ID: 1103723211

View in Genome Browser
Species Human (GRCh38)
Location 12:122985689-122985711
Sequence GCTGCGCCTGGGCCCACACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 281}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103723207_1103723211 -1 Left 1103723207 12:122985667-122985689 CCAGTGGATGGGGAGGTGGCAGG 0: 1
1: 1
2: 7
3: 74
4: 589
Right 1103723211 12:122985689-122985711 GCTGCGCCTGGGCCCACACCTGG 0: 1
1: 0
2: 1
3: 29
4: 281
1103723200_1103723211 16 Left 1103723200 12:122985650-122985672 CCTGGGAGTGAGGGTGGCCAGTG 0: 1
1: 0
2: 7
3: 52
4: 368
Right 1103723211 12:122985689-122985711 GCTGCGCCTGGGCCCACACCTGG 0: 1
1: 0
2: 1
3: 29
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103723211 Original CRISPR GCTGCGCCTGGGCCCACACC TGG Exonic
900188655 1:1344260-1344282 GCTTGGCCTGGCCGCACACCTGG + Intronic
900539585 1:3196168-3196190 GCGGCAGCTGGGCCCAGACCCGG + Intronic
900651576 1:3732554-3732576 GCGGGGCCTGGGCCCTGACCTGG - Intronic
900988549 1:6087054-6087076 CCTGCCCCCTGGCCCACACCCGG + Intronic
901001663 1:6151912-6151934 TCTGAGCCTGGGCCCAGAGCTGG + Intronic
901053060 1:6435322-6435344 GCTGCCCATGGGGCCAGACCCGG - Intronic
901414139 1:9105379-9105401 GCTGTGCCTTGGCCGACACTGGG + Intronic
901502332 1:9660669-9660691 GCTGAGCGTGGGCACACACTCGG + Intronic
901518706 1:9767191-9767213 GCTGAGCCTGGTTCCTCACCTGG + Intronic
902238506 1:15073344-15073366 CCTGCGACTGAGCCCACACCAGG - Intronic
902925055 1:19690466-19690488 GCTGGGCCTGTGGCCAGACCAGG - Intronic
903012328 1:20339981-20340003 GCAGCGCCTGGCCCAGCACCTGG + Intronic
905483105 1:38275191-38275213 GCTGGGCCTGGGCCCAGGCCCGG + Intergenic
907253339 1:53158447-53158469 GATGCGCCTGCCACCACACCTGG - Intergenic
907387934 1:54138007-54138029 TCTGCCCCTGGGCCCCCACAAGG + Intronic
912515087 1:110212057-110212079 GCAGCGACTGGGCCCCCACGAGG + Exonic
912568670 1:110606627-110606649 ACTGCGCTTGGGCCCGCAGCAGG - Intronic
913395589 1:118367759-118367781 GCTGCTCCTGGCCTCACAGCAGG - Intergenic
913600224 1:120415191-120415213 GCCGCGCCTCGGCCCGCTCCTGG - Intergenic
914192736 1:145425416-145425438 GCCGCGCCTCGGCCCGCTCCTGG + Intergenic
914590642 1:149103364-149103386 GCCGCGCCTCGGCCCGCTCCTGG + Exonic
915234418 1:154470061-154470083 GCCGCCTCTGGGCCCCCACCTGG + Intronic
915368134 1:155326728-155326750 CCTGCCCCTGGGCCCACCTCAGG + Exonic
918210790 1:182349306-182349328 GCTGGGCCTGGGCTGGCACCAGG - Intergenic
920095374 1:203483267-203483289 TCTGCGCCCGGGCCCAGTCCCGG - Exonic
922998698 1:229987672-229987694 GCAGAACCTGGGCCCACTCCCGG + Intergenic
923369362 1:233295325-233295347 GCTGCCCCTGGCCCTGCACCTGG - Exonic
924919385 1:248611900-248611922 GCTGTGTTTGGGCCCAAACCAGG - Intergenic
1063088560 10:2841418-2841440 GCTGCCCCTGAGCCTACACGGGG - Intergenic
1063377060 10:5560830-5560852 GATGGTCCTGGGCCCAGACCTGG + Intergenic
