ID: 1103730813

View in Genome Browser
Species Human (GRCh38)
Location 12:123026650-123026672
Sequence CCCAGCAAGGCCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 859
Summary {0: 1, 1: 1, 2: 5, 3: 60, 4: 792}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103730813_1103730825 29 Left 1103730813 12:123026650-123026672 CCTTCCACCTTGGCCTTGCTGGG 0: 1
1: 1
2: 5
3: 60
4: 792
Right 1103730825 12:123026702-123026724 GCAGACTTCACGCCTTTTCCAGG 0: 1
1: 0
2: 0
3: 2
4: 90
1103730813_1103730819 7 Left 1103730813 12:123026650-123026672 CCTTCCACCTTGGCCTTGCTGGG 0: 1
1: 1
2: 5
3: 60
4: 792
Right 1103730819 12:123026680-123026702 GCAGAAGCCCCTGCCCACTCAGG 0: 1
1: 0
2: 0
3: 27
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103730813 Original CRISPR CCCAGCAAGGCCAAGGTGGA AGG (reversed) Intronic
900250380 1:1665694-1665716 CCCAGCAGGGCCATGGAGGAGGG + Exonic
900305896 1:2007763-2007785 CTTTGCAGGGCCAAGGTGGATGG + Intergenic
900424877 1:2572372-2572394 CTCTGGAAGGCCAAGGTGGGCGG - Intergenic
900704509 1:4071906-4071928 CGCCGCAATGCCCAGGTGGAGGG - Intergenic
900792847 1:4691259-4691281 CCCAGGAAGGCCAGGAGGGAGGG - Intronic
901034624 1:6328930-6328952 CCTGGCCAGGCCAAGGGGGAGGG - Intronic
901155454 1:7134549-7134571 CTTTGGAAGGCCAAGGTGGAAGG - Intronic
901486265 1:9564641-9564663 CTTAGTAAGGCCAAGGTGGGTGG + Intronic
901549654 1:9986486-9986508 CTTTGGAAGGCCAAGGTGGAAGG + Intergenic
901830871 1:11891656-11891678 CCCAGCAAGGCCAAGGTGGGAGG + Intergenic
902403938 1:16173003-16173025 CCTAGCAATCCGAAGGTGGAGGG - Intergenic
903070035 1:20722549-20722571 GCCAGCAGGGCCAATGAGGAAGG + Intronic
903357816 1:22758845-22758867 CCCAGCCAGGTCCTGGTGGATGG + Intronic
904144556 1:28379515-28379537 CTCTGGCAGGCCAAGGTGGATGG - Intronic
904436883 1:30504831-30504853 GCCAGCAAGGCTATGGGGGAAGG + Intergenic
904681103 1:32229792-32229814 CTCTGGAAGGCCAAGGTGGGCGG - Intronic
904718020 1:32483959-32483981 CCTTACGAGGCCAAGGTGGAAGG + Intronic
904737229 1:32643893-32643915 TACAACAAGGCCAAGGTGGAAGG - Intronic
904800435 1:33088757-33088779 CTCAGCCAGGCCAAGAGGGAAGG - Intronic
905192748 1:36248382-36248404 CTTAGGAAGGCCAAGGTAGAAGG - Intronic
905716209 1:40152335-40152357 CTTTGCAAGGCCAAGGTGGGTGG - Intergenic
906753331 1:48285833-48285855 CCCAGCAAGAACAATGTAGAAGG - Intergenic
906782551 1:48585572-48585594 CTCAGCAAGGCCAAGGGAGTAGG - Intronic
907313347 1:53552348-53552370 CACAGCATGGCCCAGGTGGCAGG + Intronic
908322563 1:62992278-62992300 TGCAGCAAGGCAAATGTGGACGG - Intergenic
908330976 1:63070932-63070954 CTTAGGGAGGCCAAGGTGGAGGG - Intergenic
908342195 1:63193069-63193091 AACAGCAAGGCCAAGGTAGCTGG + Intergenic
909070176 1:70984469-70984491 CTCTGCAAGGCCAAGGTGGGAGG + Intronic
910204757 1:84738155-84738177 CCCATCAAGGAAGAGGTGGAAGG + Intergenic
