ID: 1103727516

View in Genome Browser
Species Human (GRCh38)
Location 12:123005401-123005423
Sequence ATGGCCCAGTTCAATGAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103727516_1103727521 20 Left 1103727516 12:123005401-123005423 CCATCCTCATTGAACTGGGCCAT 0: 1
1: 0
2: 0
3: 14
4: 150
Right 1103727521 12:123005444-123005466 GTGCCTCCTTCTCCAGCTCCCGG 0: 1
1: 0
2: 4
3: 87
4: 545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103727516 Original CRISPR ATGGCCCAGTTCAATGAGGA TGG (reversed) Exonic
906212530 1:44020033-44020055 ATTGCCCATTTCACGGAGGATGG + Intronic
906481239 1:46200440-46200462 CTGGTGCAGTTCACTGAGGAGGG - Intronic
908150730 1:61298816-61298838 AAAGTCCAGTTCAATGAAGATGG - Intronic
912607575 1:111008142-111008164 AAGGCCCTGTCCAGTGAGGAAGG - Intergenic
913966430 1:143381214-143381236 AGGGCCCAGTCCAAGGAGAAGGG + Intergenic
914060804 1:144206821-144206843 AGGGCCCAGTCCAAGGAGAAGGG + Intergenic
914118346 1:144759548-144759570 AGGGCCCAGTCCAAGGAGAAGGG - Intergenic
914987034 1:152469592-152469614 AGGGCCCACTTCATGGAGGAGGG - Intergenic
915676663 1:157538377-157538399 ATGGCCAGGTTCAATGTTGAAGG - Intronic
918440911 1:184566277-184566299 ATGGCCCAGTTTACTGTGGCGGG - Intronic
920224489 1:204428262-204428284 ATGGCCCAATACAAAAAGGAAGG + Intronic
922535821 1:226379921-226379943 AAGGGCCAGGTCAAGGAGGAAGG - Exonic
923211430 1:231807393-231807415 ATGGACCAGATCAATAATGAGGG - Intronic
923532369 1:234821635-234821657 ATGGCACAGAAGAATGAGGATGG + Intergenic
1065875172 10:29991607-29991629 ATGTCCCAGCTCAAACAGGAAGG + Intergenic
1068476630 10:57535405-57535427 ATGTCCCAGCTCAGTGAGGCTGG - Intergenic
1069750877 10:70744256-70744278 GTGGCACAGTTCAAGGAGGGAGG - Intronic
1071092024 10:81930025-81930047 AAGGCCCAGTGCATTGAGGCTGG - Intronic
1073322890 10:102626289-102626311 ATGGCCCAGCAGATTGAGGAAGG + Intronic
1075781871 10:125022432-125022454 AGGGGACAGGTCAATGAGGAAGG + Intronic
1075781887 10:125022514-125022536 AGGGGACAGGTCAATGAGGAAGG + Intronic
1078610694 11:12816618-12816640 GTGGGCCAGTGCAAGGAGGAGGG + Intronic
1090334193 11:125951768-125951790 ATGGCCCTGTGGAAGGAGGAAGG - Intergenic
1091104712 11:132907842-132907864 ATGTCACAGTTCAGTGGGGAAGG - Intronic
1092559267 12:9593208-9593230 AAGGCACATTTCCATGAGGAAGG - Intergenic
1092705658 12:11281655-11281677 ATGCTCAAGTTCCATGAGGAAGG + Intergenic
1092713244 12:11360177-11360199 ATGGCCCCAATCACTGAGGATGG - Intronic
1094610619 12:31992130-31992152 ACAGCCCAGGGCAATGAGGATGG + Intronic
1100969150 12:100048600-100048622 AGGACCCAATTTAATGAGGAAGG - Intronic
1103727516 12:123005401-123005423 ATGGCCCAGTTCAATGAGGATGG - Exonic
1104986694 12:132601382-132601404 ATGGCTCACTTCCATGGGGACGG + Intergenic
1109125965 13:58517302-58517324 ATGACTAAGTTCAGTGAGGAAGG + Intergenic
1112380167 13:98881589-98881611 GTTGCCCAGTGCCATGAGGAAGG - Exonic
1113520675 13:110938273-110938295 AAGGGCCAGGTCAAGGAGGAAGG + Intergenic
1114403937 14:22436373-22436395 ATGGCCCAGACAGATGAGGATGG - Intergenic