1066654540 10:37686062-37686084 ACTGCCCCTGGGCCCAGCCCTGG - Intergenic
1067039501 10:42941521-42941543 ACTGCCCCTGGGCCCAGCCCTGG - Intergenic
1072690408 10:97569110-97569132 ACTGCGCCTGGCCACAGACCTGG + Intronic
1073483943 10:103804943-103804965 GCAGAGGCTGAGCCCACACCAGG + Intronic
1074565363 10:114572837-114572859 GCTGTGTCTGGGTCCACTCCTGG - Intronic
1076494403 10:130887439-130887461 GCTGGGCCGGGCCCCACTCCTGG - Intergenic
1076548193 10:131260164-131260186 ACAGCGCCTGGGCCCAGGCCAGG + Intronic
1076644991 10:131947182-131947204 GCTGAACCTGGGCACACATCAGG + Intronic
1076700764 10:132271479-132271501 CCTGAGGCTGGCCCCACACCTGG + Intronic
1076769090 10:132653318-132653340 GCTGCGGCTGCCTCCACACCTGG + Intronic
1077473166 11:2774348-2774370 GCTGCTCCTGGGGCCACACTGGG - Intronic
1078845550 11:15115886-15115908 GCTGAGGGTGGGGCCACACCAGG - Intronic
1078914390 11:15765049-15765071 GCTGCTCCTGGGTCCACAACAGG - Intergenic
1083668678 11:64288685-64288707 GCTGCTCCTGGGAGCACAGCCGG + Exonic
1083922041 11:65786513-65786535 GCGCCGCCTGGGCCCAGGCCCGG + Intergenic
1084154306 11:67305004-67305026 GCTCCACATGGGCCCTCACCAGG - Exonic
1084307983 11:68299094-68299116 GCTGCCCCTGGTCCCAGACTTGG + Intergenic
1084488463 11:69464560-69464582 CCTGTGCCTGGGACCCCACCCGG + Intergenic
1086420444 11:86632733-86632755 ACTGCACCTGGGCCCACCCAAGG - Intronic
1089185288 11:116610715-116610737 CCTGGCCCTGGGCCCACACGTGG - Intergenic
1089681641 11:120121977-120121999 GCTGGGGCCTGGCCCACACCAGG + Intronic
1090619452 11:128548639-128548661 GCAGCGCCTGGGCCCCAAGCGGG - Intronic
1092113675 12:5982925-5982947 CCTGTGGCTGTGCCCACACCTGG + Intronic
1092487418 12:8914600-8914622 GCCGCGGCCGGGCCCGCACCCGG + Exonic
1092644723 12:10557916-10557938 GCTGGTCCTGGAACCACACCTGG - Intergenic
1092771630 12:11902398-11902420 TCTGAGCCTGGGCCCCCGCCTGG + Intergenic
1094581181 12:31735549-31735571 GCTGAGCCTGGGCCCAAATCAGG + Intergenic
1096946754 12:55415041-55415063 GCCGCGGCCGGGCCCGCACCCGG - Intergenic
1097049037 12:56209744-56209766 ACCGCGCCCGGCCCCACACCTGG + Intronic
1101377499 12:104183844-104183866 GCTGCCGCAGGGCCCACACAGGG - Intergenic
1101444508 12:104727959-104727981 GCTGTGCCTGGATCCACGCCTGG - Intronic
1101609660 12:106279146-106279168 GCGGGGCCTGTGCCCAGACCAGG + Intronic
1101919264 12:108919312-108919334 CCTGGGCCTGCACCCACACCTGG + Intronic
1101919289 12:108919396-108919418 CCTGGGCCTGCACCCACACCTGG + Intronic
1102513881 12:113433980-113434002 GAGGCCTCTGGGCCCACACCAGG + Intronic
1102959151 12:117080783-117080805 GCTGACCCTGGGCCCCCAACAGG + Intronic
1103719378 12:122965341-122965363 TCTGGGTCTGGGCCCACACCGGG - Intronic
1103723211 12:122985689-122985711 GCTGCGCCTGGGCCCACACCTGG + Exonic
1103968510 12:124655100-124655122 GCTGTGCCTGGGCTCTTACCGGG - Intergenic
