ID: 1103729043

View in Genome Browser
Species Human (GRCh38)
Location 12:123013856-123013878
Sequence AAGACTCCTCCACCACCCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103729034_1103729043 20 Left 1103729034 12:123013813-123013835 CCAAAGCAGGCGCACCTGGTTCG 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1103729043 12:123013856-123013878 AAGACTCCTCCACCACCCGCAGG 0: 1
1: 0
2: 0
3: 7
4: 121
1103729040_1103729043 6 Left 1103729040 12:123013827-123013849 CCTGGTTCGGGTGTAGGGGTAGG 0: 2
1: 0
2: 0
3: 9
4: 146
Right 1103729043 12:123013856-123013878 AAGACTCCTCCACCACCCGCAGG 0: 1
1: 0
2: 0
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103729043 Original CRISPR AAGACTCCTCCACCACCCGC AGG Exonic
901514899 1:9738497-9738519 AAGACTCCCCCACAACACGCTGG + Intronic
901679500 1:10904885-10904907 AAGACTCCCGCAGCACCCCCAGG + Intergenic
912048321 1:105489802-105489824 GAGCCTCCTCAACCACCCACTGG - Intergenic
914256085 1:145961941-145961963 AGGTCTCCTCCACCCCACGCTGG - Intronic
917591338 1:176480103-176480125 CAGACCCCTCCCCCACCAGCCGG - Intronic
917905831 1:179586615-179586637 GAGCCTCCTCCACCCGCCGCGGG + Intergenic
920388332 1:205583161-205583183 AAGCCTCCACCACCTCCCTCAGG - Intronic
923110159 1:230883846-230883868 AGAACTCCTCCACCACGCACAGG - Intergenic
1063475982 10:6329504-6329526 AAGACATCTCTACCACCCGGTGG + Intergenic
1065151995 10:22831512-22831534 AAGAGTCCTGCACAGCCCGCTGG - Intergenic
1069542678 10:69307267-69307289 AAGTCTCCACCCCCACCCCCCGG + Intronic
1069615090 10:69801816-69801838 ACTCCTCCTCCACCTCCCGCGGG - Intergenic
1072208398 10:93224553-93224575 AAGACACCAGCACCACCCGATGG + Intergenic
1076637744 10:131893355-131893377 CGCACCCCTCCACCACCCGCCGG + Intergenic
1077207175 11:1350217-1350239 ATGCCTCCTCCACCTCCCCCAGG + Intergenic
1083945289 11:65919758-65919780 AACTCTGCTCCCCCACCCGCAGG + Exonic
1084329681 11:68423151-68423173 AGGCCTCCTCAGCCACCCGCCGG - Intronic
1089607221 11:119648469-119648491 CAGACTCTTCCAGCACCAGCAGG + Intronic
1089696850 11:120221186-120221208 CAGCCTCCTCCACCATCCCCTGG + Intronic
1093913990 12:24779704-24779726 AAGCCTCCTCCACCACTCAAGGG - Intergenic
1098275435 12:68807776-68807798 AAGCCCACTCCACCAGCCGCTGG - Intergenic
1100287892 12:93184724-93184746 AAGACTAATCCACCATCCACAGG + Intergenic
1103041250 12:117697299-117697321 AAGCCTCCTCCACCCCCAGAGGG + Intronic
1103486811 12:121288645-121288667 AATGCTCCTACCCCACCCGCTGG + Intronic
1103729043 12:123013856-123013878 AAGACTCCTCCACCACCCGCAGG + Exonic
1103852814 12:123944172-123944194 CAGACACCTGCACCACCCCCTGG - Intronic
1103953620 12:124565276-124565298 CAGACTCCCCCGGCACCCGCTGG + Intronic
1104720974 12:131045125-131045147 ACGCCTCCCACACCACCCGCGGG + Intronic
1105247414 13:18665991-18666013 AAGGCTCCTCCACCAGCCAGGGG + Intergenic
1107276840 13:38688037-38688059 AGAACTCCTCCACTACCCGCAGG + Exonic
1110985923 13:81968216-81968238 GATACTCCTCCACCAACCTCAGG - Intergenic
1112570381 13:100588584-100588606 AGGCCTCCTCCCTCACCCGCGGG + Intronic
1120738339 14:88079900-88079922 GAGACTCCTCCACCACCTTTGGG - Intergenic
1121293187 14:92794343-92794365 AAACCTCCTCCCCGACCCGCCGG - Exonic
1122529299 14:102414650-102414672 ATGGCTCCTCCAACACCAGCTGG - Exonic
1130963246 15:88678946-88678968 AAGCCTCCCCTGCCACCCGCAGG + Intergenic
