ID: 1103723975

View in Genome Browser
Species Human (GRCh38)
Location 12:122988899-122988921
Sequence GGGGCTGTATAGCCCCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 80}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103723961_1103723975 21 Left 1103723961 12:122988855-122988877 CCCACCACTTTGCAGCGACTGCC 0: 1
1: 0
2: 1
3: 11
4: 107
Right 1103723975 12:122988899-122988921 GGGGCTGTATAGCCCCAGACAGG 0: 1
1: 0
2: 1
3: 12
4: 80
1103723970_1103723975 0 Left 1103723970 12:122988876-122988898 CCAGGAGGGGCCGTGACTGGGCT 0: 1
1: 0
2: 2
3: 22
4: 161
Right 1103723975 12:122988899-122988921 GGGGCTGTATAGCCCCAGACAGG 0: 1
1: 0
2: 1
3: 12
4: 80
1103723964_1103723975 17 Left 1103723964 12:122988859-122988881 CCACTTTGCAGCGACTGCCAGGA 0: 1
1: 0
2: 0
3: 12
4: 140
Right 1103723975 12:122988899-122988921 GGGGCTGTATAGCCCCAGACAGG 0: 1
1: 0
2: 1
3: 12
4: 80
1103723962_1103723975 20 Left 1103723962 12:122988856-122988878 CCACCACTTTGCAGCGACTGCCA 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1103723975 12:122988899-122988921 GGGGCTGTATAGCCCCAGACAGG 0: 1
1: 0
2: 1
3: 12
4: 80
1103723960_1103723975 22 Left 1103723960 12:122988854-122988876 CCCCACCACTTTGCAGCGACTGC 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1103723975 12:122988899-122988921 GGGGCTGTATAGCCCCAGACAGG 0: 1
1: 0
2: 1
3: 12
4: 80
1103723974_1103723975 -10 Left 1103723974 12:122988886-122988908 CCGTGACTGGGCTGGGGCTGTAT 0: 1
1: 0
2: 0
3: 18
4: 166
Right 1103723975 12:122988899-122988921 GGGGCTGTATAGCCCCAGACAGG 0: 1
1: 0
2: 1
3: 12
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103723975 Original CRISPR GGGGCTGTATAGCCCCAGAC AGG Intronic
900148718 1:1169145-1169167 GGGGCATGAGAGCCCCAGACCGG - Intergenic
901261377 1:7874399-7874421 GGGGCTGTTGAGCCCCAGGGCGG - Intergenic
904839715 1:33364518-33364540 GGAACTGTATAGCCCAAGACAGG + Intronic
905224676 1:36471559-36471581 GGGGCAGGATGGCCCCAGCCTGG + Exonic
905446535 1:38031342-38031364 GGGGATGTAAAGTCCCAGAGAGG + Intergenic
910186685 1:84549252-84549274 AGGGCTTTATATCCCCAAACAGG + Intergenic
915355048 1:155250837-155250859 GGCGCTGTGTAGCACCAGCCTGG + Intronic
917922606 1:179763493-179763515 GGGGCTGAAAAACACCAGACTGG + Intronic
919487703 1:198164308-198164330 GTGGCTGTATGGCCCTAGACCGG - Intronic
920126161 1:203695339-203695361 GGGAATCTTTAGCCCCAGACAGG - Intronic
922725980 1:227923254-227923276 GGGAATGTAGAGCCCCAGCCTGG - Intronic
923534851 1:234841130-234841152 GGGGCTGTCTAGTCCCAAAGGGG + Intergenic
1068687875 10:59888156-59888178 AGGGCTGGAGAGCACCAGACAGG - Intronic
1069534857 10:69245712-69245734 GGGCTTGGACAGCCCCAGACAGG - Intronic
1070354540 10:75626864-75626886 GGGGCTGTAGAAAACCAGACAGG - Intronic
1073065954 10:100759327-100759349 AGGGCTGCATAGCTCCAGCCAGG - Intronic