1114568229 14:23647807-23647829 GTGGCCCAATTCCATGAGGAAGG - Intergenic
1116251562 14:42490661-42490683 GTGGTCCAGTTCAATGACTAAGG + Intergenic
1116278456 14:42869059-42869081 CTGTCCCAGCTCAATCAGGAAGG + Intergenic
1117554281 14:56868721-56868743 AGGGCAGGGTTCAATGAGGAAGG - Intergenic
1118861725 14:69669390-69669412 ATTGCCTAGTTCAAGGAGGGAGG + Intronic
1119568831 14:75651844-75651866 ATGCCCCAGGGCAAGGAGGAAGG + Exonic
1122124520 14:99571926-99571948 AGGGCCTAGCTCAATGAGGCAGG - Intronic
1125129283 15:36262795-36262817 ATGGCCTAGTTCACTGCAGATGG - Intergenic
1135697724 16:24604811-24604833 ATTGCCCACTTCAATGTGGGTGG - Intergenic
1136479636 16:30533471-30533493 ATGGCCAAGTTCAGTGGGGCTGG + Intronic
1136483414 16:30556430-30556452 ATGGCCAAGTTCAGTGGGGCTGG + Intronic
1137983607 16:53090060-53090082 ATCCCCCAGTCAAATGAGGATGG + Intronic
1138199710 16:55079613-55079635 ATGGACCCGTCCAATAAGGAGGG - Intergenic
1139825943 16:69757250-69757272 ATGGACCAGTTAGATGATGAAGG - Intergenic
1140955914 16:79865142-79865164 ATGGGCAAGTTTAATGCGGAAGG - Intergenic
1142141102 16:88473252-88473274 ATGGCCCACTTGGAAGAGGATGG + Intronic
1143250804 17:5521735-5521757 ATGGCCCACTTTAAAGAGGAGGG - Exonic
1144730469 17:17523117-17523139 CTGGCCCAGCACACTGAGGAAGG + Intronic
1146592998 17:34144982-34145004 ATGGCCGGGTTCCATGTGGAGGG - Intronic
1147313045 17:39606370-39606392 TTGGCCGAGGTCAAGGAGGAAGG - Exonic
1148572485 17:48681253-48681275 ATGTTCCAGATCTATGAGGAGGG - Intergenic
1148777768 17:50105292-50105314 AAGGCCCAGTTGAATGAAGTGGG + Intronic
1149374630 17:56031697-56031719 ATGGCTGAGTAAAATGAGGAAGG + Intergenic
1149663303 17:58347919-58347941 AGGGCCTAGTGCAAAGAGGAGGG + Intronic
1150196500 17:63304806-63304828 GAGGCCCCGTGCAATGAGGAGGG + Intronic
1151393748 17:73805462-73805484 ATGCCCCAGAACAATGATGAGGG + Intergenic
1151647254 17:75441742-75441764 ATAGCCCTGTTCAATGTGGAGGG - Intronic
1153432293 18:5030946-5030968 ACGTCCTAGTTCAAAGAGGAAGG + Intergenic
1154103460 18:11498963-11498985 ATGGTCCAGTAAGATGAGGAGGG - Intergenic
1157453361 18:47804466-47804488 ATAGCCCAGGTCAAAGATGATGG - Intergenic
1160683809 19:424326-424348 AACGCCCAGTCCAATGAGGGAGG - Intronic
1161575663 19:5052941-5052963 ATGCCCCAGGTCACTGAGGGGGG - Intronic
1163845616 19:19636801-19636823 GTGGCACAGGTCAATAAGGATGG + Intronic
1166342983 19:42149935-42149957 AGGGCCAAGTTCAGTGTGGAAGG + Intronic
1167857037 19:52250473-52250495 ATGTCCCAGCTCAAGCAGGAAGG - Intergenic
1202700212 1_KI270712v1_random:158709-158731 AGGGCCCAGTCCAAGGAGAAGGG + Intergenic
925921183 2:8639053-8639075 AGGGCCCAGTTCCAGGAGGAAGG + Intergenic
926537894 2:14136054-14136076 ATGGTCAAGTTTAGTGAGGAAGG + Intergenic
926779931 2:16461300-16461322 ATGTCCCAGCTCAAGCAGGAAGG + Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
929742314 2:44615553-44615575 ATGATGCAGTTCACTGAGGAGGG + Intronic
930236077 2:48890078-48890100 ATCGCCCAGATCAATAAGCAGGG - Intergenic
932804005 2:74767564-74767586 ATGGCCCAGCTTCATGAAGAAGG - Intergenic
934099229 2:88636190-88636212 ATGGCCAAGTTCAAAGTGCAGGG + Intergenic
