGAGAGGCAGAGGCTGGCGGG - Intronic
1085632688 11:78132383-78132405 AGGCAGAAGGAGAGTCAGGAAGG - Intronic
1085988966 11:81816929-81816951 AGGAAGAAGGGGAGGAAGGAGGG - Intergenic
1086100448 11:83093912-83093934 ATGCAGAACGTGAGGCTAGATGG - Intergenic
1086129605 11:83387094-83387116 AGGGTGAAGGAGAGGGTGGAAGG - Intergenic
1088287398 11:108202688-108202710 AGGGAGAAGATGTTGCTTGAGGG - Intronic
1088584944 11:111353920-111353942 AGGGAGAAGGGAAGGAGGGAAGG + Exonic
1088584963 11:111353977-111353999 AGGGAGAAGGGAAGGAGGGAAGG + Exonic
1088727956 11:112656225-112656247 AGGGAGGAGCTGAGCCCGGAAGG - Intergenic
1088847660 11:113681682-113681704 AGGGCGAAGGTGAGGCTGGGAGG - Intergenic
1088919500 11:114250974-114250996 AGGGAGGAGGTGAGCCAGAAGGG + Intergenic
1089127070 11:116184058-116184080 ATGGAGAAAGTGAGGCTGAAGGG - Intergenic
1089170243 11:116506602-116506624 AGGGAGAGGGTGGGGGTGGATGG + Intergenic
1089184596 11:116606305-116606327 AGAGAGACAGTGGGGCTGGATGG - Intergenic
1089255248 11:117190573-117190595 AGGGAGGAAGTGAGGCAGGAAGG - Intronic
1089295192 11:117463157-117463179 AGGCACAAGGTGAAGCAGGAAGG + Intronic
1089459037 11:118642058-118642080 AGGAAGAAGGGGAGGAAGGAAGG - Intronic
1090943944 11:131413084-131413106 AGGGAAGAGTTGAGGCAGGAAGG - Intronic
1091038115 11:132252093-132252115 AGGGAAAAGGAGAGGTAGGAGGG - Intronic
1091114740 11:133002714-133002736 AGGGAGAAAGAGAGGAGGGAAGG + Intronic
1091155555 11:133368278-133368300 AGGGAGAGGGAGAGGAGGGAAGG + Intronic
1091268289 11:134287800-134287822 GGGCAGAGGGTGAGGCGGGAAGG + Intronic
1091391578 12:129406-129428 AGGGAGAACAGGAAGCTGGAGGG - Intronic
1091745848 12:2992443-2992465 AGGGAGGGGGTGAGGATCGAGGG - Intronic
1092088708 12:5786511-5786533 AGTGAGAGGATGAGCCTGGATGG + Intronic
1092124430 12:6065580-6065602 AGGGAGGAGGGGAGGCTGCAGGG - Intronic
1092739463 12:11614146-11614168 AAGGAGAAATTGAGGGTGGAAGG + Intergenic
1092778613 12:11965178-11965200 AGGGAGAAAGTGAGGAAGGAAGG - Intergenic
1092908421 12:13123544-13123566 AGGAAGGCGGTGAGGCTGAAGGG - Intronic
1094047113 12:26179276-26179298 CAGGAGAAGGTGAGGGCGGAGGG + Intronic
1094415642 12:30212200-30212222 GGGGAGAGGGTGAGGAGGGAGGG + Intergenic
1094772749 12:33684479-33684501 AGGGAGAAGGGGAAGGGGGAGGG - Intergenic
1095097434 12:38155961-38155983 AGGGAGAGGTTGAGGCAGCATGG + Intergenic
1095281537 12:40357066-40357088 TGGGAGAAGGGGAGGATGAAGGG - Intronic
1095797330 12:46234304-46234326 AGGGAGTAGCTTAAGCTGGAGGG + Intronic
1096447460 12:51706471-51706493 AGGAAGAAGGTGAAGAAGGAGGG + Exonic
1096556832 12:52409023-52409045 AGGGAGAGGGAGAGGGAGGAGGG - Intergenic
1096614001 12:52821502-52821524 AGGGAGAGGGTGGGTCTGGTGGG + Exonic
1096618535 12:52848204-52848226 AGGGGAAAGGTGAGGCTGATGGG - Intronic
1096743290 12:53709996-53710018 AGGGAGAGGGAGAGGGGGGAAGG + Intronic
1097182439 12:57179046-57179068 AGTGAGCAACTGAGGCTGGAGGG + Intronic
1097221879 12:57455881-57455903 AGGCAGAAGGGGAGCCTGGCAGG + Intronic
1097915289 12:65014518-65014540 AAGGAGACTGTGGGGCTGGAGGG + Intergenic
1097923203 12:65099481-65099503 GGGGAGAAGGGGAGCCTGGTAGG - Intronic
1098576029 12:72043313-72043335 AGGGAGAAGGAAAGAATGGATGG - Intronic
1098923656 12:76326264-76326286 AGGAACAAGGCAAGGCTGGACGG - Intergenic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099868068 12:88309507-88309529 AGGGAGAAAGTAAGGGAGGAAGG - Intergenic
1100405655 12:94270900-94270922 AGTGAAGAGGGGAGGCTGGATGG + Intronic
1100641432 12:96485300-96485322 AGGCAGAAGATGAGGCAGAAAGG - Intergenic
1101600460 12:106205283-106205305 AGTGAGAAAGTGAGAATGGAAGG + Intergenic
1102002420 12:109565785-109565807 CTGGAGGAGGTGATGCTGGAGGG + Intronic
1102236307 12:111296636-111296658 AGGGAGGAGGTGTGTCTGGGAGG - Intronic
1102448176 12:113019807-113019829 AGGGAGGAAGTGGGGCTGGGAGG - Intergenic
1102490449 12:113287121-113287143 AGGGAGAAAGAGAGGGAGGACGG + Intronic
1102556385 12:113729472-113729494 ATGGTGAAGGTGAGGGTGGATGG + Intergenic
1102598741 12:114012875-114012897 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1102819579 12:115896255-115896277 AGGGAGTGGGCCAGGCTGGATGG - Intergenic
1103205778 12:119127764-119127786 AGGGAGAAGGAGAAGGTAGAAGG + Intronic
1103208431 12:119148933-119148955 AGGGAGCTGGTGAGGTGGGAGGG + Intronic
1103222482 12:119257381-119257403 AGGGAGAAGGGGAGGGAAGAAGG + Intergenic
1103244699 12:119446599-119446621 AGGGAGAGGGAGAGGGAGGACGG + Intronic
1103366831 12:120389765-120389787 AGGGAGGAGGGGAGGAAGGAAGG + Intergenic
1103686988 12:122739963-122739985 TGGGAGAAGTTAAGACTGGAGGG + Intergenic
1103722353 12:122981563-122981585 AGGGAGAAGGTGAGGCTGGAAGG - Exonic
1103938356 12:124488609-124488631 AGGGAGAAGACGGGGCTGGAGGG + Intronic
1104169162 12:126263122-126263144 AGGGATAAGAAGAGGCTGGCAGG - Intergenic
1104213327 12:126711519-126711541 AGGGAGAAGGGAGGGATGGAGGG + Intergenic
1104222277 12:126796582-126796604 AAGGAGAAAGGGAGGTTGGAAGG - Intergenic
1104258994 12:127165790-127165812 AGGAAGCAGCTGAGCCTGGAGGG + Intergenic
1104576026 12:129966532-129966554 AGGGAGCAGGGAAGGCAGGAAGG + Intergenic
1104710853 12:130984840-130984862 AGGGAGCAAGGGAGGATGGAAGG - Intronic
1104740473 12:131168467-131168489 AGAGAGCAGGAGGGGCTGGATGG + Intergenic
1105785994 13:23749902-23749924 AGGCACAAAATGAGGCTGGAAGG - Intronic
1105927702 13:25022033-25022055 ATGGGGAAGATGGGGCTGGATGG - Intergenic
1105992460 13:25636114-25636136 AGGTAGAAGGTGAAACTGGCAGG + Intronic
1106186196 13:27412087-27412109 AGGGTGGGGGTGAGGATGGAGGG + Intergenic
1106224458 13:27774586-27774608 TGGGAAGAGGTGGGGCTGGAGGG - Intergenic
1106456163 13:29929206-29929228 AGGGAGGAAGGGAGCCTGGACGG + Intergenic
1106584984 13:31049040-31049062 AGGGAGAAGGGATGTCTGGAGGG + Intergenic
1106793188 13:33177721-33177743 AGGGAGAAAGGGAGGGAGGAAGG + Intronic
1106840859 13:33683665-33683687 GGGGAGAAGGTGAGGGAGGTGGG + Intergenic
1106843548 13:33712293-33712315 GGTTAGAAGTTGAGGCTGGAGGG - Intergenic
1107318540 13:39160809-39160831 AGGGAGAAAGAGAGGTAGGAAGG + Intergenic
1107479720 13:40776007-40776029 AAGGAGAAAATGAGGCTGGATGG + Intergenic
1108206459 13:48095032-48095054 AAGGAGAAGGAGCGGCTGGGAGG - Exonic
1108495869 13:51024918-51024940 AGGCAGAATGTGAAGCTGGGTGG + Intergenic
1108622669 13:52199584-52199606 AAGGAGAGAATGAGGCTGGATGG + Intergenic
1108664049 13:52611359-52611381 AAGGAGAGAATGAGGCTGGATGG - Intergenic
1108944147 13:56000494-56000516 AGGGAGATGAGGAGGCTGCAGGG - Intergenic
1110418591 13:75279206-75279228 AAGTAGAAGGTGGGGCTGAATGG - Intergenic
1112440110 13:99418853-99418875 AGGGGGGCTGTGAGGCTGGATGG + Intergenic
1113539009 13:111092394-111092416 AGGGGGCAGGTGGGGCTGGAGGG - Intergenic
1113680143 13:112238230-112238252 TGGCAGAAGGTGAAGCAGGAGGG + Intergenic
1113759971 13:112840361-112840383 ATGGGGAGGCTGAGGCTGGAAGG - Intronic
1113759988 13:112840424-112840446 ATGGGGAGGCTGAGGCTGGAGGG - Intronic
1113812829 13:113152965-113152987 AGGGAGACAGCGGGGCTGGATGG + Intergenic
1113829765 13:113286395-113286417 AGGGAGAATGGAAGGCTCGAGGG + Intergenic
1114854764 14:26424833-26424855 AGGGAGAAGGGAAGGAAGGAAGG - Intergenic
1115760963 14:36579561-36579583 AGGAAGAAGGGGAGGATGAAGGG - Intergenic
1116383024 14:44296157-44296179 TGGGAGAAGGTGAAGGTGGGTGG + Intergenic
1116423716 14:44764362-44764384 AGTGAGAAGTTCAGACTGGAAGG + Intergenic
1117152494 14:52903820-52903842 AGAGAGAAGATGATGCTGAAGGG + Intronic
1117772048 14:59143315-59143337 GGGGAGGAGGTGAGGGTGGCGGG - Intergenic
1118171774 14:63395704-63395726 AGGGGGGAGGAGAGGGTGGAAGG + Intronic
1118796954 14:69152703-69152725 AGCGAGAGGGGGAGGCTGGGAGG + Intronic
1118994351 14:70822740-70822762 AGGGAGGAGGGGAGGAAGGAAGG - Intergenic
1118998783 14:70862089-70862111 AGGGAGAAAGGGAGGGAGGAAGG + Intergenic
1119141260 14:72269380-72269402 AGGGAGAAAGTGAGAAAGGAAGG - Intronic
1119621745 14:76136799-76136821 AGGGGGAAGGAGAGGAAGGAAGG - Intergenic
1119657172 14:76425504-76425526 AGGAAGGAGGTGAGGAGGGAGGG - Intronic
1119676892 14:76562540-76562562 AGGAAGAAGGAGAGCCAGGAGGG + Intergenic
1119696098 14:76714524-76714546 AGGGAGAAGGACAGGATGGGAGG - Intergenic
1119851174 14:77867680-77867702 AGGGAGAAGGTCGGGCCAGATGG - Intronic
1119931456 14:78551663-78551685 GGGGAGGAGGTGAGGAGGGAGGG - Intronic
1120224637 14:81776855-81776877 AGGGAGAAAGGGAGGAAGGAAGG - Intergenic
1120346479 14:83296692-83296714 AGGAAGGAAGTCAGGCTGGAAGG + Intergenic
1121281679 14:92703534-92703556 GGGGAGAAGGTGAGGAAGGCTGG + Intergenic
1121373949 14:93388364-93388386 AGGGAGAAAGAGAGGAAGGAAGG - Intronic
1121427516 14:93863097-93863119 AGGGAGCAGGTGTGGATGGTAGG + Intergenic
1121432938 14:93900212-93900234 TGGACGGAGGTGAGGCTGGAGGG + Intergenic
1121843619 14:97154860-97154882 TGGCAGGAGGTGGGGCTGGAAGG + Intergenic
1122002068 14:98666966-98666988 AGGGAGAAAGGGAGGGAGGAAGG - Intergenic
1122098253 14:99386986-99387008 ATGGACAAGGGGAGACTGGAAGG + Intergenic
1122272144 14:100573165-100573187 AGGGAGCAGGTGAGTCTGGGGGG + Intronic
1122448835 14:101787370-101787392 AGGGAGGAAGGGAGGCTGGGTGG + Intronic
1122822227 14:104353382-104353404 AGGGAGACAGTGGGGCAGGAGGG + Intergenic
1123054160 14:105561334-105561356 AGGGACAAGCCGGGGCTGGACGG - Intergenic
1123061259 14:105595626-105595648 GGGGAGAAGGTGAGGAGCGACGG - Intergenic
1123078743 14:105681751-105681773 AGGGACAAGCCGGGGCTGGACGG - Intergenic
1123085713 14:105716537-105716559 GGGGAGAAGGTGAGGAGCGACGG - Intergenic
1202904417 14_GL000194v1_random:60079-60101 AGAGAGGAGGTGAAGGTGGAAGG - Intergenic
1123917712 15:25049035-25049057 AGGGAGAAAGGGAGGGAGGAAGG - Intergenic
1124033946 15:26036232-26036254 AGGTAGAAAGGGAGGCAGGAAGG + Intergenic
1124153115 15:27200016-27200038 AGGGAGAAAGTAAGGGAGGAAGG - Intronic
1124497111 15:30193309-30193331 AGGGTGAAGGAGAGGCTGAGGGG - Intergenic
1124746465 15:32345338-32345360 AGGGTGAAGGAGAGGCTGAGGGG + Intergenic
1124791573 15:32731892-32731914 AGTGAGAAAGGGAGGGTGGAGGG + Exonic
1124827035 15:33107515-33107537 AGCAAGAAGGTGAGGGTGGCTGG - Intronic
1125087872 15:35752330-35752352 AGGGAGAAGGAGAGGGAGAAAGG - Intergenic
1125423263 15:39525686-39525708 AGGAAGGAGGGGAGGATGGAGGG + Intergenic
1125458105 15:39881074-39881096 AGGTGAAAAGTGAGGCTGGAGGG - Intronic
1125663469 15:41412653-41412675 AAGGAGGAGAGGAGGCTGGATGG - Intronic
1126114852 15:45199188-45199210 GGGGAGTATGAGAGGCTGGAAGG - Intronic
1126349041 15:47725544-47725566 AGGGGGAAGGTGAGGGAGGTGGG - Intronic
1126783126 15:52155290-52155312 AGGGAGCTGCTGAGGCTTGACGG + Intronic
1126960956 15:53993532-53993554 TGAGAGAAGGTGAGGATGGGAGG + Intergenic
1127332273 15:57950828-57950850 AGGGAGAGAGGGAGGGTGGAAGG + Intergenic
1127346926 15:58110324-58110346 ATGGAGAAGGTGAGGGTAGAAGG + Intronic
1127455912 15:59155859-59155881 GGGGGGAAGGTGGGGGTGGATGG + Intronic
1127560581 15:60132515-60132537 AGGGAGAAGGAAAGGAGGGAGGG + Intergenic