910858412 1:91719400-91719422 ACCTGCAAGGCCAAGATGAATGG - Exonic
912220742 1:107672022-107672044 CGCCGCAAGGCCAAGGCGGGAGG + Intronic
912310095 1:108611582-108611604 ATCAGCAAGGCAAATGTGGAAGG + Intronic
912625522 1:111202754-111202776 GCCAGAAAGGCAAAGGAGGAAGG + Intronic
912919071 1:113847976-113847998 CTTTGGAAGGCCAAGGTGGAAGG - Intronic
913587026 1:120285651-120285673 CTTCGCAAGGCCAAGGTGGGAGG + Intergenic
913621159 1:120612719-120612741 CTTCGCAAGGCCAAGGTGGGAGG - Intergenic
914569040 1:148897536-148897558 CTTCGCAAGGCCAAGGTGGGAGG + Intronic
914603787 1:149232720-149232742 CTTCGCAAGGCCAAGGTGGGAGG - Intergenic
914829013 1:151157146-151157168 AACAGGAAGGCCAAGGAGGAAGG + Intronic
915061463 1:153189047-153189069 CCCAGCAAGACCAACGCAGAAGG - Intergenic
915118747 1:153615724-153615746 CAGGGCAAGGCCAAGGTGAAGGG + Intronic
915376574 1:155401536-155401558 CACTGGAAGGCCAAGGTGGGTGG + Intronic
916514152 1:165499614-165499636 AACAGCAAGGCCAAGGTGGGGGG + Intergenic
916954926 1:169822250-169822272 CCCAGAAAGACCAATTTGGATGG + Intronic
917258578 1:173142292-173142314 AGCAGCAAGGCCTGGGTGGAAGG + Intergenic
917258589 1:173142337-173142359 TGCAGCAGGGCCATGGTGGATGG + Intergenic
917571152 1:176266792-176266814 CCCAGGGAAGCCAAGGTGGGTGG - Intergenic
918118315 1:181515969-181515991 CTCAGCCAGGCCAAGGGGGAAGG - Intronic
918199775 1:182256115-182256137 CCCAGCTAGGCTGAGGTGGGAGG + Intergenic
919830457 1:201537249-201537271 CCCAGCATTACCAATGTGGATGG + Intergenic
920250150 1:204617976-204617998 CCCAGAAAGCCCAGGCTGGAGGG + Exonic
921128320 1:212197483-212197505 CCTTGGGAGGCCAAGGTGGATGG + Intergenic
921223788 1:212996380-212996402 CCCTGGGAGGCCGAGGTGGACGG + Intronic
921421795 1:214957244-214957266 CTCAAAATGGCCAAGGTGGAAGG - Intergenic
921976236 1:221206628-221206650 CCCAGCAAGACCAACGCAGAAGG + Intergenic
922714911 1:227864289-227864311 CCCAAGGAGGCCAAGGTGGGTGG + Intergenic
922730129 1:227945349-227945371 GCTAGCCAGGCCAAGGTGCAGGG + Intronic
923053116 1:230402729-230402751 CTTTGGAAGGCCAAGGTGGAAGG - Intronic
923310569 1:232730660-232730682 TCCCGCAAGGCCAATGTGGCTGG - Intergenic
923421629 1:233822016-233822038 CCCAGCGAGGTTAATGTGGAAGG + Intergenic
923586342 1:235275891-235275913 CGCTGGAAGGCCAAGGTGGGAGG + Intronic
924612695 1:245587123-245587145 GGCAGCATGGCCAAGGTGCAGGG - Intronic
924734304 1:246741539-246741561 CTCTGCGAGGCCAAGGTGGGAGG - Intronic
924883374 1:248187585-248187607 CCCAGCAAGGCCAATGCAGAAGG + Intergenic
924894137 1:248317360-248317382 CCCAGGAAGGCCAATGCAGAAGG - Intergenic
1063121164 10:3106483-3106505 CCCAGTCAGCCCCAGGTGGAGGG - Intronic
1064056113 10:12098925-12098947 CTTTGGAAGGCCAAGGTGGAAGG + Intronic
1064213924 10:13383728-13383750 CTAAGCAAGGCCAGGCTGGAGGG + Intergenic
1065121085 10:22530853-22530875 CCCAGCAAGACCAATGTAGAAGG - Intergenic