934171144 2:89542184-89542206 AGGGCCCAGTCCAAGGAGAAGGG + Intergenic
934281450 2:91616502-91616524 AGGGCCCAGTCCAAGGAGAAGGG + Intergenic
934779610 2:96961182-96961204 ATGACCCATTGAAATGAGGATGG + Intronic
936147465 2:109990246-109990268 ATGGCCCAATTCCTTCAGGAAGG - Intergenic
936197227 2:110381195-110381217 ATGGCCCAATTCCTTCAGGAAGG + Intergenic
939810759 2:146829350-146829372 ATGCCCAATTTCAGTGAGGAAGG - Intergenic
940089034 2:149895622-149895644 GAGGCACAGTTCAAAGAGGACGG - Intergenic
940894535 2:159067794-159067816 ATGGCACTGGTCAAAGAGGATGG - Intronic
942672470 2:178390662-178390684 ATGGCCAAATTTTATGAGGAGGG - Intronic
943210992 2:184965689-184965711 AGTGACCACTTCAATGAGGAGGG + Intergenic
944283077 2:197920866-197920888 ATTTCCCAGCTCAATGAGAAAGG + Intronic
947849292 2:233272216-233272238 GTGGCCCAGAAAAATGAGGAAGG + Intronic
1172586357 20:36087949-36087971 ATGGGCAAGTTCTATTAGGAAGG - Intergenic
1173281306 20:41630859-41630881 ATGTCCCAGTTCAAGGAGAGGGG - Intergenic
1175329341 20:58152318-58152340 AGGGCCCTATTCAAAGAGGAGGG - Intronic
1177215016 21:18116879-18116901 GTGGCCCAGATGAATGAGCAAGG + Intronic
1177923335 21:27182576-27182598 ATGTCCCAGTTCAATAAAGAGGG + Intergenic
1178035245 21:28575324-28575346 ATGGCCCAGTTCAAGCAGTCAGG + Intergenic
1178195035 21:30334951-30334973 ATGGCCCTCTCCAATGTGGATGG - Intergenic
1179629970 21:42671169-42671191 GGGGCCCAGTTCAAGCAGGAGGG + Intronic
1181086183 22:20440485-20440507 AGGGCCCAGGACAGTGAGGAAGG + Intronic
1182085995 22:27561582-27561604 ATGGCCCTGCCCCATGAGGATGG + Intergenic
1182425004 22:30267134-30267156 CTGGCCCAGTTCCCTGAAGATGG - Intergenic
1182461990 22:30489826-30489848 ATGATCCAGTCCACTGAGGATGG - Exonic
1183958382 22:41396224-41396246 ATGTCCCAGTTGAATCAGAAGGG + Exonic
1184379834 22:44138360-44138382 ATGGCCCTGAGCAGTGAGGAAGG + Intronic
952237979 3:31499905-31499927 ATGTCCCACATCAATGAGGCAGG - Intergenic
952969735 3:38643357-38643379 TTGGCCCAGGTCGATGAGGCTGG + Intronic
953163539 3:40444021-40444043 ATGGCACAGTTGAAATAGGATGG - Intergenic
954596513 3:51829934-51829956 AAGGCCCAGGAGAATGAGGAGGG + Intronic
955992119 3:64639200-64639222 ATGTCCCTGTTAATTGAGGAAGG - Intronic
956130357 3:66047474-66047496 ATGGCACAGTTCAAGGAGCAAGG - Intergenic
961739623 3:129024988-129025010 ATGGCACACTTCACTGAGGGAGG + Intronic
962959887 3:140301003-140301025 ATGTCCCAGCTCAAGCAGGAAGG + Intronic
964296441 3:155239471-155239493 ATGGCACATTAGAATGAGGATGG - Intergenic
964645674 3:158956449-158956471 ACGCCCCAGTACAATGAGGGTGG - Intergenic
964809047 3:160642398-160642420 ATGAAGCAGTTCAATAAGGAGGG + Intergenic
969028620 4:4193704-4193726 AGGGCCCAGTCCAAGGAGAAGGG - Intronic
970710720 4:18859200-18859222 TTGGCCCAATACAATGAAGAGGG - Intergenic
972933534 4:44104213-44104235 ATGGCACAGTACAGTGAGGAGGG + Intergenic
973262306 4:48177541-48177563 ATGGCCCAGGTGAATGAGGCAGG - Intronic
974108883 4:57503172-57503194 ATGGCCCATTCCAATGAAGTGGG + Intergenic
978262454 4:106776615-106776637 ATGGCCCAGTTCCATAGGGAAGG - Intergenic