1127560601 15:60132584-60132606 AGGGAGAAGGAAAGGAGGGAGGG + Intergenic
1127762239 15:62150584-62150606 AAGGATCAGGTGAGGCTGGTTGG - Intergenic
1128154750 15:65385370-65385392 GGGGAGAGGGTGAGGGAGGACGG + Intronic
1128526776 15:68417674-68417696 AGGAAGACGGTGAAGCTGGAAGG - Intronic
1128607907 15:69051049-69051071 AGGGAGGAGGGGAGGCAGGGAGG - Intronic
1128695127 15:69755987-69756009 AGAGTAAAGGTGAGACTGGATGG + Intergenic
1128954122 15:71921463-71921485 CGGGAGAAGGAGTGGGTGGAAGG - Intronic
1129242059 15:74257666-74257688 GGAGAGAAGGTGAGGCTTGAGGG - Intronic
1129290970 15:74567310-74567332 AGGTAGAAGAAAAGGCTGGATGG - Intronic
1129515336 15:76153759-76153781 GGGGAGTAGGTGAGGCCGGAAGG + Intronic
1130632320 15:85581537-85581559 TGGGAGAAAGGGAAGCTGGAGGG + Exonic
1130721263 15:86387548-86387570 AGAGAGAGGGTGGGGCTTGAAGG + Intronic
1130990116 15:88871122-88871144 TGGGAGAGGGTGAGGGGGGAGGG + Intronic
1131289907 15:91098741-91098763 GGGGAAAAGATGAGGGTGGAGGG + Intergenic
1131313086 15:91308276-91308298 AGGAAGGAGGTGAGGATGGAGGG + Intergenic
1131540193 15:93269249-93269271 AGGGAGCAGGAGAGACGGGAGGG + Intergenic
1131612863 15:93983375-93983397 AGTGAAAAGGAGAGGCTGAAGGG - Intergenic
1132045144 15:98557497-98557519 AGGGAGTAGCTGAGGCTGGGAGG + Intergenic
1132153789 15:99480904-99480926 AGGGAGAAGGGGCTGCTGGAAGG - Intergenic
1132346897 15:101114015-101114037 AGGGAGAAGGAGAGCATGGGAGG - Intergenic
1132410337 15:101573079-101573101 AGGGAAAAGATGAGACTTGATGG + Intergenic
1132611229 16:817248-817270 AGCGAGAAGGGGAGGGTGGCTGG + Intergenic
1132782813 16:1637424-1637446 AGGGCACAGGTGAGGCAGGAAGG + Intronic
1132981464 16:2740438-2740460 GTGAGGAAGGTGAGGCTGGAGGG - Intergenic
1133321895 16:4919210-4919232 AATGAGCAGGTGGGGCTGGATGG - Intronic
1133415854 16:5606460-5606482 AGAGAGAAGGTGAGGAAGGAAGG - Intergenic
1133485462 16:6214862-6214884 AGGGAGAAGGCGAGGGGAGAAGG + Intronic
1133839415 16:9394476-9394498 AGGGAGAAAGGGAGGGAGGAAGG - Intergenic
1133839458 16:9394616-9394638 AAGGAGGAAGTGAGGGTGGAAGG - Intergenic
1133867068 16:9654255-9654277 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1134093494 16:11403956-11403978 AGGGATGAGGCGAGGCAGGAGGG - Intronic
1134165703 16:11927624-11927646 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1134398354 16:13886218-13886240 ATGAAGAAGCTGAGGCTTGATGG + Intergenic
1134495031 16:14726185-14726207 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1134500415 16:14765305-14765327 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1134526955 16:14951917-14951939 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1134545448 16:15104433-15104455 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1134545461 16:15104504-15104526 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1134580165 16:15363745-15363767 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1134714543 16:16350451-16350473 AGGGTGGAGCTGAGGGTGGAAGG - Intergenic
1134722418 16:16393815-16393837 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1134945009 16:18318054-18318076 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1134952273 16:18358207-18358229 AGGGTGGAGCTGAGGGTGGAAGG + Intergenic
1135242911 16:20825390-20825412 AGGGAGAAGCCGAGGCTGATAGG - Intronic
1135310704 16:21402736-21402758 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135310725 16:21402862-21402884 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135310747 16:21402988-21403010 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310769 16:21403114-21403136 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310791 16:21403240-21403262 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310837 16:21403505-21403527 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310858 16:21403631-21403653 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310880 16:21403757-21403779 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310901 16:21403883-21403905 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310918 16:21404009-21404031 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310935 16:21404113-21404135 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310958 16:21404240-21404262 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135310998 16:21404479-21404501 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135311021 16:21404603-21404625 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135311043 16:21404729-21404751 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363652 16:21835170-21835192 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363674 16:21835296-21835318 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363696 16:21835422-21835444 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363718 16:21835548-21835570 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1135363740 16:21835674-21835696 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363762 16:21835800-21835822 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363807 16:21836065-21836087 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363829 16:21836191-21836213 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363851 16:21836317-21836339 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363868 16:21836443-21836465 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363885 16:21836550-21836572 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363907 16:21836676-21836698 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363929 16:21836802-21836824 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363951 16:21836928-21836950 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363972 16:21837054-21837076 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135363994 16:21837180-21837202 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1135447847 16:22534168-22534190 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135447869 16:22534294-22534316 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135447890 16:22534420-22534442 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135447930 16:22534660-22534682 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135447947 16:22534764-22534786 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135447964 16:22534890-22534912 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135447986 16:22535016-22535038 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135448007 16:22535142-22535164 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135448029 16:22535268-22535290 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135448050 16:22535394-22535416 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135448096 16:22535659-22535681 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135448118 16:22535785-22535807 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135448140 16:22535911-22535933 AGGGTGGAGCTGAGGGTGGAAGG - Exonic
1135645343 16:24156801-24156823 AGGGAGAAGGTAAGGGAGTAGGG - Intronic
1135849900 16:25953737-25953759 AGTGAGAAAGTGAGGCAGGAAGG + Intronic
1135899266 16:26441767-26441789 AGGGAGAGGGACAGGCTGCAAGG - Intergenic
1135965312 16:27030391-27030413 AGGCAGAAGCAGGGGCTGGAAGG + Intergenic
1136093722 16:27938706-27938728 AGTAAGAAGGTGAGGATGGATGG + Intronic
1136268018 16:29132148-29132170 AGGGAGAGAGGGAGGATGGAGGG + Intergenic
1136307450 16:29381937-29381959 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307472 16:29382063-29382085 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307494 16:29382189-29382211 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307517 16:29382328-29382350 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307539 16:29382454-29382476 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307561 16:29382580-29382602 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307583 16:29382706-29382728 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307605 16:29382832-29382854 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307627 16:29382958-29382980 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307645 16:29383084-29383106 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307663 16:29383209-29383231 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307684 16:29383335-29383357 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307705 16:29383461-29383483 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307726 16:29383587-29383609 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307747 16:29383713-29383735 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307767 16:29383839-29383861 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136307791 16:29383977-29383999 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136320974 16:29484141-29484163 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1136320995 16:29484267-29484289 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1136321017 16:29484393-29484415 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1136321042 16:29484532-29484554 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1136321064 16:29484658-29484680 AGGGTGGAGCTGAGGGTGGAAGG + Intronic
1136321086 16:29484784-29484806 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136321108 16:29484910-29484932 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136321140 16:29485143-29485165 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136321162 16:29485269-29485291 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136321186 16:29485407-29485429 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435547 16:30223481-30223503 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435568 16:30223607-30223629 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435590 16:30223733-30223755 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435612 16:30223859-30223881 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435634 16:30223985-30224007 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435654 16:30224111-30224133 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435679 16:30224250-30224272 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435701 16:30224376-30224398 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435723 16:30224502-30224524 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435755 16:30224735-30224757 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435777 16:30224861-30224883 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435799 16:30224987-30225009 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435821 16:30225113-30225135 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435843 16:30225239-30225261 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136435867 16:30225377-30225399 AGGGTGGAGCTGAGGGTGGAAGG + Exonic