1104720490 12:131042654-131042676 GCAGCGCCTGTGACCCCACCGGG - Intronic
1105805209 13:23948376-23948398 GCTGTGGTTGGGGCCACACCAGG - Intergenic
1107655652 13:42590008-42590030 GCCCCTCCTGGGCCCACACGGGG + Intronic
1112336817 13:98523128-98523150 GCTGGTCCAGGGACCACACCTGG + Intronic
1112593474 13:100786037-100786059 ACTGCACCTGGTCCCAAACCAGG - Intergenic
1113768541 13:112894911-112894933 GCTGGGGTCGGGCCCACACCTGG + Intronic
1113950086 13:114066891-114066913 GCTGAGGATGGGCCCCCACCTGG + Intronic
1113950233 13:114067261-114067283 GCTGAGGATGGGCCCCCACCTGG + Intronic
1114080326 14:19198049-19198071 CCTGCACCTGGTCCTACACCTGG + Intergenic
1114650710 14:24282880-24282902 GCTGAGCCTGAGCCTGCACCTGG + Intergenic
1118696598 14:68392355-68392377 GCTGTGCCTTGGTCCTCACCAGG - Intronic
1121410205 14:93744307-93744329 GCGGTGCCTGCTCCCACACCGGG + Intronic
1122093466 14:99354664-99354686 GATGCTCCTGGGCCCATCCCGGG + Intergenic
1122243421 14:100383983-100384005 GCGGCGCCTGGCCCCACCCAGGG - Intronic
1122447587 14:101781169-101781191 GCTGCGGCAGGGTCCCCACCGGG + Intronic
1122514571 14:102297973-102297995 GCTGCGCAGGAGCCCACAGCGGG - Intronic
1123113653 14:105884196-105884218 GCTGGAGCTGGGCCCACACTGGG - Intergenic
1123117904 14:105902945-105902967 GCTGGAGCTGGGCCCACACTGGG - Intergenic
1123120121 14:105912550-105912572 GCTGGAGCTGGGCCCACACTGGG - Intergenic
1123474427 15:20579861-20579883 ACTGCGCCTGGCCCGAAACCCGG - Intergenic
1123664872 15:22600085-22600107 ACTGCGCCTGACCCGACACCAGG + Intergenic
1123705501 15:22947996-22948018 GCTGCCCCTGGTCCCATCCCAGG - Intronic
1123722239 15:23069625-23069647 ACTGCGCCTGGCCCGAAACCCGG + Intergenic
1124574418 15:30895588-30895610 ACTGCGCCTGGCCCCAAACAGGG - Intergenic
1125717573 15:41827927-41827949 CCTGCCCCTGGACACACACCGGG - Intergenic
1128665749 15:69537330-69537352 ACTGGGCCTGGCTCCACACCTGG - Intergenic
1129749585 15:78052095-78052117 GCTGAACCTGGGGGCACACCTGG - Intronic
1129818774 15:78581013-78581035 ACAGTGCCTGGGCACACACCAGG - Intronic
1129983705 15:79897273-79897295 CCTGAGCCTGGGCCCTCACCGGG + Intronic
1131011309 15:89020480-89020502 ACTGCGCCTGGCCTCAGACCAGG - Intergenic
1131259694 15:90882034-90882056 GCTGGTCCTGGGCCCACCTCAGG - Exonic
1132657289 16:1046653-1046675 GCTGTGCCTGGGCCCCACCCTGG + Intergenic
1132747638 16:1443583-1443605 GCTGCACGCGGGCCCGCACCTGG + Exonic
1132953859 16:2580672-2580694 GCTGTGCCTGGACCCTCACGGGG - Intronic
1132960486 16:2619491-2619513 GCTGTGCCTGGACCCTCACGGGG + Intergenic
1133188694 16:4117274-4117296 CCAGCGCCGGGGCCCACACCAGG + Intergenic
1133267664 16:4594565-4594587 TCAGTGCCTGGTCCCACACCTGG - Intronic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1134121143 16:11586169-11586191 GCGGCGTCTGGGCCCAGAGCTGG + Intronic
1134452999 16:14374743-14374765 GCTGCCTCTGGGCTCACACTGGG + Intergenic