1065126213 10:22576830-22576852 CCCTGGGAGGCCAAGGTGGGCGG + Intronic
1065206135 10:23359460-23359482 CCCAGCAATGACAAGGCAGATGG + Intergenic
1065274337 10:24070081-24070103 CACTGGGAGGCCAAGGTGGAAGG - Intronic
1065663047 10:28026049-28026071 CCCAGCAGAGCCAAGGAGGTGGG - Intergenic
1065759212 10:28966356-28966378 CTTTGGAAGGCCAAGGTGGAAGG + Intergenic
1065837116 10:29668715-29668737 CTCAGGGAGGCCAAGGTGGGTGG - Intronic
1065975345 10:30836692-30836714 CCCAGAAAGGCCATGATGTAGGG + Intronic
1065982863 10:30919292-30919314 GCCAGCAAGGCCAAAGATGAAGG - Intronic
1066533841 10:36368843-36368865 CCCAGAAAAGCCATGGTAGAGGG - Intergenic
1067111348 10:43403259-43403281 CCCAGCAGGGCCAAGGCAGGCGG - Intronic
1067251918 10:44593884-44593906 CCCAGCAAGACCAATGCAGAAGG + Intergenic
1067518252 10:46973818-46973840 CCCAGCAAAGCTATGGGGGAAGG - Intronic
1067643997 10:48078010-48078032 CCCAGCAAAGCTATGGGGGAAGG + Intergenic
1067752993 10:48984167-48984189 CCCAGGAAGGCCAAGAAGCAGGG + Intergenic
1068086191 10:52375621-52375643 CCCAGCAAGACCAATGCAGAAGG - Intergenic
1068490238 10:57714023-57714045 CTTTGGAAGGCCAAGGTGGAAGG + Intergenic
1068977505 10:63025523-63025545 CTTTGCAAGGCCAAGGTGGGTGG - Intergenic
1069496847 10:68912455-68912477 CCTTGGGAGGCCAAGGTGGAAGG - Intronic
1069974998 10:72205858-72205880 CCCAGGGAGGCCAAGGTGGGTGG + Intronic
1070546074 10:77453666-77453688 TCCAGCAAGGCCAAGGAGGCTGG + Intronic
1072450768 10:95537873-95537895 TTCTGCAAGGCCAAGGTGGACGG + Intronic
1072451710 10:95544178-95544200 CTCAGCAAGCCCAAGAAGGATGG + Intronic
1073087142 10:100899802-100899824 CTCTGGAAGGCCAAGGTGGGTGG - Intergenic
1074688539 10:115981573-115981595 CCCAGCAAGCCTGAGGTGCATGG - Intergenic
1074855840 10:117472861-117472883 CTCAGCAAGGGGTAGGTGGAGGG + Intergenic
1075045491 10:119143166-119143188 CACAGCCAGGCCAAGGAGCAGGG - Intronic
1075975491 10:126690498-126690520 CTCAGGAAGCCCAAGGTGGTTGG + Intergenic
1076001945 10:126919527-126919549 CCCAGTGAGGCCAAGGGGAAGGG + Intronic
1077294764 11:1820999-1821021 GCTGCCAAGGCCAAGGTGGAGGG - Intergenic
1077308929 11:1879997-1880019 CCCAGCAAGGCCTGTGTAGATGG + Intronic
1077674012 11:4181739-4181761 CACAGCAAGGCCATGGAGGGTGG - Intergenic
1077713561 11:4559166-4559188 CCCAGCAAGACCAATGCAGAAGG + Intergenic
1078596639 11:12692853-12692875 CCAGGCAAGGCCAAAGTGCAGGG - Intronic
1078992446 11:16663564-16663586 CCCAGCAGGGCTGAGGTGGGTGG - Intronic
1079172867 11:18112852-18112874 CCCAGGAAGGCCAAGGAAGGAGG + Intronic
1079186815 11:18245615-18245637 CCCAGAAAGGCCAAGGAAGGAGG + Intronic
1079190027 11:18269595-18269617 CCCAGAAAGGCCAAGGAAGGAGG - Intronic
1079696015 11:23483757-23483779 CCCAGCAAGACCAACGCAGAAGG + Intergenic
1079714796 11:23731633-23731655 CCCAGCAAGACCAACGCAGAAGG + Intergenic