1131048332 15:89330239-89330261 AACGCTCTTCCACCAGCCGCTGG + Exonic
1132352831 15:101150561-101150583 AAGCCAACTCCACCACTCGCTGG + Intergenic
1132577913 16:672395-672417 TAGACTCCCCCACCACCCCAGGG + Intronic
1135073792 16:19375763-19375785 TAGCCTCTTCCACCACCTGCTGG + Intergenic
1136537260 16:30907370-30907392 AAGACTCCTCCATGGCCCGAGGG - Intergenic
1137687601 16:50397386-50397408 ATGACTCACCCACCACCCCCTGG - Intergenic
1139428797 16:66900166-66900188 AAGCCCCCTCCCCCACCCTCTGG - Intergenic
1142275370 16:89115748-89115770 GAGACACCACCACCGCCCGCTGG - Intronic
1147911577 17:43859192-43859214 AAGACTCCTCCCCCAGACTCAGG + Intronic
1150134498 17:62688574-62688596 AAGGCTCCTGCTCCACCCACTGG - Exonic
1152039603 17:77894344-77894366 AAGACCCCTTCAGCACCCTCTGG - Intergenic
1154441430 18:14393131-14393153 AAGGCTCCTCCACCAGCCAGGGG - Intergenic
1157727927 18:49979101-49979123 GAGGTTCCTCCACCACCCCCTGG + Intronic
1160225520 18:77008385-77008407 AAAACACCACCACTACCCGCAGG - Intronic
1160376150 18:78414239-78414261 AAGACTCCTCCATAGCCCCCAGG + Intergenic
1160537126 18:79600700-79600722 GAGACTCTTCCCCCACCCACAGG + Intergenic
1160537167 18:79600820-79600842 CAGACCCTTCCCCCACCCGCAGG + Intergenic
1160820074 19:1053793-1053815 CACACTCCTCCACCACCTTCAGG - Exonic
1161531506 19:4792621-4792643 AAGACCCCTCCACCAGCCAGGGG + Exonic
1162494070 19:11013498-11013520 AGGACTGCTCCACCAGCCTCGGG + Intronic
1164508404 19:28878024-28878046 AAGGCCCCTCCACAACCCTCTGG + Intergenic
1165577658 19:36835543-36835565 AAGACTCCTCCACAACACTGAGG + Intronic
1165716032 19:38046425-38046447 AAGACTCCACCACCACCCCACGG - Intronic
1165937381 19:39397658-39397680 AAGACACCCGCACCACCTGCTGG + Exonic
1167072146 19:47227647-47227669 AAGACTCCCCCACCTCCCCGAGG + Intronic
925730045 2:6913242-6913264 CAGGCTCCTCCACCAGCTGCCGG + Intergenic
928198066 2:29229051-29229073 CAGCCACCTCCACCACCTGCGGG + Exonic
929501317 2:42493716-42493738 AGGACTCCCCGGCCACCCGCAGG - Exonic
929538967 2:42805036-42805058 CAAACTCCTCCACCATCCGCAGG - Intergenic
931434449 2:62234910-62234932 AAAACTCCACCACCTCCCCCAGG - Intergenic
931665338 2:64606442-64606464 AAGGCTCCTCCTCCACCTGTGGG - Intergenic
932134909 2:69219839-69219861 CAGACTCCTCCACCATCAGAAGG + Intronic
932340259 2:70958996-70959018 AACACTCCTCGTCCACCCTCAGG + Exonic
932774012 2:74516312-74516334 AGGGCTCCTCCACCACCGGCCGG + Exonic
932934639 2:76088304-76088326 AAAACTCTTCCACCAGCCACGGG + Intergenic
936057211 2:109270146-109270168 AACACTCCTCCAACACCCCCAGG - Intronic
937670639 2:124533932-124533954 TAGGCACCACCACCACCCGCAGG - Intronic
940000622 2:148963584-148963606 AAGAATCATCCACCAGCCTCAGG - Intronic
940369014 2:152879342-152879364 AAGTCTCCTCTACCAGACGCAGG - Intergenic
941138589 2:161747418-161747440 AAAACTCCTCCCCCATCCCCTGG - Intronic
941227540 2:162867844-162867866 AACACTCCTCCCCCACCCCTTGG + Intergenic
1172624801 20:36340824-36340846 ATGCCTCCCCCTCCACCCGCTGG - Intronic
1175429274 20:58890986-58891008 AGGCCTCCTCCCCCTCCCGCGGG - Intronic
1175967417 20:62666394-62666416 AAGGTGCCGCCACCACCCGCTGG - Exonic
1176454627 21:6898044-6898066 AAGGCTCCTCCACCAGCCAGGGG + Intergenic
1176832800 21:13763092-13763114 AAGGCTCCTCCACCAGCCAGGGG + Intergenic
1178462715 21:32817585-32817607 AACACTTGTCCACCACCCGTTGG - Intergenic