980350144 4:131673763-131673785 AAAGCCCAGATCAATCAGGAAGG - Intergenic
983645368 4:169984847-169984869 CTGGCCCAGTTCATTGAAAAAGG - Intergenic
984096406 4:175440496-175440518 ATTGCCCAGTTGAATGATGATGG + Intergenic
986002894 5:3643985-3644007 ATGGCCCAGTTAAATGTGTTTGG - Intergenic
988307363 5:29509699-29509721 ATGGCCCAATCCATTGATGAGGG - Intergenic
988401791 5:30771584-30771606 ATGGCACTGTTCAATGAGAAGGG + Intergenic
989490232 5:42042784-42042806 ATGACCCAGTTCCTTGAGCATGG - Intergenic
992025221 5:72663233-72663255 ATGGGGCAGTGCAATGAGAAGGG - Intergenic
992079120 5:73217349-73217371 ATGGCCCAGGAAAAGGAGGAGGG + Intergenic
992154412 5:73940704-73940726 ATGGCCAAGCCCAATGAGAAAGG - Intronic
998225831 5:140325545-140325567 TTTTCCCAGTTTAATGAGGAGGG - Intergenic
998343993 5:141444622-141444644 ATGCACCAGTTCATTGAGGTAGG + Intronic
998462410 5:142319580-142319602 CTGGCCCAGGTCTGTGAGGAAGG + Intronic
1003288791 6:4760200-4760222 ATGCCCCAGTCCAAAGTGGATGG + Intronic
1006696004 6:35931379-35931401 CTGGCCCCGGACAATGAGGAGGG + Intergenic
1014581140 6:123138576-123138598 ATTGCACTGTTCAATCAGGATGG - Intergenic
1016720906 6:147296076-147296098 ATGGTCCTGTACAATGAGGGAGG + Intronic
1018598215 6:165507314-165507336 GTAGCCCAGTACAAGGAGGAAGG + Intronic
1019059784 6:169248745-169248767 ACGGCCCAGCTCAAGCAGGACGG - Exonic
1020001760 7:4760066-4760088 AGGGCCCTGTTCAACAAGGAAGG - Intronic
1020961032 7:14801598-14801620 ATGTCCCAGCTCAATCAGGCAGG - Intronic
1021183187 7:17532564-17532586 TTGCCTCTGTTCAATGAGGACGG + Intergenic
1026536405 7:71242139-71242161 CTTGCTCAATTCAATGAGGAGGG + Intronic
1027560633 7:79724492-79724514 ATGGCCTACTTCAAAGAAGAAGG + Intergenic
1030319524 7:108150016-108150038 AATGGCCAGTTCAATGAGGATGG - Exonic
1036529501 8:9570487-9570509 ATGGCCCAGTGGCATTAGGATGG + Intronic
1040052238 8:43027183-43027205 ATGGCCAAGTTCACTGGGCATGG - Exonic
1040480621 8:47823042-47823064 ATGGCCCACTTCATTCATGAGGG - Intronic
1044069088 8:87733799-87733821 ATGGCCCAGTTCCTTGAGGTTGG - Intergenic
1047175868 8:122539827-122539849 TCAGCCCTGTTCAATGAGGAGGG - Intergenic
1047799846 8:128297426-128297448 ATGGCCGAGGTGAATGAAGATGG - Intergenic
1049759096 8:144323847-144323869 AGGGCCAAGCACAATGAGGAGGG + Intronic
1050178168 9:2891119-2891141 ATGTCCCAGTTCAAGCAGGCAGG + Intergenic
1051593111 9:18796375-18796397 ATGGCCCAGATCTGAGAGGATGG - Intronic
1052500595 9:29284665-29284687 ATGTCCCAGTTCAATAAGTCAGG - Intergenic
1055705892 9:79003286-79003308 ATAGTCCAGTTCAAAGATGAGGG - Intergenic
1056691211 9:88810301-88810323 ATGGGCCAGTTCTGTGGGGATGG + Intergenic
1060989404 9:127839476-127839498 AAGGCCCAGCTCCATGAGGCTGG + Intronic
1062444392 9:136587601-136587623 AGGGCCCATTTCAGAGAGGAGGG - Intergenic
1190268060 X:48840859-48840881 ATCGCCCAGGTCATTCAGGAGGG - Intergenic
1190481567 X:50882491-50882513 ATGTCCCTGTTCAAGAAGGAAGG + Intergenic
1194970929 X:100343089-100343111 ATGTCCCAGTTCAAGCAGTAAGG - Intronic
1198491841 X:137148938-137148960 ATGGCCCAGTTTTATTATGATGG + Intergenic