1136655757 16:31708225-31708247 TCTGCTCCTGGTCCCACTCCAGG - Intergenic
1137559894 16:49495756-49495778 GCTGAGCCAGGGCCCCCTCCTGG - Intronic
1138478266 16:57284640-57284662 GCAGCGCCTGGAGCCACACAGGG - Exonic
1138658559 16:58504310-58504332 TCTGCACCTGAGGCCACACCTGG + Intronic
1139477010 16:67207804-67207826 GCTGGGCTGGGTCCCACACCGGG - Intronic
1139503216 16:67385478-67385500 GCTGCTCCAGGGCAGACACCAGG - Intergenic
1139513779 16:67441670-67441692 GCAGCGCCAGGGATCACACCTGG - Intronic
1141665515 16:85463367-85463389 GCTGTGCCTGGGCCAACTCTAGG + Intergenic
1141934436 16:87227861-87227883 GCTGGGCCGGGGCCCAGATCTGG + Intronic
1141952499 16:87348051-87348073 GCTGCCCCTGGGCCCTGCCCAGG + Intronic
1142002558 16:87671782-87671804 GCTGGTCCTGAGCCCACTCCAGG + Intronic
1142128318 16:88421024-88421046 TCTGCCCCTGGTCCCACCCCTGG - Intergenic
1142138186 16:88461054-88461076 TCTGCCCCTGGGTCCTCACCAGG - Intronic
1142188337 16:88705539-88705561 GCTGCACCAGGGCTCACAGCCGG - Intronic
1142227386 16:88884265-88884287 CCTGCTGCTGGGCCCCCACCGGG + Intronic
1142254224 16:89006272-89006294 GCTGAGCCTGGGCCGATTCCGGG - Intergenic
1142478773 17:205288-205310 GCAGCGCCCGGCCCCACCCCGGG - Intergenic
1142764737 17:2058766-2058788 GCTGAGCCAGGGCGCTCACCTGG + Exonic
1143527113 17:7479282-7479304 GCTGAGCCTGGCCCCGCCCCCGG - Intronic
1143781114 17:9230260-9230282 GCTGCCTCTGGGCCCACAGCAGG - Intronic
1144789433 17:17849235-17849257 GCTGAGCCTGAGCACACACAGGG + Intronic
1144889826 17:18488250-18488272 GGCGCCCCTGGGCCCACACCAGG + Intronic
1145142388 17:20456067-20456089 GGCGCCCCTGGGCCCACACCAGG - Intronic
1145211403 17:21015830-21015852 GCCTCGCGTGGGTCCACACCAGG + Exonic
1145248563 17:21285126-21285148 CCCCCGCCTGGGCCCTCACCTGG + Intronic
1145793522 17:27642835-27642857 GGCCCCCCTGGGCCCACACCAGG + Intronic
1145808331 17:27750381-27750403 GGCCCCCCTGGGCCCACACCAGG + Intergenic
1146454266 17:32997005-32997027 GCTGGGCCTGGGCCCAGGGCTGG + Intronic
1146846348 17:36183812-36183834 GCTGGGCCTGGGCACTCACCAGG + Intronic
1146909840 17:36641605-36641627 GACGGGCCTGGGCCCACCCCAGG - Intergenic
1147934733 17:44005100-44005122 GCTGCGTCACGGCCCACGCCGGG - Intronic
1148465561 17:47863094-47863116 GCTGCCCCTTGGACCACAGCAGG + Intergenic
1148470259 17:47888883-47888905 GCTGCTCCTGAGCCCAGCCCTGG + Intergenic
1150441577 17:65195862-65195884 GCTGGTCCAGGGCCCACACTGGG - Intronic
1151349180 17:73521584-73521606 CCAGCGCCTGAGCCCACACATGG - Intronic
1152414098 17:80147651-80147673 GCCGCGCCGGGGCCCACCACCGG - Intergenic
1152821245 17:82438975-82438997 CCTTCGCCTGTGCTCACACCTGG + Intronic
1152911262 17:83006047-83006069 GCTGGCCCTGGGCCCTCACTTGG - Intronic
1154197776 18:12278983-12279005 GCTGGGCCAGGCCCCACAGCAGG + Intergenic
1155063156 18:22246482-22246504 GTCGCTCCTGGGCCCACCCCAGG - Intergenic