1080122462 11:28693313-28693335 CCTTGGGAGGCCAAGGTGGATGG + Intergenic
1080495329 11:32812274-32812296 CTTTGCAAGGCCAAGGTGGGAGG + Intergenic
1080618768 11:33968742-33968764 CTTTGGAAGGCCAAGGTGGAAGG + Intergenic
1080941777 11:36926731-36926753 CTGAGCTAGGCCAGGGTGGACGG + Intergenic
1081095057 11:38921710-38921732 CCCAGCAAGACCAATGCAGAAGG - Intergenic
1083458883 11:62797882-62797904 CACTGGGAGGCCAAGGTGGATGG + Intronic
1083559909 11:63665100-63665122 CACTGGAAGGCCAAGGTGGGTGG + Intronic
1083650650 11:64202489-64202511 CTCTGGAAGGCCAAGGTGGGTGG - Intronic
1083768665 11:64854397-64854419 CTCATCAAGGTCAAGCTGGAGGG - Exonic
1084117308 11:67049799-67049821 CCGGGGAAGGCCAGGGTGGAAGG + Exonic
1084203003 11:67574661-67574683 CTTAGGGAGGCCAAGGTGGATGG - Intergenic
1084384742 11:68836230-68836252 CTTTGCAAGGCCAAGGTGAAAGG + Intronic
1084740900 11:71138942-71138964 CCCAGCATGGCAAAGGTAGTGGG + Intronic
1085372094 11:76018648-76018670 CTCTGGAAGGCCAAGGTGGGTGG - Intronic
1086129099 11:83382739-83382761 CCCAGCAAGACCAATGTAGAAGG + Intergenic
1086302995 11:85449882-85449904 CTTTGCAAGGCCAAGGTGGGTGG + Intronic
1086404440 11:86487932-86487954 CTTCGGAAGGCCAAGGTGGAAGG + Intronic
1086460781 11:87003556-87003578 CTTTGAAAGGCCAAGGTGGAAGG - Intergenic
1086733885 11:90282674-90282696 ACCAGCCTGGCCAACGTGGATGG - Intergenic
1087427678 11:98012128-98012150 CCCAGCAAGACCAATGCAGAAGG + Intergenic
1088572154 11:111232914-111232936 CCTTGGAAGGCCAAGGTGGGCGG - Intergenic
1088613675 11:111602558-111602580 CCCAGCATGGTCATGGCGGATGG + Exonic
1088856653 11:113761385-113761407 CTCAGCAGGGCTAAGGTGGGAGG - Intronic
1089465065 11:118679659-118679681 CCCAGCAAGCCGAAGGTGCCTGG - Exonic
1090313294 11:125762435-125762457 CCCAGCAAAGCCATACTGGAGGG - Intergenic
1090391157 11:126388573-126388595 TTCTGGAAGGCCAAGGTGGATGG - Intronic
1090392535 11:126398428-126398450 CCCAGCAAGGCCAGGGAAGCAGG - Intronic
1091286383 11:134410979-134411001 CCCAGCCAGGCCTAGCTGCATGG - Intronic
1092205540 12:6612652-6612674 CCCAGGAAGACAAAGATGGAAGG + Intergenic
1093046001 12:14445431-14445453 CTCTGGAAGGCCAAGGTGGGCGG - Intronic
1093545157 12:20337024-20337046 CCCAGCAAGGTCAAGGCAGAAGG - Intergenic
1093554221 12:20451515-20451537 ACCTGGAAGGCCAAGGTGGGCGG - Intronic
1094317572 12:29149715-29149737 CCCAGCAAGGTTAATGTGGGGGG + Intronic
1094317657 12:29149974-29149996 CCCGGCGAGGCCCAGGTGGGAGG - Intronic
1094620834 12:32078858-32078880 CCCAGCAAAGCCATGGGGGTAGG - Intergenic
1095356311 12:41279959-41279981 CCCAGCAAGGCCCATGCAGAAGG + Intronic
1095594042 12:43938754-43938776 CTTTGGAAGGCCAAGGTGGATGG + Intronic
1095781451 12:46064783-46064805 CCTAGGAAGGCTAAGGTGGGAGG + Intergenic
1095890678 12:47233148-47233170 CTTTGGAAGGCCAAGGTGGAAGG - Intronic
1096127354 12:49129687-49129709 ACCAGCCTGGCCAACGTGGATGG + Exonic