1136532114 16:30876697-30876719 AGAGAGAAGGGGAGGGTGGAGGG + Intronic
1136654714 16:31702978-31703000 AGGGAGAAGGTGCAGCTTGCAGG + Intergenic
1137218675 16:46426530-46426552 AGGGAGAAAGGGAGGGAGGAGGG - Intergenic
1137554196 16:49460475-49460497 ATGGAGAAGGGGAGGTTTGAGGG + Intergenic
1137721590 16:50630609-50630631 TGGAAGGAGGTGAGGCTGGAGGG + Intronic
1137721600 16:50630640-50630662 GGGGAGGAGGTGAGGCTAGATGG + Intronic
1137955427 16:52824530-52824552 AGGGGGAAGGTGAGGGAGGGAGG - Intergenic
1138158976 16:54735643-54735665 AGGGACAAGGTGTGGCTGATGGG - Intergenic
1138247933 16:55480695-55480717 AGGTTGAGGGGGAGGCTGGAGGG - Intronic
1138656183 16:58492877-58492899 AGGGAAAGGATGGGGCTGGAGGG - Intronic
1139310593 16:66024904-66024926 AGGGAGAAGGCACGGATGGATGG - Intergenic
1139392332 16:66612766-66612788 AGGCAGAACCTGAGGCTGTAGGG - Exonic
1139519767 16:67474422-67474444 CAGAAGAAGGTGAGGCTAGAAGG - Intronic
1139665707 16:68454016-68454038 AAGAGGAAGGTGAGCCTGGATGG + Intergenic
1140027236 16:71301732-71301754 ATGGAGAAGAGGAGGCTGGTAGG + Intergenic
1140115677 16:72039413-72039435 TTGGAGAAGCTGCGGCTGGAGGG + Intergenic
1140137676 16:72222213-72222235 CTTGAGAAGGTGAGGCAGGAAGG - Intergenic
1140190514 16:72811891-72811913 CCGGAGCAGGTGAGGCTGGAAGG - Exonic
1140270149 16:73458313-73458335 AGGGAGGAAGTGAGGGAGGAAGG - Intergenic
1140727857 16:77830134-77830156 AGTGAGAAGGTCAGGGTGGCTGG - Intronic
1141155473 16:81593934-81593956 AGGGGGAAGGTAAGGGTAGAGGG - Intronic
1141266815 16:82505395-82505417 AGAGTGAATGAGAGGCTGGAAGG + Intergenic
1141308726 16:82892079-82892101 AGGGATGAGCTGAGGTTGGAAGG - Intronic
1141475290 16:84268844-84268866 AAGGAAAATGGGAGGCTGGAGGG - Intergenic
1141737166 16:85861347-85861369 AGGGAGTGGCTGAGGCTGGGAGG + Intergenic
1141815850 16:86408829-86408851 AGTAGGGAGGTGAGGCTGGAGGG - Intergenic
1141931895 16:87210764-87210786 AGAGAGAAGGAGAGGCGGGGGGG + Intronic
1142145697 16:88492096-88492118 AGGGAGAAGGCGAGGAGGGATGG - Intronic
1142360547 16:89624342-89624364 AGGGAGCAGGTGTCACTGGAAGG + Intronic
1142387204 16:89773257-89773279 AGCGTGATGGTGAGGATGGATGG - Exonic
1142753268 17:2000877-2000899 GGGCTGAAGGTGAGGCTGGGTGG - Intronic
1142899269 17:3002384-3002406 AGGCAGACACTGAGGCTGGAAGG + Intronic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1143022811 17:3925514-3925536 TGGGAGAAGTGGAGGATGGAAGG - Intronic
1143090941 17:4448873-4448895 CTGGAGAATGTGATGCTGGATGG + Intronic
1143129890 17:4671639-4671661 GGCGAGAAGGTGGGGCTGGCGGG - Intronic
1143165035 17:4893385-4893407 AGGGAGAAGCTGGGCCTGGGTGG - Intronic
1143272408 17:5685525-5685547 ATGGTGAAGAGGAGGCTGGAGGG + Intergenic
1143332960 17:6151228-6151250 AGAGAGAAGCAGAGACTGGAAGG - Intergenic
1143481201 17:7228169-7228191 CTAGAGAAGGTGAGGGTGGAAGG + Intronic
1143513144 17:7406690-7406712 AGGGAGAAGATCAGACCGGAGGG - Intronic
1143908948 17:10231720-10231742 AGAGAGAAGATGGGGATGGATGG - Intergenic
1143919583 17:10320426-10320448 AGGGCGAAGAGGAAGCTGGAAGG - Exonic
1143988408 17:10935508-10935530 TGGGAGACTGGGAGGCTGGAGGG + Intergenic
1144080706 17:11761528-11761550 AGGGATAAGGTGAGGCAGATGGG - Intronic
1144778876 17:17798106-17798128 AAGGAGAAGGTGCGGCCAGAAGG + Exonic
1144781276 17:17809782-17809804 AAGGTGAAGGTGAAGCTGGACGG + Intronic
1145247645 17:21280083-21280105 ACAGAGAAGAGGAGGCTGGATGG + Intergenic
1145259109 17:21344129-21344151 AGGCGGCAGGTGAGGCTGCAAGG - Intergenic
1145278989 17:21454965-21454987 AGGGAGAAGGAGAGGAGGGGAGG - Intergenic
1145317509 17:21743874-21743896 AGGCGGCAGGTGAGGCTGCAAGG + Intergenic
1145398866 17:22515486-22515508 AGAGAGAAGGAGAGGAGGGAAGG + Intergenic
1146057189 17:29587397-29587419 GGTGAGAAGGTGAGGATGGTGGG - Intronic
1146059777 17:29598478-29598500 AGGGAGAAGGGGAGGGGAGAGGG - Intronic
1146163261 17:30571073-30571095 AGGGAGAAACTGAGGCTCCAAGG + Intergenic
1146332220 17:31937083-31937105 AGGGAGGAGGAGAGGAGGGAAGG - Exonic
1146908526 17:36633189-36633211 AGGGAGAAGGGGAGACGGGAGGG - Intergenic
1146944546 17:36864754-36864776 AGGGAGGAGGGGAGGGAGGAAGG - Intergenic
1147186566 17:38716458-38716480 AGGGAGAAGGAGGGGCTGAAGGG - Exonic
1147277726 17:39333146-39333168 AGGGAGACGGAGAGGGAGGAGGG - Intronic
1147464319 17:40599040-40599062 AGGAGGAAGGAGAGGGTGGAAGG - Intergenic
1147580236 17:41623832-41623854 AGGGAGAAACTGAGGCTCCAAGG + Intronic
1147669372 17:42167922-42167944 AGGGAGAAGGCAGGGCAGGAAGG - Intronic
1147794589 17:43033451-43033473 AGGGGGAAGGACAGGGTGGATGG + Intergenic
1148205430 17:45776817-45776839 AGGGAAAAGGAGAGGAGGGAAGG + Intergenic
1149000472 17:51752364-51752386 ATGGAGAAGTTGAAGCTGCAGGG + Intronic
1149200704 17:54182876-54182898 AGTGAGAAAGTGAGGGTGGAGGG - Intergenic
1149552328 17:57549486-57549508 AGGGTGAAGGTGAGGTAGAAAGG - Intronic
1149577114 17:57722127-57722149 TGGGAGAATTTGAGGCTGGCAGG - Intergenic
1149604216 17:57913578-57913600 AGGGAGGAGCAGAGGCTGCAGGG + Intronic
1149784367 17:59422879-59422901 AGGGAAAAGGTGACACTGGAAGG + Intergenic
1150007357 17:61478126-61478148 TGAGAAGAGGTGAGGCTGGAGGG + Intronic
1150054982 17:62006308-62006330 AAGGAGAAGGGGAGACAGGAAGG + Intronic
1150129161 17:62657635-62657657 GGGGGGTGGGTGAGGCTGGAGGG + Intronic
1150466857 17:65400942-65400964 AGGGAGGAAGGGAGGCAGGAAGG - Intergenic
1150727236 17:67661301-67661323 AGGGAGTAAGTGAGTCTGAAGGG - Intronic
1150918496 17:69459945-69459967 AGGGAGAAGGAAAGGAAGGAAGG - Intronic
1151339912 17:73464570-73464592 TGGAAGATGGTGAGGCTGGAAGG - Intronic
1151422794 17:74009625-74009647 AGGCGGGAGGTGAGGGTGGAGGG - Intergenic
1151632813 17:75322495-75322517 AGGAAGAAGGTGAGGAGGGCTGG + Intronic
1151671603 17:75574271-75574293 TGGGAGAGGGTGGGGCTGGCAGG + Intronic
1152125683 17:78445200-78445222 TGGGAGGAGGGGAGGCTGGGGGG + Intronic
1152125693 17:78445219-78445241 GGGGAGGAGGGGAGGCTGGGGGG + Intronic
1152508759 17:80771308-80771330 AGGGAGAGCGTGAGGAAGGAGGG - Intronic
1152592891 17:81222475-81222497 AGGGAGGTGGAGAGGGTGGAGGG + Intronic
1152701661 17:81822700-81822722 AGGGAAGAGGCCAGGCTGGACGG + Exonic
1152821317 17:82439220-82439242 AGGGAGAGGGTGGGGCAGGAGGG + Intronic
1152850290 17:82629952-82629974 TGGGAGGAGGTGAGGAGGGAAGG - Intronic
1152859736 17:82689228-82689250 AGTGAGCAGGTGCGGCTGGCAGG + Intronic
1152946158 17:83198694-83198716 AGGGTGGCGGTAAGGCTGGAAGG + Intergenic
1203192766 17_KI270729v1_random:205172-205194 AGGGAGAAGGGGAGGTTACAGGG - Intergenic
1203202130 17_KI270730v1_random:4607-4629 AGGGAGAAGGGGAGGTTACAGGG - Intergenic
1153135157 18:1909313-1909335 AGGGATAATGTGAGAGTGGAGGG - Intergenic
1153283753 18:3438366-3438388 AGAGAGAAGGTGAGGGAGGGAGG + Intronic
1153283808 18:3439148-3439170 AGGGAGAAGGTGACACTAGATGG + Intronic
1153362095 18:4208788-4208810 AGGGAGAAGGAGAGGTTGGGGGG + Intronic
1153448031 18:5196142-5196164 AGGGAGTGGGGAAGGCTGGAGGG - Intronic
1153525713 18:5992705-5992727 AGGGAGAGAGTGGGGGTGGAGGG - Intronic
1153914036 18:9730269-9730291 AAAGATAAGGTGAGGCTCGAAGG - Intronic
1154009698 18:10564406-10564428 AGGGATGAGGTGAGCCAGGATGG - Intergenic
1154024052 18:10690219-10690241 AGGGAGAAGGAGAGGTTGTAGGG + Intronic
1154325597 18:13388614-13388636 AGGGAGCAGGTCAGGCTGTTGGG + Intronic
1155144530 18:23072132-23072154 AGGGAGAGGGGGTGGTTGGATGG + Intergenic
1155157954 18:23173257-23173279 AGGCAGCAGGTTAGGCTTGAAGG - Intronic
1155428700 18:25733061-25733083 AGAGAGAAAGAGAGGCTGGCAGG + Intergenic
1155608325 18:27633572-27633594 AGGGGAAAGGTGAGGCTGGAAGG - Intergenic
1155813770 18:30276298-30276320 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
1156398202 18:36717958-36717980 AGGGGGATGGGGAGGCTGGGAGG + Exonic
1156399163 18:36725153-36725175 AGGGAGGAAGTGATGATGGAAGG - Intronic
1156491404 18:37498512-37498534 AGGGAGAAGGTAAGGGAAGAGGG - Intronic
1156503235 18:37572950-37572972 AGGGAGAGGCTGAGGATGGAGGG + Intergenic
1156537215 18:37875585-37875607 AGGGACAGGGAGAGACTGGAGGG - Intergenic
1156833666 18:41526701-41526723 AGTTAGAATGTGAGGCTTGAAGG - Intergenic
1156907399 18:42370307-42370329 ATGGAGGAGGTGAGGCATGAAGG + Intergenic
1156987508 18:43365870-43365892 AGGGAGAGAGTGAGGGAGGAGGG + Intergenic
1157281976 18:46352159-46352181 AAGGAGGAGGGGAGCCTGGAGGG - Intronic
1157403602 18:47405770-47405792 AGGGAGAAGGTGAGGCAGGGAGG + Intergenic
1157560271 18:48640562-48640584 AGGGAGAAACTGAGGCTACATGG + Intronic
1157619223 18:49006447-49006469 ATGGAGATGGTAAGGGTGGAGGG - Intergenic
1157706887 18:49814295-49814317 AGGCAGCGGGTGAGGCTGGACGG + Intronic
1158009008 18:52706993-52707015 AGGTAGAAGCTGGGGTTGGAGGG + Intronic
1158432117 18:57398696-57398718 AGGGAGTAGTTGAGGAGGGATGG + Intergenic
1158538214 18:58327491-58327513 AGGGAGAGGCTGAGCCAGGAAGG + Intronic
1159084639 18:63774696-63774718 AGGGTGGAGGAGAGGCTGGCAGG + Intronic
1159149542 18:64503962-64503984 AGGGAGGTGGTGTGGTTGGATGG + Intergenic
1159238746 18:65713065-65713087 AGGGAGGAAGTGAGGAAGGAAGG - Intergenic
1159325984 18:66918370-66918392 AGGGAGGAGGGAAGGATGGAAGG - Intergenic
1159384865 18:67710359-67710381 AGTGAGGTGGAGAGGCTGGAGGG - Intergenic
1159673370 18:71251002-71251024 GGGGAGAAGGTGGGGGAGGAAGG + Intergenic
1159997651 18:74981590-74981612 AGGGAGACTATGAGGCTAGAGGG + Intronic
1160392658 18:78546926-78546948 AGGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160392667 18:78546945-78546967 AGGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160689854 19:456477-456499 AGGGAGGAGGAGGGTCTGGAAGG - Intronic
1160800041 19:963521-963543 AGGGGGCAGGTAGGGCTGGAAGG + Intronic
1160906345 19:1453361-1453383 AGGGAGTGGGGGAGGCTGGGGGG + Intronic
1160953917 19:1680942-1680964 AGGCAGATGGGGAGGCTGGAAGG + Intergenic
1160978699 19:1806719-1806741 CGGGGGCAGGAGAGGCTGGACGG - Intronic
1161051418 19:2165624-2165646 AGAGAGAAGTGGAGGCTGGAAGG - Intronic
1161106574 19:2446536-2446558 TGGGAGGAGGGGAGGCAGGAAGG - Intronic
1161355118 19:3814783-3814805 AGGGAAGTGGGGAGGCTGGAGGG - Intronic
1161729351 19:5949652-5949674 AGGTGGAAGGTGAAGCTGTATGG - Intronic
1161796173 19:6387904-6387926 AGTGAGAAGATGGGGCGGGAAGG + Intronic
1161821631 19:6533761-6533783 AGGGAGAAGGTGTCTCTGGAGGG - Intronic
1161989491 19:7676641-7676663 GGGGTGGAGCTGAGGCTGGAGGG + Exonic
1162028508 19:7907475-7907497 AGAGAGAGCGAGAGGCTGGAGGG - Intronic
1162029321 19:7910590-7910612 AGGGAGGAGGAGACGCTGCAGGG - Intronic
1162064293 19:8115694-8115716 AGGAAGTAGGTGAGGGTGGGAGG + Intronic
1162127418 19:8506914-8506936 ATAGAGAAGGTGAGGCTAGGAGG - Intergenic
1162141247 19:8586651-8586673 AGGCAGACGGTGGGGCTGGGGGG + Exonic
1162337635 19:10071431-10071453 AGGGACAAGGAGGGGCAGGAGGG + Intergenic
1162648833 19:12069612-12069634 AGGAAGAAGGTGAGAGTGGGAGG + Intronic