1158134485 18:54191295-54191317 GCTAATCCTGGGACCACACCTGG + Intronic
1160665770 19:327472-327494 GCTGCCACTGGGCACACGCCCGG + Intronic
1160684448 19:426996-427018 CCTGCCCCTGTGCCCACACCCGG - Intronic
1160775360 19:852860-852882 GCGGTGCCTGGGGACACACCGGG - Exonic
1160790485 19:920640-920662 GCTCCGCCTGGGGTCCCACCCGG + Exonic
1160838601 19:1136357-1136379 GCGGCCCCAGGGCCCATACCAGG - Intronic
1161105687 19:2442925-2442947 GCTGCTGCTGGCCCCGCACCAGG - Intronic
1161115768 19:2495651-2495673 CCTGCCCCTCTGCCCACACCTGG + Intergenic
1161482674 19:4518609-4518631 GCTGGGCCTGGGCCCATGCTGGG - Intergenic
1163724256 19:18913575-18913597 GCTGCCCCTGAGCCCAGGCCAGG + Intronic
1165245416 19:34495771-34495793 GGTGAGCCTGGGCCCACAGGAGG + Exonic
1165470147 19:35998689-35998711 ACTGCGCCTGGCCTCACAACAGG - Intergenic
1165477408 19:36039403-36039425 GCTGCGCCTGGTGCCGCTCCTGG + Exonic
1165766139 19:38352441-38352463 GCTGTGGCTGGACCCACGCCTGG + Intronic
1166181831 19:41114240-41114262 GCTGCGCCTGGGGGCCCTCCTGG - Intergenic
1166333392 19:42091417-42091439 GCTGAGACCAGGCCCACACCAGG + Exonic
1167328792 19:48841271-48841293 GCTGCTCCTGGGCACTCATCCGG + Exonic
924963688 2:57203-57225 TCTGGGCCCAGGCCCACACCTGG - Intergenic
925157436 2:1658506-1658528 CCTGCACCCGGGCCCACAGCTGG - Intronic
925362032 2:3286397-3286419 GCTCCTTCTGGGCCCACTCCTGG - Intronic
925430216 2:3785587-3785609 GCTGGGCCGGGAACCACACCTGG + Intronic
925938991 2:8797073-8797095 GCTGGGGCAGGTCCCACACCTGG - Intronic
926142011 2:10373325-10373347 GCAGGGCCTGGGCCCCCAGCAGG + Intronic
926285271 2:11482848-11482870 GCAGCGCCAGGCCCCGCACCCGG - Intergenic
926326420 2:11788173-11788195 GCTGCTGCTGGGCCCTCAACTGG + Intronic
926625288 2:15085501-15085523 GCTGGGCCTGGGCCTGCATCTGG - Intergenic
927962633 2:27250399-27250421 GCTGCACCGGGGCCCTGACCGGG + Intergenic
928436019 2:31254942-31254964 GCAGTGCCTGGGCCCTCACAGGG - Intronic
929995831 2:46825792-46825814 GCTGGGCCAGGGCCCTCACACGG - Intronic
937313429 2:120916070-120916092 GCTGCTCCAGGGACCACCCCGGG - Intronic
938536269 2:132252355-132252377 GCTGTGCCTGGGGCCCCATCCGG - Intronic
941699780 2:168592294-168592316 GCTGTGCCTCTGCCCACAGCTGG - Intronic
942045902 2:172099262-172099284 GCTGGGCGTGGGGCCGCACCGGG - Intergenic
942083980 2:172427654-172427676 GCTGCGCCCGGCCCCACCCCCGG - Intronic
944221864 2:197310950-197310972 GCTGCCCCCGCGCCCGCACCGGG + Intronic
948489636 2:238304229-238304251 GCTGCGCTTGGGCACCCACCTGG + Intergenic
948896725 2:240931125-240931147 GCTGGCCCTGGGCGCCCACCTGG - Exonic
1168986108 20:2050375-2050397 ACTGCGCCCGGCCCCACACAGGG + Intergenic
1169493246 20:6089283-6089305 CCTCCACCTGGGGCCACACCTGG + Intronic
1170494826 20:16914806-16914828 GCTGGGCCTGGGCCAGCATCTGG - Intergenic
1171022027 20:21593857-21593879 GCTGAGCCTGGACTCAGACCTGG + Intergenic
1172468842 20:35176101-35176123 GGTGGGCCTCGCCCCACACCTGG + Intronic