1096134312 12:49186798-49186820 ACCAGCCTGGCCAACGTGGATGG + Exonic
1096144595 12:49269478-49269500 ACCAGCCTGGCCAACGTGGATGG - Exonic
1096233578 12:49910901-49910923 CCCAGCAAAGCCCAGGTGTGGGG - Intergenic
1096423616 12:51481842-51481864 CTCAGGAAGGCTGAGGTGGAAGG + Intronic
1096856931 12:54489897-54489919 CCTTGGAAGGCCAAGGTGGGAGG - Intergenic
1097264746 12:57738517-57738539 CCCACCCAGGCCGGGGTGGACGG - Intronic
1097412030 12:59267666-59267688 CCCAGCAAGACCAATGCAGAAGG + Intergenic
1097669172 12:62515570-62515592 CTTTGTAAGGCCAAGGTGGATGG + Intronic
1097691195 12:62736006-62736028 TCCAGCAAGGCCAAGAAGGGCGG + Intronic
1097898902 12:64853886-64853908 CCCAGCAAGATCAATGCGGAAGG - Intronic
1098556302 12:71822706-71822728 CTTTGGAAGGCCAAGGTGGATGG + Intergenic
1098994696 12:77105595-77105617 TCCCGGAAGGCCAAGGTGGGAGG + Intergenic
1100342247 12:93690396-93690418 TACAGCAAGGCCCAGGTTGAGGG + Intronic
1100994221 12:100284926-100284948 CTTTGGAAGGCCAAGGTGGAAGG + Intronic
1101555998 12:105810074-105810096 GACAGCAATCCCAAGGTGGAAGG + Intergenic
1102461375 12:113101816-113101838 CACAGCAAGGCCACGGTGGGGGG + Intronic
1102644176 12:114393230-114393252 ACCAGCAAGGCTGGGGTGGAGGG - Intronic
1102996759 12:117357334-117357356 CCCAGCAAGGTCAAGGTGGGAGG + Intronic
1103032762 12:117630664-117630686 CCCAGCAGTGGAAAGGTGGATGG + Intronic
1103071082 12:117942741-117942763 CCTTGGAAGGCCAAGGCGGAAGG - Intronic
1103108742 12:118255334-118255356 CTTTGCAAGGCCAAGGTGGGAGG - Intronic
1103174524 12:118850990-118851012 CTCTGCAAGGCTGAGGTGGAAGG - Intergenic
1103233134 12:119349307-119349329 CCCACCAAGGCCAAGGTCCAGGG + Intronic
1103484547 12:121273978-121274000 CCCAGCAGGGCCTCTGTGGAAGG - Intronic
1103730813 12:123026650-123026672 CCCAGCAAGGCCAAGGTGGAAGG - Intronic
1103814732 12:123645311-123645333 CCCTGAGAGGCCAAGGTGGGAGG - Intronic
1103980749 12:124735526-124735548 CTTTGGAAGGCCAAGGTGGACGG + Intergenic
1103995853 12:124829563-124829585 CACAGCAAGGCCAGTGTGGCTGG - Intronic
1104115708 12:125746942-125746964 CCCAGCAAGATCAATGTAGAAGG - Intergenic
1104235860 12:126936120-126936142 CTCTGGGAGGCCAAGGTGGATGG + Intergenic
1104260967 12:127181674-127181696 CTTTGGAAGGCCAAGGTGGATGG - Intergenic
1104356167 12:128089078-128089100 CCCAGCCAGGGCAATGTTGAAGG + Intergenic
1104481210 12:129109961-129109983 CCGAGCATGGCCAAGGTGCAGGG + Intronic
1104533734 12:129597799-129597821 CACAGCTAGTCCAAGGCGGATGG - Intronic
1104557923 12:129818789-129818811 CTTTGGAAGGCCAAGGTGGATGG + Intronic
1104639166 12:130456460-130456482 CCCACCACAGCCAAGGCGGAAGG + Intronic
1105269230 13:18855297-18855319 CTTTGCAAGGCCAAGGTGGGTGG + Intergenic
1105418956 13:20236081-20236103 CCCAGCAAAGCCATAGGGGAGGG - Intergenic
1105599006 13:21869167-21869189 CCTTGGGAGGCCAAGGTGGAAGG - Intergenic