1162723089 19:12674006-12674028 AGAGAGAAGATGAGGCAGGAAGG + Intronic
1162752816 19:12838945-12838967 AGGAAGAAGGGGAGGCTGGGGGG + Intronic
1162765127 19:12914556-12914578 AGGGAGAATGTGTGGGTGTAGGG - Intronic
1162833741 19:13302989-13303011 GGGGAGAGGCTTAGGCTGGACGG + Intronic
1162972796 19:14191195-14191217 GGGGACAGGCTGAGGCTGGAGGG - Intronic
1163160284 19:15460177-15460199 AGGGTGTATGAGAGGCTGGAGGG - Intronic
1163565427 19:18048411-18048433 AGGGTCAAGGCTAGGCTGGAGGG + Intergenic
1163703184 19:18797101-18797123 AGGGAGAGGGGGAGGGAGGAAGG - Intergenic
1163779607 19:19239564-19239586 AGGGAGGAGGGGAGGGAGGATGG - Intronic
1164608886 19:29618807-29618829 AGGCAGGAGGAGAGGCCGGAAGG + Intergenic
1164646394 19:29861665-29861687 AGGGAGGATCTGAGCCTGGAAGG + Intergenic
1164680384 19:30130699-30130721 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164680442 19:30130871-30130893 AGGGAGGAGGAGAGGAAGGAAGG - Intergenic
1164680487 19:30131008-30131030 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680513 19:30131081-30131103 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680539 19:30131154-30131176 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680548 19:30131182-30131204 AGGGAGAAGGGGAGGGGGAAGGG - Intergenic
1164787463 19:30944825-30944847 AGGGAGAAAGGGAGGAAGGAAGG + Intergenic
1164937098 19:32223457-32223479 AGGAAGAAAGAGAGGATGGAAGG + Intergenic
1165071716 19:33259652-33259674 AGGGAGATGGTGAAACTGGGAGG - Intergenic
1165160515 19:33813037-33813059 AGACCGAGGGTGAGGCTGGAGGG + Exonic
1165325850 19:35114434-35114456 AGGGAAACTGGGAGGCTGGAGGG - Intergenic
1165374168 19:35429922-35429944 AGGGGGAAGGTGAGGCCAGCTGG + Intergenic
1165744538 19:38222821-38222843 AGGGGAGAGGTGAGGCTGGAGGG - Intronic
1165817094 19:38648862-38648884 AGGGAGAAGGTGAGATCGGTGGG + Intronic
1165832696 19:38737124-38737146 TGGGCAAAGCTGAGGCTGGAGGG - Intronic
1165847388 19:38827042-38827064 AGGGAGAAGGAGGGGAAGGAGGG + Intronic
1165912358 19:39237130-39237152 AGGGAGAAGGAGAAGATGAAGGG + Intergenic
1166147211 19:40845942-40845964 AGGTGGAGGGTAAGGCTGGAGGG - Exonic
1166151368 19:40877838-40877860 AGGTGGAGGGTAAGGCTGGAGGG - Exonic
1166155857 19:40910532-40910554 AGGTGGAGGGTAAGGCTGGAGGG - Intergenic
1166159212 19:40939139-40939161 AGGGAGAAGGAGAGGGAGGGTGG + Intergenic
1166184215 19:41128838-41128860 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1166194388 19:41196495-41196517 AGGGTGATGGGGAGGCTGGGAGG + Intronic
1166267967 19:41696654-41696676 AGGGAGAAGGTGATGCAGGAAGG + Intronic
1166293406 19:41877544-41877566 TGGGCCAAGGTGGGGCTGGAGGG + Intronic
1166297512 19:41896343-41896365 AGGGAGCAGGGCTGGCTGGAAGG - Intronic
1166297672 19:41896940-41896962 AGGGGGAAGGTGAGAGAGGAGGG - Intronic
1166375057 19:42323402-42323424 AGGGAAAAGGTGAGGGTCCAGGG + Intronic
1166380762 19:42353980-42354002 GGGGAGAAGGTGAGGGTGAGTGG - Exonic
1166496669 19:43307871-43307893 AGGGAGAAGGTGGTGCAAGAAGG - Intergenic
1166734693 19:45077082-45077104 ATGGTGGAGCTGAGGCTGGAGGG + Intergenic
1166778147 19:45324628-45324650 AGGAAGAAGATGAGGTTGGAGGG + Intergenic
1166835314 19:45664140-45664162 TGGGAGAAGTTTAGGTTGGAAGG - Intergenic
1167195174 19:48023394-48023416 AGGGAGGAAGTGAGGGAGGAGGG + Intronic
1167262515 19:48467197-48467219 AGGGAGATGGAGAAGCTGGAGGG - Intronic
1167286658 19:48602233-48602255 AGGGAGGAGGGGAGCCAGGAAGG + Intronic
1167410906 19:49343217-49343239 AAGGTGGAGGTGAGGCTGGAGGG - Exonic
1167464785 19:49645031-49645053 AGGAAGAAGATGAGTCTCGAGGG + Exonic
1167753357 19:51394506-51394528 AGGGAGAAGGCGAGGCGCGCGGG - Intergenic
1167789705 19:51666637-51666659 AGGGAGAAAGAGAGGAAGGAAGG + Intergenic
1167854283 19:52225671-52225693 AGAGAGAGGGTGAGCCAGGATGG - Intronic
1168649939 19:58086432-58086454 AAGAAGAAGGCGAGGCTGGAAGG + Intronic
1168720008 19:58549648-58549670 AGGGTGAGTGTGAGGCTGGTGGG + Exonic
925044649 2:763649-763671 GGGGAGAAGGTGAAGATGGAGGG + Intergenic
925090170 2:1148808-1148830 GGAGAGAAGGTGAAGGTGGAGGG + Intronic
925290169 2:2742609-2742631 AGGAAGAAAGGGAGGATGGATGG + Intergenic
925292345 2:2756154-2756176 AGGCAGAAGCTGAGGGTGGCAGG - Intergenic
925369778 2:3336116-3336138 AGGGTGAAGGGGAGGGTGAAGGG + Intronic
925851522 2:8086721-8086743 GGGGAGGAGAAGAGGCTGGAGGG + Intergenic
925862619 2:8194527-8194549 AGGGAGAAAGAGAGGAAGGAAGG - Intergenic
926093165 2:10063605-10063627 AGGGTGAGGGTGACACTGGAGGG + Intronic
926244574 2:11113502-11113524 AGGAAGAAGGGGAGGGAGGAAGG - Intergenic
926399989 2:12487342-12487364 AGGGAGGAAGGGAGGATGGAAGG + Intergenic
926430557 2:12781004-12781026 AGGATGAAGCTGGGGCTGGAAGG - Intergenic
926433869 2:12818361-12818383 AGGGAGAAGGGAAGGAAGGAAGG - Intergenic
926557232 2:14373280-14373302 AGGGAGTACTTGAGGGTGGAGGG + Intergenic
926720911 2:15959503-15959525 AGGGAGAAGGACTGGCTGGATGG + Intergenic
926838375 2:17050109-17050131 ACTGAGAAGGTGATGTTGGATGG - Intergenic
926842738 2:17100701-17100723 AGGGAAGAGGTGAAGCCGGAGGG + Intergenic
926931107 2:18041952-18041974 AGGCAGAAGGTGAGGGTTTATGG - Intronic
927684140 2:25159262-25159284 AGGGAGAAGGTGTGGGGGAAAGG + Intergenic
927827284 2:26317542-26317564 AGGGACAGAGTCAGGCTGGAGGG - Exonic
928221825 2:29409660-29409682 AGGAAGAGGATGAGGCTTGACGG - Intronic
928265851 2:29811171-29811193 AGGTCGAAGGCCAGGCTGGAGGG + Intronic
928902798 2:36338673-36338695 AGAGAGAAGGGGAGGGTGGCAGG - Intergenic
929069244 2:38012117-38012139 AGGGTGAAGGGCAGGCTGGGTGG - Intronic
929261671 2:39873045-39873067 AGGGAGGAGGGGAGGCAAGAGGG - Intergenic
929304873 2:40349587-40349609 AGGGTTATTGTGAGGCTGGAAGG + Intronic
929417041 2:41754131-41754153 AGGGAGAAAGTGAATCAGGATGG - Intergenic
929924670 2:46198306-46198328 ATGGAAAAGCTGAGGCAGGAAGG - Intergenic
930599576 2:53427676-53427698 AGGCAGAATGTGAGATTGGAAGG - Intergenic
930684084 2:54289199-54289221 AGGAAGGATGTGAGGCTGAAAGG - Intronic
931133390 2:59366219-59366241 AGGGAGAAAGGGAGGGAGGAAGG + Intergenic
931304672 2:61017144-61017166 GGGGAGAAGGTGAGGCGGGTAGG - Intronic
931814370 2:65886214-65886236 AGCAAGAAAGTGAGGCTGGGAGG - Intergenic
932331142 2:70899124-70899146 CGGCAGAAGGTGAGGTTGGGGGG - Intergenic
932333852 2:70918213-70918235 AGGGAAAAGGTGAGCCAGGGTGG - Intronic
932396812 2:71454252-71454274 AGAGGGAAACTGAGGCTGGAAGG + Intronic
932402173 2:71488641-71488663 GGGGACACGGTCAGGCTGGAGGG - Intronic
932635728 2:73386184-73386206 CTGGAGAAGGTGAGGCGGGCCGG + Exonic
932680131 2:73817749-73817771 TGGCAGAAGATGAGGCTGGGTGG + Intergenic
932750169 2:74366445-74366467 AGCGAGCAGGTGGGCCTGGATGG - Exonic
933018133 2:77157261-77157283 AGGGAGAAAGTGAAGAAGGAAGG + Intronic
933141126 2:78793856-78793878 AGTGAGAGGCTGAAGCTGGATGG + Intergenic
933331342 2:80896551-80896573 AGGAAGAGAGTGAGGCAGGAAGG - Intergenic
933698535 2:85237951-85237973 AGGGGGAAGGTGATGCGGGCAGG + Intronic
933726773 2:85431473-85431495 AAGCTGAAGGGGAGGCTGGAAGG - Intronic
933991423 2:87636891-87636913 AGGCAGGAGGTGGTGCTGGAGGG + Intergenic
934061545 2:88298711-88298733 GGGGAGAAGGTGAGGGGAGAGGG + Intergenic
934557370 2:95294582-95294604 GGGGAGAAACTGAGGCTGGGGGG - Intergenic
934874988 2:97909362-97909384 AAGGAGAAAATGAGACTGGAGGG + Intronic
935626318 2:105175019-105175041 ATGGAGAGGGAGAGGCTGGTAGG - Intergenic
935651645 2:105387183-105387205 AGGGAGAAGGGGAAGATGCAAGG - Intronic
936073240 2:109385005-109385027 AGGGAGGGTGTGAGGCTGGGTGG - Intronic
936078317 2:109415786-109415808 AGGGAGGTGGTGAGGGTGGGTGG - Intronic
936268812 2:111032772-111032794 AGGGGGATGGTCAGGCTGGGAGG - Intronic
936302419 2:111313931-111313953 AGGCAGGAGGTGGTGCTGGAGGG - Intergenic
936571925 2:113624728-113624750 AGGGTGATGGTGAGGGTGGGGGG - Intergenic
936679850 2:114757346-114757368 AGGGAGAGGGGGAGGGAGGAGGG + Intronic
936711801 2:115140348-115140370 AGGCAGCAAGTGAGGCTGCAGGG + Intronic
936844641 2:116816142-116816164 AGGAAGAAAGGGAGGATGGAAGG + Intergenic
936953711 2:118003617-118003639 AGGCAGGGGGTTAGGCTGGATGG - Intronic
936986422 2:118315258-118315280 AGGGTGAAGAGGAGGCTGCAAGG - Intergenic
937027449 2:118711264-118711286 AGGGAGAAGAGGAGGTTGGTGGG - Intergenic
937971335 2:127551662-127551684 CGGGAGAAGGCAGGGCTGGAAGG + Intronic
938103632 2:128514763-128514785 AGGGAGAGGTCGAGGCTGAAGGG - Intergenic
938273677 2:129997300-129997322 AGGGAGAATGTGAGAAAGGAAGG + Intergenic
938380189 2:130832135-130832157 AGGGAGGAGGTGGGGGAGGAGGG - Intergenic
938442534 2:131348815-131348837 AGGGAGAATGTGAGAAAGGAAGG - Intronic
938572121 2:132570357-132570379 AGTGAGGAAGTGCGGCTGGAGGG - Intronic
938992543 2:136644062-136644084 AGGGAGGAGGAGAGGAAGGAAGG + Intergenic
939490850 2:142874444-142874466 AGGGGAAAGGAGAGGCAGGAGGG + Intergenic
939918603 2:148080126-148080148 AAGGTGAAGGTGATGTTGGAAGG + Intronic
939996928 2:148928535-148928557 AGGGACAAGGGGAGGCTCGAGGG - Intronic
940107193 2:150113841-150113863 AGGGAGGAATGGAGGCTGGAAGG - Intergenic
940463288 2:153995811-153995833 AGGGAGAAGGTGGGAGTGGTAGG - Intronic
941012902 2:160321332-160321354 AGGGAGAAGAGGAAGCTGAATGG - Intronic
941169669 2:162121215-162121237 AGGAAGTAAGTGAGGCTGCAAGG + Intergenic
942238451 2:173935972-173935994 AGGGAGAAAGTAAGGAAGGAAGG - Intronic
942325418 2:174772323-174772345 AGGGAGATTGTGAAGCAGGACGG - Intergenic
942549981 2:177105238-177105260 TGGGGGAAGTTGGGGCTGGAAGG - Intergenic
942798769 2:179852171-179852193 ACGGAGAAGGGAAGGCAGGAAGG + Intronic
942908953 2:181218482-181218504 CGGGAGAACGTAAGGCTGGCTGG - Intergenic
943330781 2:186556369-186556391 AGGGAGAAAGAGAGGAAGGAAGG - Intergenic
943373357 2:187044593-187044615 AGCAAGAAAGTGAGGCAGGAGGG - Intergenic
943532662 2:189103864-189103886 AGGAAGAAAGTGAGGGAGGAAGG - Intronic
943645047 2:190401084-190401106 AGGAACAAGGGGAGGGTGGAGGG + Intergenic
943713404 2:191123461-191123483 TGAGAGAAGGTCAGGCTGGATGG - Intronic
943732303 2:191315207-191315229 AGGGAGGAGGGGAAGATGGATGG - Intronic
944556074 2:200889100-200889122 AGGAAGGAGGTGAGGCGGTAAGG - Exonic
944683342 2:202096575-202096597 AGAGGGAAAGTGAGGCTGGCTGG + Intronic
945137524 2:206644273-206644295 AGGGAGCAGGTGAAGCTCAAGGG - Intergenic
945853491 2:215038694-215038716 AGGCAGAGGGTCAGGCTTGAAGG - Intronic
946395356 2:219441586-219441608 CGGGAGGAGGTGAGGGTGGGAGG + Intronic
946558771 2:220889527-220889549 AGTGAGGAGGAGGGGCTGGAGGG - Intergenic
946722108 2:222620169-222620191 TGGTAGCAGGTGAGGCTGGGAGG - Intronic
946731861 2:222717514-222717536 AGGGAGAGGATGAGGCAGGAAGG + Intergenic