1180993522 22:19953098-19953120 AAGACTCCCCCATCACACTCCGG - Intronic
1181758942 22:25044420-25044442 CCGACTCCCCCACCACCAGCGGG - Intronic
1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG + Exonic
1185192758 22:49448971-49448993 AGGACTCCTCCACCCCGGGCAGG + Intronic
950259490 3:11534066-11534088 AAGCCTCCTCCTCCCCCCCCAGG + Intronic
953484630 3:43283992-43284014 AAGACTCCTTCACCACCCTATGG - Intergenic
954105668 3:48408643-48408665 CAGACACCTCCACCACCCTAAGG + Intronic
954910640 3:54104421-54104443 AAAACCACTCCACCACCCACAGG + Intergenic
957927766 3:86836862-86836884 AAGAAGCCTCCACCATCCACTGG + Intergenic
962372231 3:134830476-134830498 AAAACTCCCCCACCATCCTCAGG - Intronic
964480007 3:157130610-157130632 ATAACTCCTGCCCCACCCGCTGG + Intergenic
969392962 4:6902864-6902886 AAGTCTCCTCCCCCAACCTCAGG + Intergenic
969566938 4:7984324-7984346 AAGGCTCCCCCGCCACTCGCGGG + Intronic
971371033 4:26019097-26019119 AAGCCTCCTCCAGCATCCACTGG + Intergenic
975796873 4:78015391-78015413 AGGACTCCTCCAGCAGCTGCTGG + Intergenic
975985196 4:80196550-80196572 TCCCCTCCTCCACCACCCGCTGG + Exonic
979445837 4:120810118-120810140 AAACCTCCTCCCCCACCCCCTGG + Intronic
1002456457 5:179347892-179347914 AAGTCTCCTCCACCTCCCTGAGG - Intergenic
1008393103 6:50975745-50975767 AGGACTCATCCACCATCCCCTGG - Intergenic
1011653604 6:89529811-89529833 CTGACTCCTCCACCAACCCCTGG - Intronic
1017816807 6:158022108-158022130 GAGCCTCCCCCGCCACCCGCAGG - Intronic
1018912378 6:168109360-168109382 AAGACTCCGCCGCCAGCCGATGG + Intergenic
1029024908 7:97406100-97406122 GAGACTCCTCCAGCTCCTGCTGG + Intergenic
1033673163 7:143511987-143512009 CCGACTCCTCCTCCACGCGCAGG - Intergenic
1034003576 7:147443388-147443410 GACACCCCTCCACCACCTGCAGG - Intronic
1034126263 7:148674759-148674781 ATCACTCCTCCCCCACCCCCTGG + Intergenic
1035199176 7:157249236-157249258 CAGGCTCCCCCACCTCCCGCAGG + Intronic
1035554087 8:552400-552422 AAAATGCCTCCACAACCCGCAGG + Intergenic
1037294133 8:17383066-17383088 AAGACACATCCACCACCTGGGGG + Intronic
1045290707 8:100830283-100830305 CCCACTCCTCCACCACCCACTGG + Intergenic
1046537423 8:115533259-115533281 AATACTCTCCCACCACCCTCTGG + Intronic
1047336259 8:123939586-123939608 AAGACTCCCCAACGACCTGCAGG - Intronic
1048380045 8:133857427-133857449 AGAACTTCTCCACCACCCACTGG - Intergenic
1049716802 8:144096779-144096801 AATACTTCTCCACTACCCCCAGG + Intronic
1053585278 9:39451773-39451795 AAGCCTCCTCTTCCACCCCCAGG - Intergenic
1054254796 9:62801556-62801578 AAGAACCCTCCACCACACCCCGG - Intergenic
1054581039 9:66913450-66913472 AAGCCTCCTCTTCCACCCCCAGG + Intronic
1057230520 9:93318845-93318867 CAGCCTCCTCCACCTCCCACTGG + Intronic
1058945671 9:109853732-109853754 AAGATTCTACCACCACCAGCAGG + Intronic
1059418233 9:114175201-114175223 AGGCCTCCTCCACCTCCCCCAGG + Intronic
1059999476 9:119945092-119945114 AAGACGGCACCACCACCCTCAGG - Intergenic
1060583909 9:124774139-124774161 AAGACTCTGCTACCACCTGCAGG + Intergenic
1062210287 9:135359944-135359966 GACACTCCTCCACCAGCCACAGG + Intergenic
1062637466 9:137499041-137499063 AGGGCTCCTCCTCCACCCCCAGG - Intronic
1192560377 X:72124191-72124213 AAGAGTCCACCCCCACCCTCAGG + Intergenic
1200389401 X:155928820-155928842 GAGATTCCTCCACCACTCTCAGG - Intronic