1105900171 13:24746438-24746460 CACAGCAAGGACCAGGAGGACGG - Intergenic
1106582678 13:31031564-31031586 CCCAGGTAGGCCAAAGGGGAAGG - Intergenic
1107289928 13:38840350-38840372 CCCAGCAAGGCCAACGCAGAAGG - Intronic
1107325750 13:39240383-39240405 CCCAGCAAGGTCAACATAGAAGG - Intergenic
1107935949 13:45345464-45345486 CCTAGGCAGGCCAAGGTGGGAGG + Intergenic
1108850215 13:54718806-54718828 CCCAGCAAGACCAATGCAGAAGG - Intergenic
1108861048 13:54859125-54859147 CCCACCAATGCCAATGTAGACGG + Intergenic
1108940466 13:55947402-55947424 CCCAGCAAGACCAAGGCAGAAGG + Intergenic
1109361468 13:61299523-61299545 TCTAGGAAGGCCAAGGTGGGTGG - Intergenic
1109819875 13:67638877-67638899 CCCAGCAAGACAATGGTGGCAGG + Intergenic
1110019856 13:70457050-70457072 CCCAGCAAGACCAATGCAGAAGG + Intergenic
1110211480 13:72978949-72978971 CTCAAAAAGGCCAAGGTGGGAGG + Intronic
1110282722 13:73714197-73714219 CTCTGAAAGGCCAAGGTGGAAGG + Intronic
1110375013 13:74783512-74783534 CTTTGAAAGGCCAAGGTGGAAGG + Intergenic
1110774755 13:79394875-79394897 CTCTGGGAGGCCAAGGTGGACGG - Intronic
1111703958 13:91724746-91724768 CTCTGTAAGGCCAAGGTGGGAGG + Intronic
1112165751 13:96918441-96918463 CCCAGCAAGACCAATGCAGAAGG + Intergenic
1112475862 13:99730379-99730401 CCCAGCACTGCCCAGGTGGCTGG + Intronic
1112494214 13:99893109-99893131 CCCAGCGTGGCCAGTGTGGAGGG - Exonic
1112620256 13:101047320-101047342 CCCAGCAAGACCAACGCAGAAGG - Intergenic
1113034250 13:106031494-106031516 CTCAGCAAGCCCCAGGTGAAAGG - Intergenic
1113516182 13:110901795-110901817 CTCTGGGAGGCCAAGGTGGAAGG + Intronic
1113716720 13:112514406-112514428 CTCTGGAAGGCCAAGGTGGGAGG + Intronic
1114066778 14:19066790-19066812 ACCAGCAAGGCAGAGGAGGAGGG - Intergenic
1114095488 14:19333237-19333259 ACCAGCAAGGCAGAGGAGGAGGG + Intergenic
1114133662 14:19821331-19821353 CCCAGCAAGACCAACGCAGAAGG - Intronic
1114612415 14:24051681-24051703 GTCAGCAAGGACAAGCTGGAGGG + Intergenic
1114665487 14:24375142-24375164 CCTTGGGAGGCCAAGGTGGAAGG - Intronic
1115006520 14:28492117-28492139 CCCAGCAGAGCCATGGTGGCAGG - Intergenic
1115085772 14:29513171-29513193 CTCTGCCAGGGCAAGGTGGAAGG - Intergenic
1115124089 14:29972078-29972100 CCCAGCAAGACCAATGCAGAAGG + Intronic
1115359915 14:32488906-32488928 CCCAGCAAGACCAACGCAGAAGG - Intronic
1115523371 14:34255043-34255065 CTTTGGAAGGCCAAGGTGGAAGG + Intronic
1116775620 14:49178219-49178241 CCCAGCAAGACCAACGCAGAAGG + Intergenic
1117020920 14:51569610-51569632 ACCAGGAAGGCTGAGGTGGAAGG - Intronic
1117056559 14:51917785-51917807 CCTTGGAAGGCCAAGGTGGGCGG + Intronic
1117305363 14:54468559-54468581 CCCAGCAAAGCCATGGGGGCAGG + Intergenic
1117359799 14:54961527-54961549 GTCAGCAAGGCAAAGGTGCATGG - Intronic
1118800657 14:69186480-69186502 ACTTGGAAGGCCAAGGTGGAAGG - Intergenic