947077746 2:226363986-226364008 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077751 2:226363998-226364020 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077793 2:226364105-226364127 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077799 2:226364117-226364139 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077804 2:226364129-226364151 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077824 2:226364177-226364199 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077841 2:226364213-226364235 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077847 2:226364225-226364247 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077853 2:226364237-226364259 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077859 2:226364249-226364271 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077865 2:226364261-226364283 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077870 2:226364273-226364295 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077884 2:226364309-226364331 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947359349 2:229331957-229331979 TGGGAGCAGGTGGTGCTGGAGGG - Intergenic
947624825 2:231612913-231612935 AGGGAGAAGGGAAGGGGGGACGG + Intergenic
947715448 2:232336794-232336816 GGGGAGAGGGTGGGGCTGGAAGG + Exonic
947720980 2:232369187-232369209 AGGAAGACGGTGGGGCTAGAAGG + Intergenic
947889909 2:233608245-233608267 TGGCAGAAGGTGAGGGTGGAGGG + Intergenic
947895338 2:233666100-233666122 TGGCAGAAGGTGAGGGTGGAGGG + Intronic
947925933 2:233922591-233922613 AGGGAGACAGGGAGGCTGGAGGG - Intronic
948333739 2:237192013-237192035 AAGGGGAAGGTGAGGCAGGGAGG - Intergenic
948454293 2:238097591-238097613 AGGGAAAAGGAGGGGCAGGATGG + Intronic
948644214 2:239393605-239393627 AGGAGGAAGGGGAGGCTGGGTGG - Intronic
948694317 2:239725544-239725566 AGGGAGAAGGTGAGTGAGGGAGG + Intergenic
948698582 2:239746820-239746842 CGGGGGAAGGTGAGGTAGGATGG + Intergenic
948884574 2:240876293-240876315 TGGGAGAAGGGGAGGCCGAAGGG + Intronic
949077185 2:242068029-242068051 GGGGAGGAGGAGAGGCTGGTGGG - Intergenic
1168828854 20:833534-833556 AGGAAGAAGGTGGGGCCGGCTGG + Intergenic
1168879685 20:1195906-1195928 ATGGAGAAGGTGAGTGTTGAGGG + Intergenic
1169342877 20:4809745-4809767 AGGGAGTGGGGGAGGCAGGACGG + Intronic
1169427724 20:5509712-5509734 AGGAAAAAGGGGAGGCAGGAGGG + Intergenic
1169513979 20:6296512-6296534 AGTGAGATTGTGAGGCTGGGGGG + Intergenic
1169547514 20:6665695-6665717 AGGGAGGAAGAGAGGCAGGAAGG - Intergenic
1169719374 20:8657059-8657081 AGGGAGAAGGTGAGGGAAGGGGG + Intronic
1169979075 20:11363416-11363438 AAGGAGAAGGAGAGAATGGAAGG - Intergenic
1170555802 20:17513769-17513791 AGTGGGAAAGTGAGGCAGGAAGG + Intronic
1170568928 20:17622086-17622108 AAGGAGAAGATGAGGCTCCATGG + Intronic
1170924157 20:20707739-20707761 AAGCAGAAGCTGAGGCTGGCTGG - Intronic
1171154955 20:22863389-22863411 ATGAAGAATGTGAGGGTGGAAGG - Intergenic
1171347701 20:24478433-24478455 TGGCAGACAGTGAGGCTGGACGG - Intronic
1172109376 20:32536373-32536395 GGGGAAGAGGTGGGGCTGGAGGG + Intronic
1172648957 20:36489712-36489734 GGGGAGAAGGTAAGGATGGGAGG + Intronic
1172696461 20:36826364-36826386 AGGGAGAAGGAGAGGGAGGGGGG - Intronic
1172720788 20:36999452-36999474 AGGGAGAGGGAGAGGAGGGAGGG - Intronic
1172744228 20:37194213-37194235 AGAGAGAAGGTGGCACTGGAGGG + Intronic
1172761564 20:37326965-37326987 AGGGAATAGGTGAGTCTGGTTGG - Intergenic
1172791845 20:37511299-37511321 AGGGAGAAGGTGTGGAGGGAGGG - Intronic
1172846982 20:37935443-37935465 AGGCAAGAGGTGAGGCTGGAGGG - Intronic
1172875194 20:38159959-38159981 AGGGGGAAACTGAGACTGGAGGG + Intronic
1173167523 20:40696101-40696123 AGGGAGAGGAGGGGGCTGGAGGG - Intergenic
1173317277 20:41956420-41956442 AGGGAGAAATTGAGACTGGGTGG + Intergenic
1173364048 20:42369140-42369162 AGTGAGAAAGGGAGGATGGATGG - Intronic
1173552731 20:43944546-43944568 AGGAGGAGGGAGAGGCTGGAAGG - Intronic
1173560863 20:44004411-44004433 AAGGAGAAGGTGAAGCAGGAAGG + Intronic
1174097097 20:48098064-48098086 AGGAAGAAGGTGAGGGTAGATGG + Intergenic
1174098693 20:48109983-48110005 AGGGTGAAGGGGTGGGTGGATGG - Intergenic
1174104855 20:48154978-48155000 AGAGAGAAACGGAGGCTGGATGG + Intergenic
1174216691 20:48921588-48921610 AGACAGAAGGCGAGGGTGGAGGG - Intergenic
1174767459 20:53267350-53267372 AGGGAGAGGGAGAGCATGGATGG + Intronic
1175018076 20:55813336-55813358 AGGAGGATGGTGTGGCTGGATGG - Intergenic
1175413253 20:58785215-58785237 AGGGAGAGGGTGAAGATGGTGGG - Intergenic
1175571526 20:60026425-60026447 AGGGAGAAGAGGAGGCAGAAGGG + Intronic
1175871368 20:62210946-62210968 AGGCAGAAAGTGTGTCTGGAGGG - Intergenic
1175962952 20:62646269-62646291 AGGGTGAAGGTGAGGAGGCAGGG - Intronic
1175988756 20:62777206-62777228 AAGGAGGAGATGAGGCAGGAAGG + Intergenic
1175988760 20:62777225-62777247 AAGGAGGAGATGAGGCAGGAAGG + Intergenic
1175988763 20:62777241-62777263 AGGAAGGAGATGAGGCAGGAAGG + Intergenic
1175988767 20:62777260-62777282 AAGGAGGAGATGAGGCAGGAAGG + Intergenic
1176020229 20:62958966-62958988 GGGGAGGCGGTGATGCTGGAGGG - Intronic
1176027494 20:62993472-62993494 TGGGAGCAGGGGAGGCTGGGAGG + Intergenic
1176027553 20:62993622-62993644 TGGGAGCAGGAGAGGCTGGGAGG + Intergenic
1176027574 20:62993689-62993711 TGGGAGCAGGAGAGGCTGGGAGG + Intergenic
1176027590 20:62993739-62993761 TGGGAGCAGGAGAGGCTGGGAGG + Intergenic
1176037289 20:63045815-63045837 AGGGAGCAGGTGAGCCAGGTGGG - Intergenic
1176270506 20:64233427-64233449 AAGGGGAAGGTGAGGGGGGAGGG - Intronic
1176361549 21:6000829-6000851 AGGGTGAAGGTGAGGTGGGGCGG + Intergenic
1176618812 21:9041781-9041803 GAGGAGAAGGTGAGGTTTGAGGG - Intergenic
1176707181 21:10125376-10125398 AAGGGGAAGGTGAGGTTTGAGGG + Intergenic
1177118874 21:17118050-17118072 AGGGAGAAGATGATGCAGGAAGG - Intergenic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1178293355 21:31387766-31387788 GGGGAGGAGGTGGGCCTGGAGGG + Intronic
1178389084 21:32184059-32184081 AGGGAGAGGGTGAGGCTGAATGG - Intergenic
1178873287 21:36393215-36393237 AGGGAGAGGGAGACGGTGGAGGG + Intronic
1179238455 21:39567658-39567680 AGGAAGAAGGAGAGGATGGTGGG - Intronic
1179282549 21:39946317-39946339 AGGGGGAAGGTGAGCTTGCATGG + Intergenic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1179761969 21:43537721-43537743 AGGGTGAAGGTGAGGTGGGGCGG - Intronic
1179927104 21:44540753-44540775 AGGGAGAAGGGGAGCAAGGAAGG + Intronic
1179998628 21:44985204-44985226 AGGGTGGAGGTGAGGCTGGGCGG + Intergenic
1180116393 21:45708300-45708322 TGGGAGGAGGTGTGGCAGGAGGG + Intronic
1180621721 22:17167048-17167070 AGGCCGAGGGTGAGGGTGGATGG - Intergenic
1180639268 22:17285080-17285102 AGGAAGCAGCTGAGGCTTGAAGG + Intergenic
1180968197 22:19801372-19801394 AGGGATCAGGTCAGGCTGGTGGG - Intronic
1181009446 22:20031999-20032021 ATGGGCAAGGTGAGCCTGGAGGG - Intronic
1181027145 22:20132749-20132771 GTGAAGAAGTTGAGGCTGGAGGG - Intronic
1181438436 22:22923465-22923487 AGGGAGGGGGTGAGGGTGGGTGG - Intergenic
1181618518 22:24071554-24071576 AGGGAGAAACAAAGGCTGGAGGG - Intronic
1181882213 22:25990060-25990082 AGGGAGAAGGGGTGGCGGGAAGG - Intronic
1181901023 22:26155916-26155938 AGGGAGAAAGGGAGGAAGGAGGG + Intergenic
1182086704 22:27565790-27565812 AGGGAGAAAGGAAGGATGGATGG + Intergenic
1182089773 22:27586237-27586259 TGGGAGAATGGGTGGCTGGATGG - Intergenic
1182256561 22:29043222-29043244 AGAGAGAAAGAAAGGCTGGAGGG - Intronic
1182361310 22:29748054-29748076 AGGGAGAGGGTGTGGCTGGGCGG - Intronic
1182487532 22:30648284-30648306 AAGAAGTCGGTGAGGCTGGAAGG - Intronic
1182695858 22:32198966-32198988 AGAGAGAATGAGAGGCTTGAGGG + Intronic
1182769134 22:32781076-32781098 AGGGAGGAAGGGAGGATGGAAGG - Intronic
1183078573 22:35441995-35442017 AGGGAACAGGGGAGACTGGAAGG - Intergenic
1183138942 22:35917676-35917698 TGGGAGAAGGGGAGGCCAGAAGG + Intronic
1183144274 22:35974851-35974873 AGGGAAAAGATGAGGCTGCAGGG - Intronic
1183153139 22:36053676-36053698 AGGGAGAAGGGAAGGCAGAAGGG - Intergenic
1183153172 22:36053779-36053801 AGGGAGAAGGGAAGGGAGGAGGG - Intergenic
1183153185 22:36053810-36053832 AGGGAGAAGGGAAGGGAGGAGGG - Intergenic
1183272785 22:36872453-36872475 AGATTGAAGGTGAGGTTGGAGGG + Intronic
1183539086 22:38419293-38419315 CGGGGGGAGGTGAGGCAGGAGGG + Intergenic
1183618352 22:38958590-38958612 AGGGAGAAAGAGAGGAAGGAAGG - Intronic
1183698813 22:39438208-39438230 AGGGAGAAGGGAAGGAAGGAGGG - Intergenic
1183759955 22:39806991-39807013 AGGTTAAAGGTGAGGCTGCAGGG + Intronic
1183855428 22:40629988-40630010 AGGGACAAGGTTAATCTGGAGGG + Intronic
1183855517 22:40630883-40630905 AGGGACAAGGTTAACCTGGAGGG - Intronic
1184119542 22:42441103-42441125 CTGGAGAAGGGGAGGCTGGGTGG - Intergenic
1184212496 22:43044110-43044132 AGGGAGAAGATGGGGGTGGGTGG - Intronic
1184292014 22:43502429-43502451 AGGAGGAGGGTGAGGCTGCAAGG + Intronic
1184835705 22:47019803-47019825 AGGGAGAAGCGAAGGATGGAGGG - Intronic
1184848077 22:47101426-47101448 AGAGAGACGGAGAAGCTGGAAGG - Intronic
1184867379 22:47209273-47209295 AGGAAGAATGTGGGGCTGGGTGG + Intergenic
1184896565 22:47410666-47410688 AAGAACAAGATGAGGCTGGATGG + Intergenic
1184925001 22:47630517-47630539 AGGAAGAAGGTGAGACCAGAAGG - Intergenic
1185297018 22:50059302-50059324 AGGGAGGAGGGGCGGGTGGAGGG - Intergenic
1185420884 22:50733750-50733772 AGGGAGCAGGGGATGCTGGCAGG - Intergenic
1185428267 22:50786150-50786172 AGGGTGATGGTGAGGGTGGGGGG + Intergenic
949165426 3:935026-935048 AGGTTGGAGGTGAGGCTTGATGG - Intergenic
950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG + Exonic
950066495 3:10115943-10115965 AGGGAGAAGGTGGGACCTGAAGG - Intronic
950228530 3:11255990-11256012 GGGCAGAAGGTGAAGCTGCAAGG + Intronic
950352761 3:12373289-12373311 AGGGAGAAGGGCAGGGGGGAAGG + Intronic
950627178 3:14255981-14256003 ATGGAGAAATTGAGGCTGGAGGG - Intergenic
950646566 3:14380852-14380874 AGGGAGCAGGGGAGGAAGGAAGG + Intergenic
950841770 3:15974798-15974820 AGGGAGACCGCGGGGCTGGAGGG - Intergenic
950907583 3:16553046-16553068 GGGGAGAAGGGGAGGAGGGAGGG + Intergenic
951150095 3:19278436-19278458 AGGGAGAAAGGCAGGCAGGAAGG + Intronic
951193538 3:19798520-19798542 AGGGAGAAAGGAAGGCAGGAAGG + Intergenic
952043240 3:29285257-29285279 GGGGAGTAGGTGGGGGTGGATGG + Intronic
952352294 3:32551961-32551983 TGGGAGAAGCTGAGCCTTGAAGG - Intronic
952542340 3:34379501-34379523 AGGAAGAAGGTGAGGAGGGAAGG - Intergenic
952736580 3:36697352-36697374 AGGGATAAGCTGAGGCTGTCGGG - Intergenic
952855492 3:37767100-37767122 AGGGAGGAGGGGAGGATGCAGGG + Intronic
952904895 3:38133278-38133300 AGCTAGGAGATGAGGCTGGAAGG + Intronic
953162001 3:40429557-40429579 TGGGAGTAGCTGAGGCAGGAGGG + Intergenic
953392907 3:42544168-42544190 AAGGAGAAAGTGAGGATAGAAGG - Intergenic
953455023 3:43034227-43034249 AGGGAGAAAGTGAGGATGCTTGG + Intronic
953930953 3:47005416-47005438 AGGGAGATGCTGTGGCTGGAGGG - Intronic
954005619 3:47588211-47588233 AAGGAGCAGCTGAGGCTGGCGGG + Exonic
954445283 3:50543003-50543025 AGGGAGAAGGTGGAGCTGGGAGG + Intergenic
954600442 3:51863475-51863497 AGGGAGAAGAGGAGGCAGCAAGG - Intergenic
954609805 3:51938288-51938310 AGGGAATAGGGGAGGTTGGATGG - Intronic
954665470 3:52249108-52249130 AGGCAGACAGTGAGGCTGGTGGG + Intronic
954722673 3:52578898-52578920 AGGAAGAAAGTGTGGTTGGAGGG + Intronic