1173840204 20:46152062-46152084 GCTGCGCCTGTTTCCTCACCTGG + Intergenic
1174344225 20:49917897-49917919 ACTGCGCCTGCTACCACACCCGG - Intergenic
1175381346 20:58566512-58566534 GCTGAGCAGGGGCCCACACTTGG - Intergenic
1175743259 20:61435614-61435636 GCCGAGCCTGGGCCAACACCTGG + Intronic
1175904103 20:62371414-62371436 GCTGCCACTGGGTTCACACCTGG + Intergenic
1176022223 20:62967675-62967697 GGTGGGCCTGGGTCCAGACCAGG + Exonic
1176088394 20:63308305-63308327 GCTCTGGCTGGGTCCACACCCGG + Intronic
1176861511 21:14013763-14013785 GCTGCACCTGGGCCCTGACTCGG - Intergenic
1179710408 21:43209997-43210019 CCTGCCCCTGGGCCAGCACCCGG + Intergenic
1180043631 21:45292929-45292951 GCTGCGTCTGAGCCCAAACAGGG - Intergenic
1180500448 22:15924635-15924657 CCTGCACCTGGTCCTACACCTGG - Intergenic
1180910164 22:19444315-19444337 TCTGCCTCGGGGCCCACACCAGG + Exonic
1181265625 22:21629158-21629180 GCAGCGCCTCGGCGAACACCTGG + Exonic
1181494977 22:23282643-23282665 GCTGGTCCTGGGGCCAGACCAGG - Intronic
1181591894 22:23890399-23890421 GCTGCGTCTGGGACCTCGCCTGG + Intronic
1183310945 22:37109268-37109290 GCTGTGCCTGTCCACACACCTGG + Intronic
1183913037 22:41092771-41092793 GCCGGGCCTGGGCCCAAGCCCGG - Exonic
1184275565 22:43407744-43407766 GCTGCTCCTGGTGCCACTCCTGG - Intergenic
1184620422 22:45672243-45672265 GCGGCGCCTGGGTCCAGGCCGGG - Intronic
1184923890 22:47624334-47624356 GAAGGGCCTGGGCCCACTCCTGG + Intergenic
1185043948 22:48519623-48519645 GCTGCTTCTGGTCCCACTCCAGG - Intronic
1185345390 22:50308412-50308434 GCTGCACCCGGGACCCCACCTGG + Intergenic
1185366658 22:50439963-50439985 GCTGCACCTGGGCCCTGACTCGG - Exonic
949402532 3:3680887-3680909 ACTGCGCCTAGCCCCACAGCTGG - Intergenic
950586553 3:13896156-13896178 GCTGCGCCTCTGCCCTTACCAGG + Intergenic
950645830 3:14376188-14376210 CAGGTGCCTGGGCCCACACCTGG + Intergenic
950764237 3:15261463-15261485 GCTGGGGCTGTGACCACACCTGG + Intronic
952392043 3:32888893-32888915 GCTGAGCCTGTGCCCACAGCAGG + Intronic
954377527 3:50202998-50203020 GCAGCTCCTGCCCCCACACCTGG - Intergenic
954629008 3:52038245-52038267 GCTCAGCCTGGGCCAACATCAGG - Intergenic
955294235 3:57720710-57720732 ACTGCGCCTGGCCACACCCCAGG - Intergenic
956867376 3:73383601-73383623 GCTGCTCCTTGGCCTTCACCAGG + Exonic
957084824 3:75669460-75669482 GGGTCGCCTGCGCCCACACCGGG + Intergenic
960921811 3:122754826-122754848 TCTGCCCGTTGGCCCACACCTGG + Intronic
961334059 3:126159700-126159722 GCTGACCCTGGACCCAGACCAGG - Intronic
961448099 3:126990529-126990551 GCTGGGACTCGGCCCAGACCTGG + Intronic
961653827 3:128430638-128430660 GCAGCACCTGTGCCCACACCAGG - Intergenic
961787464 3:129356406-129356428 GCTGCGCCCGCCACCACACCTGG + Intergenic
961818065 3:129561461-129561483 GCTGGGGCAGGGCCCACACCAGG - Intronic
962181053 3:133206885-133206907 GCTGAAGCTGGGCCCACAGCCGG + Intronic