1119293589 14:73515765-73515787 CCCAGCACGTCCAAGCTGGTGGG - Intronic
1119293653 14:73516240-73516262 CCCAGCACGTCCAAGCTGGTGGG - Intronic
1119296107 14:73534447-73534469 CTCAGGGAGGCCAAGGTGGGAGG + Intronic
1119300046 14:73564364-73564386 CTCAGGGAGGCCAAGGTGGGAGG + Intergenic
1119459634 14:74789458-74789480 CCCAGGGAGGCCAAGGCAGATGG - Intronic
1119659096 14:76437876-76437898 ACCAGCATGGCCGGGGTGGAGGG + Intronic
1120121230 14:80681858-80681880 CACTGGGAGGCCAAGGTGGAAGG + Intronic
1120843259 14:89105220-89105242 CCCAGCAAGATCAAGGGAGAAGG - Intergenic
1121062179 14:90922690-90922712 CTTTGGAAGGCCAAGGTGGATGG - Intronic
1121076974 14:91076999-91077021 CTCTGGGAGGCCAAGGTGGAAGG + Intronic
1121571844 14:94952109-94952131 CTGAGCAAGGCCAGGGCGGAGGG + Intergenic
1122544113 14:102512915-102512937 CCTAGGAAGCCCCAGGTGGAGGG + Intergenic
1122724000 14:103738781-103738803 CCCAGCAAGCCCAACGACGAAGG - Exonic
1122978081 14:105179172-105179194 TCCAGCCAGGTCAAGGTGCAGGG + Intronic
1202830080 14_GL000009v2_random:18699-18721 CTTTGCAAGGCCAAGGTGGGTGG - Intergenic
1202871926 14_GL000225v1_random:172894-172916 CCCAGGGAGGCCAATGTGGAAGG + Intergenic
1123576738 15:21676892-21676914 CCCAGCAAGACCAACGCAGAAGG - Intergenic
1123613360 15:22119360-22119382 CCCAGCAAGACCAATGCAGAAGG - Intergenic
1123675954 15:22710518-22710540 CCCAGGGAGGCCAAGGCGGTCGG - Intergenic
1123720897 15:23061313-23061335 CCCAGCAAAGCCATGGGGGTGGG - Intergenic
1124372323 15:29110798-29110820 CCCAGCCAAGCCCAGGTGCAGGG + Intronic
1124414112 15:29460385-29460407 CTCTGGAAGGCCAAGGTGGGTGG + Intronic
1124663870 15:31574909-31574931 TCCAGCAGGCCCAAAGTGGAGGG - Intronic
1124786053 15:32681691-32681713 CCTTGGAAGGCCAAGGTGGGAGG - Intronic
1125398014 15:39270937-39270959 CCCATCAATGGCAAGTTGGAAGG - Intergenic
1125607078 15:40945693-40945715 CTTTGGAAGGCCAAGGTGGACGG + Intergenic
1126761907 15:51977244-51977266 CTTAGTGAGGCCAAGGTGGATGG - Intronic
1126771717 15:52063304-52063326 TTCAAGAAGGCCAAGGTGGATGG - Intronic
1127259253 15:57316531-57316553 CCCAGGAAGGCCAATGGGCAGGG - Intergenic
1127735848 15:61838627-61838649 CACAACAAGGCCATGTTGGAGGG - Intergenic
1127873046 15:63089219-63089241 CCTTGGAAGGCCAAGGTGGGAGG - Intergenic
1128247773 15:66144559-66144581 GCCAGCTAGGCCCAGGTGAAAGG + Intronic
1128356514 15:66931225-66931247 CTCTGAGAGGCCAAGGTGGACGG + Intergenic
1128983415 15:72202312-72202334 CCCTGCAGGCCCAAGGTGGCAGG + Intronic
1129404058 15:75302633-75302655 GCCAGCAAGGCCGAGGAGAATGG - Intergenic
1129411092 15:75350721-75350743 CCCAGGAAGGCTGAGGTGGGAGG - Intronic
1129477065 15:75792661-75792683 GCCAGCAAGGCCGAGGAGAATGG - Intergenic
1129600988 15:76997992-76998014 CTCTGGGAGGCCAAGGTGGATGG + Intronic
1129705245 15:77790612-77790634 CCCAGGAAGGCAGGGGTGGAGGG + Intronic