954795598 3:53160076-53160098 AGGGCAGAGGAGAGGCTGGATGG - Intronic
955123427 3:56085032-56085054 ATGGAGAAACTGAGGCTGAAAGG - Intronic
955822866 3:62914781-62914803 AGGGAATAGGTGAGGATTGAAGG + Intergenic
955861215 3:63332563-63332585 AGAGAGAAGGTATGGGTGGATGG + Intronic
956772749 3:72540322-72540344 TGGGAAATGGTGATGCTGGAGGG - Intergenic
957541128 3:81570462-81570484 AGGGAGAAGATGAAGGTTGATGG + Intronic
957593784 3:82233937-82233959 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
958479449 3:94628091-94628113 AGGGAGAAAGGGAGGAAGGAAGG - Intergenic
959033641 3:101333906-101333928 AGGGACAAGGTTAGGGGGGATGG + Intronic
959215261 3:103444140-103444162 AGGGAGGAAGTGAGGAAGGAAGG - Intergenic
959590354 3:108073449-108073471 TGGGAGAAGCTGAGGCAGTAAGG + Intronic
959919029 3:111850294-111850316 AGGGAGAAGGTGAGGGGGGCAGG + Intronic
960053934 3:113263121-113263143 AGGGACAAGTTGAGGCTTGGAGG + Intronic
960967753 3:123116798-123116820 GAGGAGGAGGTGGGGCTGGATGG + Intronic
961448647 3:126992574-126992596 AGAGGGAAGCTGAGGCTGCAGGG - Intronic
961540801 3:127598175-127598197 AGGTAGAAGCTGAGGCTCCAGGG - Intronic
961562562 3:127740750-127740772 AGGGTGGAGGTGAGGCTTGCAGG + Intronic
961660268 3:128464929-128464951 AGGGGGAAGGGGAGGGAGGAAGG - Intronic
962072159 3:132044595-132044617 AGGGAGAAGGAGGGGCAGGGAGG + Intronic
962270852 3:133977038-133977060 AAGGGGAAGGTGAGGCTGCCCGG - Intronic
962490875 3:135893002-135893024 AGGGAGAAAGTAAGGAAGGAAGG + Intergenic
962559534 3:136591261-136591283 AGGGAGGAGGGGAGGAGGGAAGG + Intronic
962685597 3:137844955-137844977 AGGGAGAGGGAGAGGATGGATGG - Intergenic
962893377 3:139692467-139692489 ATGGGAAAGGTGAGGCTGGAGGG + Intergenic
962935473 3:140076659-140076681 AGAGAGAAGGTGGGCCTCGAAGG - Intronic
962942151 3:140134747-140134769 TGGGGGAAGGAGAGGGTGGAGGG + Intronic
963127868 3:141832060-141832082 AGAGAGCCGGTGAGGCTGTATGG + Intergenic
963128854 3:141839646-141839668 AGTGACAGGGTGAGGCTGGGTGG - Intergenic
963405397 3:144856681-144856703 AGGGAGAAGGGAAGGAAGGAAGG - Intergenic
964389815 3:156185330-156185352 TTGGAGATGGTGAGGCTGGAAGG - Intronic
964397737 3:156265329-156265351 AGGGAGAAGAAGTAGCTGGATGG - Intronic
964480249 3:157132230-157132252 AGGGAGGACATGCGGCTGGAGGG - Intergenic
964624889 3:158749351-158749373 GGGGAAAGGGTGAGGCTGAATGG - Intronic
964977038 3:162634266-162634288 AGGGAGGAGGTGAACTTGGAGGG - Intergenic
965473328 3:169122359-169122381 AGGGAGGAAGTGAGGCTTAATGG - Intronic
966461403 3:180180625-180180647 AGGGAGAAAGGGAGGGAGGAAGG + Intergenic
966855832 3:184193357-184193379 ATGTAGAAGTTGGGGCTGGAAGG - Exonic
967205198 3:187113109-187113131 AGGGTGAAGGTGGGAATGGATGG + Intergenic
967541604 3:190674674-190674696 AGGAAGAAAGTGAAGCTAGAAGG + Intergenic
967997419 3:195177150-195177172 AGGGAGCAGGTGATTCTGCACGG - Intronic
968166553 3:196470524-196470546 AGGATGAGGCTGAGGCTGGATGG - Exonic
968166568 3:196470609-196470631 AGGATGAGGCTGAGGCTGGATGG - Exonic
968189843 3:196659870-196659892 CAGGAGAGGGTAAGGCTGGAGGG - Exonic
968503063 4:960110-960132 GGCGGGGAGGTGAGGCTGGAGGG + Exonic
968537473 4:1143518-1143540 GGATAGAAGGTGGGGCTGGAAGG - Intergenic
968730022 4:2265168-2265190 AAGGAGAATGTAAGGCTGGGTGG - Intergenic
969102583 4:4780473-4780495 ATGGAGAAACTGAGGCTTGAGGG - Intergenic
969462695 4:7337149-7337171 TTGCAGAAGGTGGGGCTGGAAGG + Intronic
969462822 4:7337806-7337828 AGGGGGAAGGTGCAGGTGGAAGG - Intronic
969467542 4:7366531-7366553 GAGGAGGGGGTGAGGCTGGAGGG - Intronic
969599774 4:8169456-8169478 AGGGAGCAGGTGAGGGGTGAGGG - Intergenic
969685410 4:8671266-8671288 AAGAAGAAGGTGAGGGTGGAAGG + Intergenic
970213157 4:13731713-13731735 AAGCAGAGGATGAGGCTGGAAGG + Intergenic
970903081 4:21182620-21182642 TGGAAGGATGTGAGGCTGGAAGG - Intronic
971130510 4:23804191-23804213 GGGGAGAGGGCAAGGCTGGAGGG - Intronic
971242676 4:24902635-24902657 AGGCAGTTGGTGAGGCTTGATGG - Intronic
971296506 4:25398362-25398384 ACTGAGAAGGTGAAGTTGGAAGG + Intronic
971478664 4:27095264-27095286 ATGGAGAAGGAGAGGCTGGTGGG - Intergenic
971595381 4:28520996-28521018 AGGTAGAAGGAGAGGAAGGAAGG - Intergenic
972125437 4:35759190-35759212 AGGGAGGAGGTGAAGCAAGATGG - Intergenic
972316963 4:37935774-37935796 ATGGCGAAGGTAAGACTGGAGGG - Intronic
972329165 4:38047756-38047778 AGGGAAAAGGTGAGGGGTGAGGG + Intronic
972330323 4:38058126-38058148 AGGGAGGCGGTCAGGATGGAAGG - Intronic
975612055 4:76213413-76213435 ATCGAGAAGGTGAGGCGGGGCGG - Exonic
975617102 4:76257455-76257477 AGAGAGAAGGGGACACTGGAAGG - Intronic
976126024 4:81834521-81834543 AGGGAGTGGGGGAGGGTGGAGGG + Intronic
976475645 4:85479592-85479614 AAGGAGAATGTGGAGCTGGATGG + Intronic
976587280 4:86812742-86812764 AAGGAGGAGGTGAGGTTAGAGGG + Intronic
976775264 4:88699297-88699319 AGGAAGAGGGTGGGGCTGGGTGG - Intronic
977271763 4:94925956-94925978 AGGGAGGAGGGGAGGAAGGAAGG - Intronic
977293911 4:95191711-95191733 AGGGAGGAGGTGAGCAGGGAAGG - Intronic
977294128 4:95192598-95192620 GGGGAGAAGGTGAGCAGGGAAGG - Intronic
977585776 4:98773912-98773934 AGGGAGGAGGAGAGGCAGGAGGG - Intergenic
978424871 4:108571719-108571741 AGTGAGTGGCTGAGGCTGGACGG - Intergenic
978518689 4:109596381-109596403 AGGGAGAAGAGGAGGCAGCAAGG + Intronic
979122984 4:116926480-116926502 GGGGAGAAGGCAAGGCAGGAGGG + Intergenic
979307331 4:119162278-119162300 AAGCAGGCGGTGAGGCTGGACGG + Intronic
979547294 4:121952061-121952083 AGGGAGAAGGAGAGGGAGGGCGG + Intergenic
979582774 4:122379564-122379586 AGCGAGAGGTTGAGGCTGGGAGG + Intronic
979687245 4:123524486-123524508 AGGGAGAAAGGGAGGCAGGGAGG - Intergenic
981197355 4:141937161-141937183 AGGAAGAAAGTAAGGCAGGATGG + Intergenic
981713755 4:147732936-147732958 AGGGAAAAGGTGAAGCTTAAGGG - Intronic
981939169 4:150263291-150263313 AGTGAGTAGATGCGGCTGGATGG - Intergenic
982111555 4:152061046-152061068 AGGTGGAAGGGGAGGCAGGAGGG + Intergenic
982147747 4:152415927-152415949 AAAGAGAAGGTGATGCTGGGGGG - Intronic
982199644 4:152947829-152947851 AGAGAGAAGGGAAGGATGGAAGG + Intronic
982346006 4:154360314-154360336 AGGAAGAAATTGAGGCTGGAAGG - Intronic
984159066 4:176229402-176229424 AGGGAGAAGAGCTGGCTGGAAGG - Intronic
984443026 4:179797322-179797344 AGGGAGAAAGTGAGGGAGGGAGG + Intergenic
984911437 4:184676929-184676951 AGGGAGAAGGGGAAGGGGGAAGG - Intronic
984993205 4:185401984-185402006 GGCGAAGAGGTGAGGCTGGAAGG - Intronic
985070809 4:186165060-186165082 AGAGGGAAAGTGAGGCTGGCAGG - Intronic
985166098 4:187095728-187095750 AGGGAGAAGGTGAGGCTGCAGGG + Intergenic
985183168 4:187287428-187287450 AGGGAGTAGGTGATTCTTGATGG + Intergenic
985517722 5:355509-355531 AGCGAGAGGGTGAGGCTGTGCGG - Intronic
985534525 5:456564-456586 AGGGTGAAGCTGGGGTTGGAGGG + Intronic
985693193 5:1324990-1325012 AGGGCCAGGGTGAGGCGGGAAGG - Intronic
986015193 5:3751522-3751544 AGGGAGAAAGAAAGGATGGAGGG + Intergenic
986105774 5:4658116-4658138 AGGCAGAAGGGGAGGATGGAGGG - Intergenic
986854609 5:11854085-11854107 AGGAGGACGGTGTGGCTGGAAGG - Intronic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
988365295 5:30290581-30290603 AGGAAGAGGTTGAGGTTGGAGGG - Intergenic
988592990 5:32565190-32565212 GGGGAGAAGGTGGGGATGGCAGG + Intronic
988801198 5:34698154-34698176 AGGGAGGAGGGGAGGGAGGAAGG - Intronic
989135707 5:38152217-38152239 AGGGAGAGAGTCAGGCTGGTGGG - Intergenic
989757214 5:44969941-44969963 AGGGTGGAAGTGAGGTTGGACGG - Intergenic
989778294 5:45234663-45234685 AGGGCTTAGTTGAGGCTGGAAGG - Intergenic
990446215 5:55896638-55896660 AGGGGAAAGGTGAGGCGGGGAGG - Intronic
991035370 5:62122883-62122905 ATTGGGAAGGTGAGGATGGAGGG - Intergenic
991045854 5:62221903-62221925 AGTGAGGAAGTGTGGCTGGAAGG - Intergenic
991975118 5:72177585-72177607 TGGGAGCTGGTGAGGCAGGAGGG - Intronic
992206956 5:74440247-74440269 AGGGAGAAAGTGAGGCAGAGAGG - Intergenic
992552146 5:77868988-77869010 GGGGAGAAGGGGAAGCTGGGTGG + Intergenic
993111132 5:83658773-83658795 AGGGAGAGGGTTAGCATGGATGG - Intronic
993439349 5:87936755-87936777 AGGGAGAGGGGGAGGAGGGAAGG - Intergenic
995130918 5:108629620-108629642 AGGGAGAAGGTCTGGGTGGAAGG + Intergenic
995485512 5:112636369-112636391 AGGGTGCAGGTGAGCCTGGCAGG - Intergenic
995881402 5:116848232-116848254 AGGTTGAAGGAGAGGCTGGAAGG - Intergenic
996898798 5:128519891-128519913 GGGGAAAAGGTAAAGCTGGAAGG + Intronic
996914504 5:128695988-128696010 AGGGAGACTGTGAGGCTGGAAGG - Intronic
997453333 5:134000696-134000718 ATGGAGAAAGAGAGCCTGGATGG + Intronic
997578843 5:135004766-135004788 AGGGAGAGGGGGAAGCTGGAAGG + Intronic
997607056 5:135182704-135182726 AGGGGGAAGGTGAGGAAGGGTGG + Intronic
997731923 5:136187758-136187780 TGAGAGAAGATGAGGCTGGTGGG + Intronic
997816306 5:137022150-137022172 AGGGAGAAGGTGGGGTTGAGGGG - Intronic
998039917 5:138945392-138945414 AGGGGCAAGGTGAGGTTTGATGG - Intergenic
998402513 5:141855285-141855307 GGGGGGTAGGTGACGCTGGAAGG - Intronic
998531632 5:142890439-142890461 TGGGAGGAGGTGAGGCTGGAGGG + Intronic
998540843 5:142980050-142980072 AGGGAGAAGGGGAGCGAGGAAGG - Intronic
998819203 5:146042945-146042967 AAGGAGTTTGTGAGGCTGGATGG - Intronic
999124245 5:149235115-149235137 TGAGAGCAGGAGAGGCTGGAAGG - Intronic
999193085 5:149763163-149763185 AGGGAGCAAGCGAGGCTGCAGGG - Intronic
999279598 5:150356608-150356630 AGGGAAAAGGTGAGGTAGGCTGG - Intergenic
999687700 5:154117397-154117419 AGTCAGAAGGTGAGGCTGTGTGG - Intronic
999722592 5:154409754-154409776 TGGGGGGAGGTGAGTCTGGAGGG + Exonic
999780644 5:154847387-154847409 GGGAATAAGGTGAGGCTGGAAGG + Intronic
1000133622 5:158323257-158323279 AGGGAGTAATTGAGGTTGGATGG + Intergenic
1000725997 5:164771626-164771648 AGGGAAAGGGTGAAGATGGAGGG - Intergenic
1000752460 5:165113876-165113898 AGGTGGAAGGGGAGCCTGGAGGG - Intergenic
1001018222 5:168160781-168160803 AGGCTGAGGCTGAGGCTGGAGGG + Intronic
1001042897 5:168349488-168349510 AAGGAGAGGGTGAGGCTGCTTGG - Intronic
1001263860 5:170257448-170257470 AGGGAGAAGGTAAGCCTACAGGG + Intronic
1001434953 5:171693021-171693043 ACGGAGAAGCTGAGGCCAGAGGG - Intergenic
1001479958 5:172081874-172081896 AAGGGGAAGGGGAGGATGGAAGG - Intronic
1001564340 5:172689852-172689874 AGTGAGCAGATGAGCCTGGAAGG - Exonic
1001634314 5:173198824-173198846 AGGGAGAAAGGGAGGGAGGAAGG - Intergenic
1001634466 5:173199753-173199775 AGGTGGGAGATGAGGCTGGAGGG + Intergenic
1001725554 5:173894810-173894832 TGGGTGCAGGTGGGGCTGGAAGG + Intronic
1001749359 5:174117144-174117166 ATGGAGAAAGTGAAGCTGGAAGG - Intronic
1001813395 5:174647815-174647837 AGAGAGAAGGTGAGATTGAAGGG + Intergenic
1001961896 5:175884550-175884572 AGGGTGAGGGTAAGGGTGGAGGG - Intergenic
1002031353 5:176433028-176433050 AGGGAGAGGGAGAGGAGGGAGGG - Intergenic
1002052849 5:176581406-176581428 AAGGAGAAGTTGTGGCTGTAGGG - Exonic
1002079081 5:176727162-176727184 AGAGAGAAGGTGGGCCTGCATGG - Intergenic
1002099519 5:176850516-176850538 AGGCAGAAGGAGAGTCGGGATGG + Intronic