963524702 3:146403471-146403493 GCTGTTCCAGGGACCACACCTGG + Intronic
967207531 3:187137678-187137700 GCTGTGCCTGCCACCACACCCGG - Intronic
968452577 4:682211-682233 GCTCCCCCTCGGTCCACACCCGG + Exonic
968649200 4:1753718-1753740 GGTGCCCCTCGCCCCACACCTGG - Intergenic
968978593 4:3834752-3834774 GTGGCGACTGGGCCCTCACCTGG - Intergenic
969220344 4:5754919-5754941 GCTGAGCCTGGACCCAGACATGG - Intronic
969227062 4:5805576-5805598 GCAGGTTCTGGGCCCACACCTGG + Intronic
969577903 4:8047115-8047137 GCTGCACGTGGCCCCACATCCGG - Intronic
969598497 4:8162090-8162112 GCTGGCCCTGGGCCGGCACCTGG - Intergenic
971230735 4:24798945-24798967 CCAGCACCTGGGCCCACACCTGG - Intronic
975464400 4:74693089-74693111 GCTGCTCCTGGCCCCACGACCGG - Intergenic
985260721 4:188112445-188112467 GCTGGGCATGCGCCCACGCCCGG - Intergenic
985580832 5:694311-694333 GCTGCGCCTCGGCCTCCTCCAGG - Intergenic
985595454 5:785643-785665 GCTGCGCCTCGGCCTCCTCCAGG - Intergenic
985713824 5:1445106-1445128 GCTGCCCCTGGCCCCGCTCCAGG - Intronic
989568466 5:42924290-42924312 CCTGCGCCTGGGCCTCCTCCTGG - Intergenic
990955420 5:61333777-61333799 GCTGCGCCGCGGCCCGCACAGGG - Intronic
991077364 5:62555790-62555812 ACTGCGCCTGGCCCCACACCTGG + Intronic
991234052 5:64373707-64373729 GCTGCCCCATGGACCACACCTGG + Intergenic
994043699 5:95284988-95285010 GCTGCGCCAGGGACCGCACCCGG + Intergenic
996371098 5:122753471-122753493 GGTGAGCCTGGGGCCACAGCTGG - Intergenic
998228834 5:140346465-140346487 GCTGCGCCTGGGTCCCGGCCAGG - Exonic
1002915251 6:1523662-1523684 GCTGGTCCTGGGCGCTCACCGGG + Intergenic
1006310049 6:33250924-33250946 GCTGCGGCTGGGACAGCACCCGG + Exonic
1006792768 6:36714577-36714599 TTTGCGCTTGGGCCCACTCCAGG + Intronic
1006978327 6:38124404-38124426 GCTGCGCAGGAGCCCACAGCGGG + Intronic
1007470470 6:42086902-42086924 GCTGCGCCTGGCCCGTCACCTGG - Intronic
1012256305 6:97036746-97036768 GCTTCACATGAGCCCACACCTGG - Intronic
1012958745 6:105599542-105599564 GCAGCACCTTGGCCCACACCTGG + Intergenic
1013455972 6:110330047-110330069 GCTGCGCCAGTGCCCACCACCGG - Intronic
1016714058 6:147203946-147203968 GCGGCGCGGGGACCCACACCAGG + Intergenic
1018086603 6:160306510-160306532 GCTGGGTCTGTGCCCACACATGG + Intergenic
1018309418 6:162492660-162492682 ACCGCGCCCGGCCCCACACCTGG - Intronic
1018898874 6:168041053-168041075 GCGGCTCCGGGGACCACACCTGG + Intronic
1019142617 6:169957692-169957714 GCTGCGCCAGGACCCACCGCAGG - Intergenic
1019469602 7:1211695-1211717 GCTCCCCCGGGGCCCACAGCAGG + Intergenic
1019704927 7:2493086-2493108 GCTGTGCCTTGGACAACACCAGG - Intergenic
1020002969 7:4766036-4766058 GCTGAGGATGGGCACACACCGGG - Exonic
1023287715 7:38636679-38636701 GCAGCTCCTGTGCCCTCACCCGG + Intergenic
1023740640 7:43277984-43278006 GCTGCCCCTGGGCTCAGACCTGG + Intronic
1023885285 7:44349651-44349673 GCTGCTCCTGGCCCCATGCCTGG + Intergenic