1075805817 10:125188056-125188078 GAGGCTGGGAAGCCCCAGACAGG - Intergenic
1076469935 10:130711235-130711257 GGGGCTGGACAGCCACAGGCTGG + Intergenic
1083163160 11:60867861-60867883 GGGGCTGGACACCCCCAGGCTGG - Intronic
1083234975 11:61345476-61345498 GGGGCTGTGCAGCCGCAGTCAGG - Exonic
1083310672 11:61782086-61782108 GGGGCTGTATAACCCTGGGCAGG - Intronic
1083335741 11:61920568-61920590 CTGGCTGTGTAGCCCTAGACAGG + Intergenic
1085272183 11:75276981-75277003 GGGGCTGAATATCCCCAACCCGG - Intronic
1103723975 12:122988899-122988921 GGGGCTGTATAGCCCCAGACAGG + Intronic
1105242615 13:18621274-18621296 GGGGGTGCATAGCCCCTGCCAGG - Intergenic
1112065377 13:95787238-95787260 GGGGCTGTATAGGCAGTGACGGG + Intronic
1113010628 13:105761737-105761759 GAGGCTGAAAAGCCCCAGACTGG - Intergenic
1113769159 13:112897552-112897574 GGGGCTGCATGGCCCCCAACAGG - Intronic
1118662858 14:68033800-68033822 GGGGCTGAATCATCCCAGACAGG + Intronic
1119898888 14:78243480-78243502 GGGGCTGCAGCTCCCCAGACTGG - Intronic
1121102421 14:91259109-91259131 AGAGCTGAATAGCCCCAGCCTGG - Intergenic
1123053497 14:105559031-105559053 GGGGCTCCAGAGCCCCAGAGAGG - Intergenic
1123078074 14:105679445-105679467 GGGGCTCCAGAGCCCCAGAGAGG - Intergenic
1123488683 15:20763333-20763355 GGGGGTGCATAGCCCCTGCCAGG + Intergenic
1123545179 15:21332406-21332428 GGGGGTGCATAGCCCCTGCCAGG + Intergenic
1127292126 15:57580344-57580366 GGGAGTGTAAAGCCCCAGAGGGG + Intergenic
1129284722 15:74515270-74515292 GGGGCTGCATACACCCAGAAGGG + Intergenic
1202953525 15_KI270727v1_random:59677-59699 GGGGGTGCATAGCCCCTGCCAGG + Intergenic
1133129166 16:3665638-3665660 GGGGCTGGGGAGCCACAGACAGG - Intronic
1136126542 16:28186699-28186721 GTTGCTGTATCACCCCAGACTGG + Intronic
1138605887 16:58088439-58088461 GGGGCTCTGTAGCCCAAGCCTGG - Intergenic
1143976245 17:10832013-10832035 GTTGCTGTATAGTCCCAGACTGG - Intronic
1145863949 17:28228244-28228266 GGCGCTGTCCAGCCCCAGGCTGG - Intergenic
1147598782 17:41733478-41733500 GGGGAAGTACAGCCTCAGACTGG + Intronic
1149431547 17:56598138-56598160 GGGGCTGTGTCTCCCCAGAGTGG + Intergenic
1153315175 18:3714375-3714397 ATGGATGTATAGCCCCAGAAGGG + Intronic
1154446325 18:14438603-14438625 GGGGGTGCATAGCCCCTGCCAGG + Intergenic
1160015109 18:75134196-75134218 AGGGCTGTATCTCCCCAGGCAGG + Intergenic
1162418630 19:10553196-10553218 CTGGCTGAATGGCCCCAGACTGG - Exonic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
1166291064 19:41863819-41863841 GGTGCAGTGTAGCCCCGGACAGG + Intronic
1168349319 19:55667090-55667112 GGGTCTGTGTGGCCCCAGTCTGG + Intronic
925005702 2:441510-441532 GGCACTGTATAGACACAGACTGG - Intergenic
926623303 2:15068152-15068174 CTGGCTGTATAGCCTCAGGCAGG + Intergenic
927289573 2:21392654-21392676 GGGGCTTCATAGCCTCAGAATGG + Intergenic