1002289817 5:178192639-178192661 AGGGAGAAAGGGAGGAAGGAAGG + Intergenic
1002310408 5:178310436-178310458 AGGCAGAAGGTGAGCCTGCGGGG - Intronic
1002820657 6:721514-721536 AGAGAGAATGTGAGGCCAGAAGG + Intergenic
1002883804 6:1275970-1275992 AGCGAGAAGGAGAGAGTGGAAGG + Intergenic
1002888755 6:1316961-1316983 GGGGGGAGGGTTAGGCTGGAGGG - Intergenic
1003347625 6:5285306-5285328 AGGGAGAAGGGGAGGAAGGCAGG + Intronic
1003348483 6:5293428-5293450 GGGGAGGAGGTGGGGATGGAGGG + Intronic
1003355537 6:5366017-5366039 AGGCGGAAGGGGAGGCAGGAAGG + Intronic
1003369579 6:5511064-5511086 AGGGAGAAGGAGAGGCCAGATGG + Intronic
1003458439 6:6306653-6306675 GGGGAGAAGGTGGGGTGGGAGGG + Intronic
1003497889 6:6679842-6679864 AGGGAGTGGGAGAGGCCGGAAGG + Intergenic
1003857112 6:10287592-10287614 AGGGAGAAAGGGAGGAAGGAAGG + Intergenic
1003874363 6:10423175-10423197 AGGGAGAAGGTGAAGAAGGAAGG + Intergenic
1004131263 6:12921836-12921858 AGGGAGAGAGGGAGGCAGGAAGG + Intronic
1004468373 6:15906584-15906606 AGTGAGAAGGTGGGGGAGGAAGG - Intergenic
1005118658 6:22366574-22366596 AGGGAGAAGTTGAGGCGCAAAGG - Intergenic
1005255374 6:23997257-23997279 AGGGGGAAGGGGAAGCAGGAGGG - Intergenic
1005674346 6:28138371-28138393 AGGGAGAAGGTCATTCTGGAAGG + Intergenic
1005995472 6:30928461-30928483 AGTGAGAAGGGGAGGATGGTGGG + Intergenic
1006034806 6:31202822-31202844 GGGCAGAAGGTGCGGCAGGAAGG - Exonic
1006091356 6:31630896-31630918 ACGGGAAAGGAGAGGCTGGATGG + Intronic
1006185104 6:32177159-32177181 AGGGTAAAGGTGTGGCTAGAGGG - Intronic
1006245221 6:32728033-32728055 AGGGAGAAAGAGAGGGAGGATGG - Intergenic
1006456412 6:34134495-34134517 AGGGAGGAGCTGAGGCTGTGGGG + Intronic
1006601241 6:35227694-35227716 ACTGCAAAGGTGAGGCTGGAAGG + Exonic
1006739406 6:36296692-36296714 AGGGGGGTGGAGAGGCTGGACGG + Intronic
1006897062 6:37477972-37477994 AGAGAGAAATTGAGCCTGGAGGG + Intronic
1006908712 6:37550070-37550092 AGGGAGCAGCTGTGCCTGGATGG + Intergenic
1006945046 6:37779307-37779329 AGGGAAAAGGGTAGGGTGGAGGG + Intergenic
1007125519 6:39422759-39422781 AGGGAGTAAGTGAGGAGGGAGGG - Intronic
1007151934 6:39702173-39702195 AGAGAGAATGAGAGTCTGGAAGG - Intronic
1007342730 6:41201828-41201850 AGGGAAAAGGAGAGGCTGCTGGG - Intergenic
1007539125 6:42624657-42624679 AGGGAGTAGGTGATGCTGATTGG + Intronic
1007692324 6:43710571-43710593 AGGGAGGAAGGGAGGGTGGAAGG + Intergenic
1007741045 6:44009636-44009658 AGGGAGAAAGGGAGGGAGGAAGG + Intergenic
1008056710 6:46953081-46953103 ACTGAGAGGGTGAGGCTGGCAGG + Intronic
1008321594 6:50120871-50120893 AGGGACAAAGTCTGGCTGGATGG + Intergenic
1008448959 6:51626983-51627005 TGGGAGAAGGTAAGCTTGGAGGG - Exonic
1009839137 6:69044240-69044262 AGCGAGAATGTAAGGGTGGAGGG - Intronic
1011445248 6:87432457-87432479 ATGGAGAGGGGGAGGCAGGAGGG - Intronic
1011470703 6:87704745-87704767 AGGGTGAAGGGGAGACTGGGTGG + Intergenic
1011515646 6:88149656-88149678 AGGGACAAGGTGAAGGAGGAAGG - Intronic
1011632357 6:89339586-89339608 AGGGGGAAGGAGAGGGGGGAAGG + Intronic
1011632371 6:89339616-89339638 AGGGGGAAGGGGAGGAGGGAAGG + Intronic
1012373824 6:98537429-98537451 AGGGAGGGAGTGAGGGTGGAAGG + Intergenic
1012540959 6:100360999-100361021 AGGGAGAAACTGAGGCTGCCTGG + Intergenic
1013087352 6:106867669-106867691 AGGGAGTCGGTGAGGGTTGAGGG + Intergenic
1013130326 6:107226590-107226612 TGGTAGAAAGTGAGGCTGGAGGG + Intronic
1013236944 6:108205519-108205541 AGGTGGAAGGGGAGGCAGGAGGG - Intergenic
1014225925 6:118846791-118846813 AAGGTGATGGTGAGGTTGGATGG - Intronic
1014436295 6:121424507-121424529 GGGGACAGGGTGAGGCAGGAGGG + Intergenic
1015544939 6:134352172-134352194 TGGGAGTAGGTGCAGCTGGAGGG - Intergenic
1015566194 6:134573951-134573973 GGGGAGAGGGTTAGACTGGAAGG + Intergenic
1015942930 6:138469961-138469983 AGGGAGTGGGGGAGGCAGGAAGG + Intronic
1016502428 6:144736764-144736786 AGGCACAAGGTGGGGCCGGATGG - Intronic
1016646271 6:146412065-146412087 AGGCAGAAGGAGGGGATGGAGGG - Intronic
1016833692 6:148456224-148456246 AGGGGGAAAGTGAGGCAGCAGGG - Intronic
1016909109 6:149179395-149179417 GTGGAGAAGGTGAGGCAGGGAGG + Intergenic
1017027425 6:150193608-150193630 TGGGAGAAGGGGAGGAGGGAGGG + Intronic
1017030246 6:150214599-150214621 AGGGGGAAGGAGAGGCTAGGGGG - Intronic
1017057895 6:150454338-150454360 GGAGAGAAGGAGAGGCTGGCAGG - Intergenic
1017102147 6:150858228-150858250 AGTGAGAAGGTGGGTCAGGAGGG - Intergenic
1017455530 6:154597737-154597759 AGGGAGAGCATGTGGCTGGAGGG + Intergenic
1017456273 6:154604106-154604128 AGGGTGGAGGTGAGGCTGGGTGG - Intergenic
1017669517 6:156756648-156756670 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1017721189 6:157244213-157244235 AGGGGGAAGGAGAGGAGGGAAGG - Intergenic
1017983750 6:159424809-159424831 ATGGAGAAGATGAGGCTGTTTGG - Intergenic
1018028415 6:159823118-159823140 AGGGAGAAGAGGAGGCAGGCAGG - Intergenic
1018650141 6:165986281-165986303 AGAGTGAAGGTGGGGTTGGATGG + Intronic
1018781914 6:167076086-167076108 AGGGAGGAAGGGAGGATGGAAGG - Intergenic
1018883475 6:167909367-167909389 ATGGAGAAGGTGAGGATGGAGGG + Intronic
1019118823 6:169787021-169787043 AGGAAGAAGGAGAGGAAGGAAGG - Intergenic
1019126828 6:169846259-169846281 AGGGAGCAGGAGAGGGTGCAAGG - Intergenic
1019163865 6:170086698-170086720 AGGCAGAAGGGGCGGCAGGAGGG + Intergenic
1019221047 6:170473114-170473136 AGGAAGTAGGTGAGGCAGGCAGG - Intergenic
1019288586 7:236055-236077 AGGAAGAAGGAGAGGCTGCCAGG + Intronic
1019415622 7:925452-925474 AGGGTGGAGGGGAGGCCGGAGGG - Intronic
1019423322 7:961904-961926 AGGGGGATGGTGAGGGTGGGGGG - Intronic
1019595331 7:1855782-1855804 GGGGAGTGGGAGAGGCTGGAAGG - Intronic
1019665987 7:2252616-2252638 AGGGTGAAGGGGGGGCTGGAGGG - Exonic
1019739887 7:2667441-2667463 AGCCAGGAGGTGAGGCTGGCCGG + Intergenic
1019860717 7:3656189-3656211 AAGGAGAAGGGAAGGATGGAGGG - Intronic
1019891901 7:3954231-3954253 AGGCAGGAGGGGAGGGTGGAGGG - Intronic
1019891965 7:3954411-3954433 AGGCAGGAGGGGAGGGTGGAGGG - Intronic
1020011358 7:4807556-4807578 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011369 7:4807594-4807616 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011402 7:4807704-4807726 GGGGAGAAGGAGAGGGAGGAGGG - Intronic
1020024341 7:4888377-4888399 AGGGAGGGGGTGAGAGTGGATGG - Intergenic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1021450614 7:20780353-20780375 AGAGAGAAGGTGAGGAAGGAAGG + Intergenic
1021656703 7:22880643-22880665 AGGGAGGAGGGGAGGAAGGAAGG - Intergenic
1022958247 7:35401183-35401205 AGGCAGAAAGTGAGGCCAGATGG - Intergenic
1023595204 7:41822417-41822439 AGGGAGGAGGAGAGGGAGGAAGG + Intergenic
1023638896 7:42238274-42238296 AGTGAGAAAGAGAGGCTGGGTGG - Intergenic
1023806769 7:43877970-43877992 AGGGACGAGCTGAGGCTGCAGGG - Exonic
1023836289 7:44069825-44069847 AGGGAGAAGGAGAGATAGGAGGG + Intergenic
1023867323 7:44244411-44244433 TGGGAGATGGTGAGGCTGATGGG - Intronic
1023872258 7:44269506-44269528 AGGGAGGAGGAGGGGCTGGGAGG - Intronic
1023884878 7:44347648-44347670 AAGCAGGAGGTGAGGCTGCAAGG - Intergenic
1024217119 7:47256928-47256950 ATGGAGACGGTGAGGGAGGAGGG + Intergenic
1025673199 7:63627374-63627396 AGGTAGAAGGGGAGGGAGGAGGG + Intergenic
1026015389 7:66667459-66667481 AGGGACCAGGTGAGGGAGGAGGG - Intronic
1026133194 7:67636985-67637007 AAGGAGAAGGGGAGGAAGGAAGG - Intergenic
1026405047 7:70056389-70056411 AGGGTGAAGGTGATGAAGGAGGG - Intronic
1026474841 7:70726042-70726064 TGGGAGAAGGGAAGGCTAGAGGG + Intronic
1026767645 7:73170612-73170634 AGGGATAAGGTGAGGCATGGTGG + Intergenic
1026834829 7:73631738-73631760 AGGGAGAAGGGGAGAGAGGAAGG - Intergenic
1026891801 7:73986611-73986633 AGGGACCAGGTGAGGGAGGAGGG - Intergenic
1026904071 7:74052730-74052752 AGGGAGAGAGAGAGGCAGGAAGG + Intronic
1027428246 7:78083343-78083365 AGGGAGAAGGAGATGGTGGGGGG + Intronic
1028223132 7:88219841-88219863 AGGGAGAAGCCGAGGGCGGAAGG + Intronic
1028424026 7:90666054-90666076 TGGCAGAAGATGAGGCTGCAGGG - Intronic
1028623199 7:92846953-92846975 AGGGAGTAGGAGAGGCTGCGAGG - Intergenic
1028664182 7:93321274-93321296 GGTGAGAAGGCGAGGCTGGTAGG - Intronic
1028793262 7:94877078-94877100 AGGAAGAAGGTGAGGCACGGTGG - Intergenic
1029244775 7:99191127-99191149 AGGGAGATGGTGAAGCAGGTGGG - Intronic
1029375396 7:100174279-100174301 AGGCAGAAGGTGAGGCTGGGAGG + Intronic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1029628873 7:101737821-101737843 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
1029704784 7:102270508-102270530 TGGCAGACGGTGAGACTGGAGGG - Intronic
1030189255 7:106794375-106794397 GGAGAGAAGGGGAGGGTGGAAGG + Intergenic
1030468822 7:109937823-109937845 GGGTAGAAGTTCAGGCTGGAAGG + Intergenic
1031213612 7:118861602-118861624 AGGGAGCCAGTGTGGCTGGAAGG + Intergenic
1032023211 7:128421574-128421596 AGGGAGTAGGTTGGGCAGGAGGG - Intergenic
1032491933 7:132330249-132330271 GGGAAGAAGGTGAAGCTGGAGGG + Intronic
1032585201 7:133139988-133140010 AAAGAGAAGGTGGGGCTGGCTGG - Intergenic
1032626390 7:133595983-133596005 GGGGAAAAGGTGGGGCTGGTTGG - Intronic
1032685672 7:134231563-134231585 AGGGAGAACGGGAGGAAGGAAGG - Intronic
1032685719 7:134231699-134231721 AGGGAGAACGGGAGGAAGGAAGG - Intronic
1032685728 7:134231731-134231753 AGGGAGAACGGGAGGAAGGAAGG - Intronic
1033069437 7:138188689-138188711 AGGGAGCAGCAAAGGCTGGAGGG + Intergenic
1033204817 7:139409638-139409660 AGGGAGAAGCTGAGGAGGTATGG + Exonic
1033717639 7:144019142-144019164 AGGGAGCAGTTGATGCTGAATGG + Intergenic
1033772532 7:144568336-144568358 AGAGACAAGATGTGGCTGGATGG - Intronic
1034093107 7:148382158-148382180 AGCCAGAAGCTGGGGCTGGATGG - Intronic
1034293195 7:149948515-149948537 ATGGAGAGGGTGGGGCAGGAAGG - Intergenic
1034417112 7:150971039-150971061 AGGGAGAAGGTGAGGCGTGGTGG + Intronic
1034538386 7:151740120-151740142 AGGGAGCAGGGGCAGCTGGAGGG - Intronic
1034812879 7:154148364-154148386 ATGGAGAGGGTGGGGCAGGAAGG + Intronic
1034995106 7:155572074-155572096 AGGGAGAAAGAGAGGAAGGAAGG + Intergenic
1035036873 7:155901352-155901374 AGGGAGAGGGTGAGGGTGTGGGG + Intergenic
1035535738 8:389914-389936 GGGGAGGAGGAGAGGCTGGTGGG - Intergenic
1035602542 8:905301-905323 GGGGAGAGTGAGAGGCTGGAAGG + Intergenic
1035618252 8:1018201-1018223 AGGGACAAGCTGAGGACGGAGGG - Intergenic
1035819323 8:2575317-2575339 AAGGAGCAGTTGAGGCTGAAAGG - Intergenic
1036111478 8:5907586-5907608 AGGGAGAAAGTGAAGGAGGAAGG + Intergenic
1036138955 8:6188740-6188762 AGTGAGAGGTTGAGGCAGGAGGG - Intergenic
1036213853 8:6863425-6863447 AGGGAGTGGGAGAGGCTGGAGGG + Intergenic
1036497628 8:9283839-9283861 AGGGAGAGGAAGAAGCTGGAAGG - Intergenic
1036752135 8:11450017-11450039 GTGGAGAATGCGAGGCTGGAAGG - Intronic
1037319632 8:17630850-17630872 CAGGAGAAGGCGAGGCTGCATGG - Intronic
1037586587 8:20280879-20280901 AGGTAGAAGGTAAGTCTGGGAGG - Intronic
1037994305 8:23341397-23341419 TGGGAGATAGTGAGGCTGAAAGG + Intronic
1038281957 8:26173844-26173866 ATGGAGAAGGTGAGTTTGCAGGG + Intergenic