1024208392 7:47183056-47183078 TCTGTGCCTTGGCCCACACCTGG + Intergenic
1026597825 7:71749201-71749223 GCAGCTCCTGGGACCACACTTGG - Intergenic
1026916112 7:74121199-74121221 CCTGCCACTGGGCCCACAGCTGG + Exonic
1029414780 7:100436016-100436038 GCTGCGGCTCGGACCGCACCGGG + Exonic
1033644183 7:143288277-143288299 TCTGCGCCTGCGCACGCACCGGG + Exonic
1034184262 7:149162469-149162491 ACTGTGCCTGGCCCCACAGCTGG + Intronic
1034269538 7:149796948-149796970 GCTGGTCCAGGGCCCACACCTGG - Intergenic
1035833948 8:2728083-2728105 GCTGCGCAGGAGCCCACAGCCGG - Intergenic
1039486913 8:37917244-37917266 GCTTGGCCTGGGCTCACCCCAGG + Intergenic
1043523754 8:81074027-81074049 TCTGCACGTGTGCCCACACCTGG - Intronic
1043737594 8:83767856-83767878 CCTGCACCTGTGCCGACACCTGG - Intergenic
1048951940 8:139503742-139503764 GCTGCTCCTGAGCCACCACCAGG - Intergenic
1048968783 8:139632499-139632521 CCTGCTCCTGGGCACACAGCTGG + Intronic
1049306736 8:141907990-141908012 GCTGCTTCTGGGCCCAGCCCCGG - Intergenic
1049645364 8:143733591-143733613 GCTACCCTTGCGCCCACACCTGG - Intronic
1049802193 8:144523053-144523075 GCTGGGCCTGGGCGGACACTCGG - Exonic
1049847093 8:144808068-144808090 GCTGCACCTGCGCCTACACACGG + Exonic
1051344996 9:16143554-16143576 GCAGCTCCTGGGCCCTCACCAGG - Intergenic
1052815869 9:33102225-33102247 GCCCTGCCTGGGCCAACACCTGG - Intergenic
1052831727 9:33221338-33221360 ACTGGACCTGGGCCCAGACCTGG - Intronic
1057133361 9:92669907-92669929 CCTGCGCGTGGGCCACCACCAGG + Exonic
1057220854 9:93257058-93257080 GCTGAGCGGGGGCCCCCACCTGG - Exonic
1057272238 9:93657781-93657803 GCTGTCCATGGGCCCACACCAGG - Intronic
1059631464 9:116128189-116128211 GCTGGGCCTGGTCTCCCACCAGG - Intergenic
1060528058 9:124331718-124331740 GCTGCGTCTGTGCCCAGGCCTGG + Intronic
1061779073 9:132985108-132985130 GCTGCACCCAGGCCGACACCAGG - Intronic
1061923523 9:133794980-133795002 GGTGCACCTGAGCCAACACCCGG + Intronic
1062044423 9:134418473-134418495 GGTGTGCCTGGGCCCACAGAGGG - Intronic
1062254452 9:135614493-135614515 GCTGCACCTGGGTCCAACCCAGG + Intergenic
1062283127 9:135760664-135760686 GCCTGGCCTGGGCCCATACCTGG - Intronic
1062321474 9:135992538-135992560 GCTGAGCCTGGCCCCACGCCAGG + Intergenic
1062521538 9:136959907-136959929 GCTGGGCCTGGTCCCCCTCCTGG - Intergenic
1062525162 9:136975275-136975297 GGTGCACCTGGGCCCACCCGAGG - Intergenic
1062538991 9:137033177-137033199 GCCACGCCTGGGACCACACAAGG - Exonic
1062581042 9:137229389-137229411 GCTGCGTCTAGGCCCAAGCCAGG - Exonic
1062590494 9:137272446-137272468 GCTGGGCCTGGGCAGACAGCAGG + Intronic
1062622862 9:137430419-137430441 GCTGCGCCACGGCCGACTCCTGG + Intronic
1185552467 X:994032-994054 GCTGTGCCTGGGTTCACACTGGG - Intergenic
1190554359 X:51618573-51618595 GCTGGACCTGGGCGCACAGCGGG - Intergenic
1200164030 X:154023884-154023906 GCAGCCTCTGGGCCCACATCCGG - Intronic