928260333 2:29761030-29761052 GGGGCTCTATGTCCCCAGGCAGG - Intronic
931755547 2:65371008-65371030 GGGGCTGAATAGCCACACACAGG + Intronic
936626719 2:114156585-114156607 GGGGCTGCAGATCCCCTGACGGG + Intergenic
937646744 2:124274226-124274248 GGTGCTGAATAGCCACATACTGG + Intronic
937770300 2:125713100-125713122 TGGGTTGTAAAGCCCCAGATTGG + Intergenic
948699090 2:239749366-239749388 GGGGCTGTCCACCCCCAGGCTGG - Intergenic
1168925824 20:1578093-1578115 AGAGCTGTAGAGCCGCAGACTGG + Intronic
1169345351 20:4824038-4824060 GGGCCTGTTTAGCCCCTGTCCGG - Intergenic
1169534773 20:6525983-6526005 AGGGCTGTTGAGCCCCAGAGGGG + Intergenic
1172166906 20:32905063-32905085 AGGGCTGGAGAGGCCCAGACAGG - Intronic
1179162315 21:38908691-38908713 GGGGATCTCTAGCCCAAGACAGG + Intergenic
1180054303 21:45349224-45349246 GGGGCTGTGGGGACCCAGACAGG - Intergenic
1182757045 22:32688722-32688744 GTGGCTGGACAGCCCCAGGCAGG - Intronic
1183190778 22:36320804-36320826 GGTGCTCTCCAGCCCCAGACAGG + Exonic
1184253591 22:43274771-43274793 GGGGCTGCAGAGCCACAGCCTGG + Intronic
950129239 3:10530563-10530585 GGGGCAGTCTGGCCACAGACAGG + Intronic
955522854 3:59791942-59791964 GGAGCTGTGCAGCCCCAGAATGG + Intronic
961332104 3:126148449-126148471 GGAGCTGCACAGCCCCAGACTGG + Intronic
962367802 3:134797346-134797368 GGGGATATATACCCCCAAACCGG + Intronic
966429574 3:179817153-179817175 GGGGCAATATAGCCCCCAACAGG - Intronic
986565580 5:9110355-9110377 GGGTCTGCATCTCCCCAGACAGG + Intronic
986892711 5:12328525-12328547 GGGCCTGTCTAGACCCACACTGG - Intergenic
994393306 5:99209123-99209145 GTGGCTGTATGCCCCCAGCCAGG - Intergenic
999125640 5:149243961-149243983 GGGGCTGCATAGCCCAGGGCTGG + Intronic
1001406716 5:171482048-171482070 AGGGCTGTGCAGCCCCAGCCAGG + Intergenic
1018095851 6:160386555-160386577 GGGGAAGTATAGGCCCAGGCGGG + Intronic
1023879882 7:44312349-44312371 GGGGCTGCAAAGCCCCAGAACGG + Intronic
1024219911 7:47279257-47279279 TGGGCTGTATCCCCCCAGCCTGG - Intronic
1024340270 7:48250463-48250485 GGCGCTGGATAGCCCCAGAATGG - Intronic
1033685951 7:143641627-143641649 GGTCCTGTATACCCCCAGACTGG + Intronic
1033689792 7:143725688-143725710 GGTCCCGTATACCCCCAGACTGG - Intronic
1033698662 7:143815994-143816016 GGTCCTGTATACCCCCAGACTGG - Intergenic
1034109434 7:148521963-148521985 GGGGCTGGCTAGCCACATACAGG + Intergenic
1037890210 8:22620092-22620114 GGGGCTGCTTAGCCCCAGCCAGG - Exonic
1045326843 8:101123435-101123457 GGCGCTGCTTAGCCCCAGGCTGG + Intergenic
1049248918 8:141577805-141577827 GGGGCTGGAGAGCCCCAGGAGGG + Intergenic
1054754730 9:68946298-68946320 GGGGCTGTGTAGCCCTAGACTGG - Intronic
1055215866 9:73861262-73861284 GGGTCTTTATTGCCCCAGAAGGG - Intergenic
1061478871 9:130886573-130886595 GGTGCCAAATAGCCCCAGACTGG + Intronic