1038339333 8:26671276-26671298 AGGGAAAAAGTCAGGCTGGTGGG - Intergenic
1038370400 8:26983413-26983435 AAGGAGAAAATCAGGCTGGAGGG + Intergenic
1038394519 8:27237054-27237076 AGGTGGCAGGTGAGGCTGGCAGG + Intronic
1038411787 8:27364682-27364704 GATGAGAAGGTGGGGCTGGAAGG - Intronic
1038596464 8:28890583-28890605 AGGGAGGAGGGAAGGCGGGAGGG - Exonic
1038680091 8:29658778-29658800 ATGGAGGGGGTGAGGATGGAAGG - Intergenic
1038735096 8:30161576-30161598 AGGGAGCAGGTAAGGCTGGGAGG - Intronic
1039091599 8:33835539-33835561 AGGCTGAAGGAGAGGCAGGAAGG + Intergenic
1039196367 8:35035929-35035951 AGGGAGATTGTGATGATGGATGG + Intergenic
1039347192 8:36719150-36719172 AGGGAGAAAGGAAGGATGGAAGG - Intergenic
1039415536 8:37390711-37390733 AAGGAGATGGTGAGGCGAGAGGG + Intergenic
1039845195 8:41321022-41321044 AGGCTGAAGGTGAGGAAGGAGGG - Intergenic
1040109941 8:43562787-43562809 AGGGGGACGGTGAGGCAGGCGGG - Intergenic
1040330710 8:46384366-46384388 AGGGGGAGGTTGAGGCTGGCAGG + Intergenic
1040483640 8:47850205-47850227 AGGAAGGAGGTGAGCCAGGAAGG - Intronic
1040669285 8:49669198-49669220 AGGAGGAAGGAGAGGCTAGAAGG + Intergenic
1041689098 8:60671940-60671962 GGGGAAAAAGTGAGGATGGAAGG - Intergenic
1041725140 8:61011156-61011178 TGGGGGAAGCTGAGGCAGGAGGG + Intergenic
1042147075 8:65740898-65740920 ATGGAGCAGGTGAAACTGGAGGG - Intronic
1042499391 8:69492038-69492060 GGGGAGTAGGTGAGGCGGGAGGG + Intronic
1042879856 8:73475109-73475131 GGGGAGAGGGTGTGACTGGAAGG + Intronic
1043084360 8:75810600-75810622 AGGGAGGAGGGGAGGAAGGAAGG - Intergenic
1044213847 8:89583965-89583987 AAGAAGAAGGTGAGAATGGATGG - Intergenic
1044586025 8:93869795-93869817 AGGGAGAAGGGGAGGCCGGCAGG - Intronic
1044619116 8:94172000-94172022 CGGGAGAAGGGGAGGGAGGAGGG - Intronic
1045155288 8:99462149-99462171 AGGGAGAAAGGGAGGGAGGAAGG - Intronic
1045558010 8:103233358-103233380 AGGGTGAGGTTGAAGCTGGAAGG + Intergenic
1045755113 8:105533701-105533723 AGGGAGAAAGTAAGGAGGGAGGG - Intronic
1045755159 8:105533848-105533870 AGGGAGAAAGGGAGGAAGGAAGG - Intronic
1046962300 8:120124639-120124661 AGGGAGAAGAGGAGGCTCGAAGG + Intronic
1048165607 8:132059061-132059083 AGGGAGAAAGAGAGGGTAGAAGG - Intronic
1048416473 8:134232697-134232719 AGAGAGAAGGTGAGGGAGAATGG - Intergenic
1048573230 8:135671870-135671892 AGGGTGGAGCTGAGGCTGGGAGG + Intergenic
1048690342 8:136955820-136955842 AGGGAGGAAGTGAGGGAGGAAGG - Intergenic
1049199545 8:141333306-141333328 TGGAGGGAGGTGAGGCTGGAGGG + Intergenic
1049306482 8:141906894-141906916 AGGCCGAAGGTGGGTCTGGAGGG - Intergenic
1049365416 8:142234635-142234657 AGGGAGCTGCAGAGGCTGGAGGG - Intronic
1049469248 8:142768164-142768186 AGGGAGGAGGAGAGGAAGGAAGG + Intronic
1049477160 8:142802086-142802108 AGGGAGGAGGGGTGGGTGGATGG + Intergenic
1049530401 8:143151685-143151707 AGGGAGACAGGGAGGCTGGGTGG - Intergenic
1049533322 8:143167143-143167165 AGGGAGAAAGTGGGGAGGGAAGG + Intergenic
1049583162 8:143421786-143421808 AGGGAGAAGCTGGGGATGGGTGG + Intronic
1049974949 9:852711-852733 AGGGTGAATGTGAGTGTGGATGG - Intronic
1050290169 9:4145749-4145771 AGGGAGAAAGTGAGGGAGGGAGG - Intronic
1050331997 9:4555086-4555108 ATGGAGAAGCTGAGTCTGGGAGG + Intronic
1050490862 9:6186557-6186579 AGGGAGAAGGTGAAGGGGAAGGG + Intergenic
1050788927 9:9441500-9441522 AGGCAAAAGGTGATGATGGAGGG + Intronic
1050941142 9:11459826-11459848 AGGCAAAAAGTGAGGCTTGAGGG - Intergenic
1051250050 9:15150459-15150481 AGGGAGAAGGTGAGTGTGGCTGG + Intergenic
1051666860 9:19474047-19474069 AGGGAGAAAGGGAGGAAGGAAGG - Intergenic
1052711771 9:32065936-32065958 AGGCTGAAGCTGAGGATGGAAGG - Intergenic
1053053046 9:34977269-34977291 AGGGAGGAGGAGAGGCTGAGTGG - Intronic
1053178315 9:35945516-35945538 AGGGAGCTGCTGAGGCTGAAAGG - Intergenic
1053289640 9:36871462-36871484 AGGGTCAAGGTGGGCCTGGAGGG - Intronic
1053652066 9:40178728-40178750 AGCCAGCAGCTGAGGCTGGATGG + Intergenic
1053902457 9:42808042-42808064 AGCCAGCAGCTGAGGCTGGATGG + Intergenic
1054532520 9:66197478-66197500 AGCCAGCAGCTGAGGCTGGATGG - Intergenic
1055297821 9:74852446-74852468 AGGGAGAGGGAGAGGGAGGAGGG - Intronic
1055550940 9:77431737-77431759 AGGGAGACAGTGGGGCTGGAAGG + Intronic
1055882689 9:81020542-81020564 AGGGAGATTGTAAGGCTGGAGGG - Intergenic
1056048899 9:82747336-82747358 AGGTAGAAGGGGAGGGTGAAAGG + Intergenic
1056399081 9:86209549-86209571 AGGAAGCTGGTGTGGCTGGATGG + Intergenic
1056951438 9:91043503-91043525 AGAGAGAAGGGTAGGCAGGAGGG - Intergenic
1057220931 9:93257394-93257416 GTAGAGAAGGTGAGGCTGGAGGG - Intronic
1057389038 9:94627774-94627796 AGGCAGCAAATGAGGCTGGAGGG + Intronic
1057489720 9:95511350-95511372 GGGGAGGAGGAGAGGCTGGAGGG - Intronic
1057604391 9:96488794-96488816 TGTGAGGAAGTGAGGCTGGAAGG - Intronic
1057778796 9:98033423-98033445 AGGGAGGGGGTGGGGCTGGAGGG + Intergenic
1057865191 9:98674792-98674814 AGGGAGACCCTGAGACTGGAGGG + Intronic
1057961095 9:99457826-99457848 AGGGAGAAGGGAAGGAAGGAGGG + Intergenic
1058566051 9:106286562-106286584 AGAGAGAGAGAGAGGCTGGATGG + Intergenic
1058634501 9:107023364-107023386 AGGGAGCTGGTGAGGGTGGATGG + Intergenic
1058944228 9:109841688-109841710 AGGGAAGAGGAGAGGATGGAGGG + Intronic
1058951841 9:109911127-109911149 GGTCAGAAGGTGTGGCTGGATGG + Intronic
1059053950 9:110959265-110959287 ACAGAGAAGGTAAGGATGGAAGG + Intronic
1059116513 9:111604568-111604590 GGGTAGAAGGAGAGGCTGGAAGG - Intergenic
1059365969 9:113786638-113786660 AGGGGGCCGATGAGGCTGGAGGG + Intergenic
1060146753 9:121259603-121259625 GGGGATGAGATGAGGCTGGAGGG + Intronic
1060207470 9:121690693-121690715 AGGGTAAAGGTGAAGCTGGGAGG - Intronic
1060344995 9:122808183-122808205 TGGGATAAGGAAAGGCTGGATGG + Intronic
1060372398 9:123086690-123086712 AGGGAGAAAGGGAGGGTGGGAGG + Intronic
1060419928 9:123461125-123461147 ATGAAGAAGGTGAGGAAGGAAGG - Intronic
1060444996 9:123679741-123679763 AGGCTGCAGGTGAGGCTGCAGGG + Intronic
1060828749 9:126700926-126700948 AGGTGGAAGGTGAGAGTGGAGGG - Exonic
1060967649 9:127720821-127720843 AGGGAGGAGGGAAGGCAGGAGGG - Intronic
1060976869 9:127770233-127770255 GGGGAAGAGGTGAGGCTGCAGGG - Intronic
1061168931 9:128940833-128940855 AAAGAGAAGGAGGGGCTGGATGG + Intronic
1061253633 9:129440904-129440926 AGGCTGAGGGTGGGGCTGGATGG - Intergenic
1061590826 9:131596546-131596568 AAGCACAAGGTGAGTCTGGAGGG - Intronic
1061611515 9:131749772-131749794 AGAGTGGAGGTGGGGCTGGAGGG - Intergenic
1061865742 9:133491023-133491045 AGTGAGAAGGAGAAGCTGGAGGG + Intergenic
1061967579 9:134025050-134025072 ATGGAGGAGGAGGGGCTGGATGG - Intergenic
1062048684 9:134436291-134436313 AGGAAGGAGGGGAGGCTAGAAGG - Intronic
1062062131 9:134502381-134502403 AGGGAGAAGCTGGGGTTGGGGGG - Intergenic
1062081630 9:134627075-134627097 AGGGTCAAGGTGAGGCTGCCAGG + Intergenic
1062141304 9:134960589-134960611 AGCGAGGAGATGAGGCTGGAGGG - Intergenic
1062464988 9:136676947-136676969 AGGGAGAACGTGAGTGTGCAGGG - Exonic
1062480916 9:136750965-136750987 AGGGAGGAGGGGAGGAAGGAGGG + Intergenic
1062729780 9:138102473-138102495 AGTGAGGAGGTGAGGCTCGGGGG + Intronic
1202791927 9_KI270719v1_random:94250-94272 AAGGGGAAGGTGAGGTTTGAGGG + Intergenic
1185756923 X:2659753-2659775 AGGGGGAAGGGGAGGGGGGAGGG - Intergenic
1185972595 X:4681867-4681889 AGGAAGAAGGAGAGGAGGGAAGG + Intergenic
1186038658 X:5452291-5452313 AGGTGGGTGGTGAGGCTGGAAGG + Intergenic
1186684948 X:11916243-11916265 TGGCAGAAAGTGAGGCTAGAAGG + Intergenic
1187176144 X:16897915-16897937 ATGGAGAGAGTGAGGCTGGAGGG + Intergenic
1187444225 X:19346210-19346232 AGGGAGAAGGGGAGGGAGAAGGG + Intronic
1187700857 X:21963260-21963282 AGGAGGAAGGTGAGGATGAAGGG + Intronic
1187740551 X:22350774-22350796 AGGCAGAAGGTGAGGCACAATGG - Intergenic
1187829960 X:23370996-23371018 GGGGAGGAGGAGAGGCAGGAGGG + Intronic
1188138247 X:26516343-26516365 AGGTGGAAGGGGAGGCAGGAGGG - Intergenic
1188596413 X:31906803-31906825 AAGTAGAAGGTGAGGTTGGAGGG - Intronic
1189142348 X:38620036-38620058 AGGGACATGGCGAGGGTGGATGG + Intronic
1189307192 X:39995700-39995722 AGTGAGCAAGTGAGGGTGGAAGG - Intergenic
1189848593 X:45157993-45158015 AGGGAGATCTTGAGGCTGGGGGG + Intronic
1190161969 X:48038703-48038725 AGAGTGAAGGTGATGCTGGAGGG + Intronic
1190185323 X:48228626-48228648 ATGGTGATGGTGAGGCTGGAAGG + Intronic
1190190722 X:48274694-48274716 ATGGTGATGGTGAGGCTGGAAGG + Intronic
1190212811 X:48461162-48461184 TGGGAGAAGGGGACTCTGGAGGG - Intronic
1190427208 X:50345061-50345083 AGGGAGAGAGTGAGGCAGGGAGG - Intronic
1190664860 X:52687299-52687321 ATGGTGATGGTGAGGCTGGAAGG + Intronic
1190674562 X:52771120-52771142 ATGGTGATGGTGAGGCTGGAAGG - Intronic
1190856261 X:54297784-54297806 AAGGAGAAGGTCAGGCTCGATGG + Intronic
1191843862 X:65532038-65532060 AGGGAGAAGGACAGGCTAGAGGG - Intronic
1192053211 X:67746106-67746128 AGGGAGAAAGGGAGAGTGGAGGG - Intergenic
1192808833 X:74532248-74532270 TGGGACAAGGTGAGGCTGATTGG - Exonic
1194348513 X:92796029-92796051 AGGGGGAAGGGGAGGGGGGAAGG + Intergenic
1194739748 X:97558485-97558507 AGGTAGGAGATGAGGCTGGGGGG + Intronic
1194861979 X:99010709-99010731 AGGGAGAAGGGAAGGAAGGAAGG + Intergenic
1194915900 X:99708281-99708303 AGGGTGAAGCTGAGGCAGGGAGG - Intergenic
1195650871 X:107282771-107282793 AAGAAAAACGTGAGGCTGGATGG + Intergenic
1195876826 X:109550758-109550780 AAGGAGAGGGTGAGGCCTGAGGG - Intergenic
1196852426 X:119950089-119950111 AGGGAGAGGGTAAGGAAGGAAGG - Intergenic
1197721039 X:129744832-129744854 AGGGAGAAGGATTAGCTGGAGGG + Intronic
1197903090 X:131394296-131394318 ATAGAGAAGGGGAGGCTGGATGG - Intronic
1198215954 X:134554976-134554998 ATAAAGAAGGTGTGGCTGGAGGG - Intergenic
1198387560 X:136144063-136144085 AGGCAGGAGGTAAGGCTGGCTGG + Intergenic
1198421408 X:136473216-136473238 AGGGAGAGAGAGAGGCAGGAAGG + Intergenic
1198484260 X:137070842-137070864 AGGGAGAAGGAGAGGAGGAATGG - Intergenic
1199377779 X:147133586-147133608 AGGGAGGAGTGGAGGGTGGAAGG + Intergenic
1199419610 X:147629757-147629779 AGGGAGAAACTGAGGCCTGAAGG + Intergenic
1199938863 X:152604541-152604563 AGAGAGATGGTGAGGGAGGAAGG + Intergenic
1200144693 X:153920612-153920634 GTGGAGAAGGTGGGCCTGGAGGG - Exonic
1200253106 X:154564277-154564299 AGAGGGAAGGGGAGGATGGAGGG - Intronic
1200264661 X:154640138-154640160 AGAGGGAAGGGGAGGATGGAGGG + Intergenic
1201146417 Y:11067491-11067513 AGGGAGAGGGTGAGGAAGGGAGG + Intergenic
1201146430 Y:11067535-11067557 AGGGAGAGGGTGAGGAAGGAAGG + Intergenic
1201334890 Y:12869972-12869994 AGGGAGAGAGGGAGGCAGGAGGG - Intergenic
1201769872 Y:17609636-17609658 TGGGAGGAGCTGCGGCTGGAGGG - Intergenic
1201831682 Y:18296351-18296373 TGGGAGGAGCTGCGGCTGGAGGG + Intergenic
1202273903 Y:23096279-23096301 GGGGAGAAGGGGAGGAGGGAGGG + Intergenic
1202292123 Y:23324398-23324420 GGGGAGAAGGGGAGGAGGGAGGG - Intergenic
1202426899 Y:24730024-24730046 GGGGAGAAGGGGAGGAGGGAGGG + Intergenic
1202443892 Y:24940070-24940092 GGGGAGAAGGGGAGGAGGGAGGG - Intergenic