1129742242 15:77994853-77994875 CCCAGAAACGCCAGGCTGGAAGG + Intronic
1129843240 15:78756627-78756649 CCCAGAAACGCCAGGCTGGAAGG - Intergenic
1130364331 15:83220534-83220556 CCCTGGGAGGCCAAGGTGGGAGG + Intergenic
1131605838 15:93901283-93901305 CTCAGCAAAGCCAGGGTGGGTGG - Intergenic
1132107032 15:99070559-99070581 CTTTGCGAGGCCAAGGTGGATGG + Intergenic
1132427885 15:101735115-101735137 CTTTGCGAGGCCAAGGTGGAAGG - Intergenic
1202985606 15_KI270727v1_random:411137-411159 CCCAGCAAGACCAACGCAGAAGG - Intergenic
1132501550 16:286714-286736 CCCAGCAGGGCCAGGTCGGAAGG + Exonic
1132865324 16:2090280-2090302 CTCAGCAAGGTCAAGGAGGTGGG - Exonic
1133824269 16:9263019-9263041 CCCAGGAAGGCCGAGGTGGGAGG - Intergenic
1134073941 16:11277474-11277496 CCCGGCAAGGCCGAGCGGGAGGG - Intronic
1134438799 16:14285458-14285480 CCCTGCAAGGCGGCGGTGGACGG + Intergenic
1135062114 16:19279884-19279906 CTTTGCAAGGCCAAGGTGGGTGG - Intergenic
1135102369 16:19617110-19617132 CTTTGCAAGGCCAAGGTGGGAGG + Intronic
1135488622 16:22887701-22887723 CCCATGAAGGCCGAGGTGGGAGG + Intronic
1135630379 16:24031862-24031884 CCCAGGCAGGCCCAGATGGAGGG + Intronic
1135918272 16:26625367-26625389 CCCTGGAAAGCCAAGGTGGGTGG - Intergenic
1136342408 16:29653547-29653569 CCTTGGGAGGCCAAGGTGGAAGG - Intergenic
1136573879 16:31112034-31112056 CCCTGCCAGGCCAGGATGGAGGG + Intronic
1137336577 16:47554912-47554934 CCCAGCAAGACCAATGCAGAAGG - Intronic
1137409665 16:48217350-48217372 CACAGGGAGGCCAAGGTGGGTGG + Intronic
1137669656 16:50271865-50271887 CAAAGCAAGGCCAAGGGGGTGGG - Intronic
1137739123 16:50748437-50748459 CCTTGGAAGGCCAAGGTGGGAGG + Intronic
1138274810 16:55726267-55726289 CCCAGCTTGGCCAGGGTGAATGG - Intergenic
1138288497 16:55828200-55828222 CCCAGCTTGGCCAGGGTGAATGG + Intronic
1138799657 16:60012713-60012735 CCCAGCAAGAGGAATGTGGAAGG + Intergenic
1139380770 16:66529315-66529337 CCCAGCAATGCCGAGGCTGAGGG + Intronic
1139572169 16:67820059-67820081 CTTTGCAAGGCCAAGGCGGATGG - Intronic
1139695284 16:68669873-68669895 CCCTGGGAGGCCAAGGTGGGAGG + Intronic
1139932551 16:70540302-70540324 TTCGGGAAGGCCAAGGTGGATGG - Intronic
1140029058 16:71319687-71319709 CTTTGGAAGGCCAAGGTGGACGG - Intergenic
1140353984 16:74288497-74288519 CACTGGGAGGCCAAGGTGGATGG - Intergenic
1140543861 16:75787880-75787902 TCCAGGAAGGCCCAGGTGGCTGG - Intergenic
1140578919 16:76205624-76205646 CTTTGCAAGGCCAAGGTGGGTGG + Intergenic
1140833121 16:78769761-78769783 CTTTGGAAGGCCAAGGTGGAAGG + Intronic
1141103301 16:81213593-81213615 CCCAGGAAGGCCAAGGTGGGCGG + Intergenic
1141474261 16:84261864-84261886 CTCTGGGAGGCCAAGGTGGACGG - Intergenic
1141650797 16:85391989-85392011 CCCAGGAAGGACAAGGACGATGG - Intergenic
1142608440 17:1095156-1095178 CCCAGGAAGGCCAAGGAGACGGG + Intronic
1143585848 17:7849816-7849838 CGCAGGAATGCCAAGGTGAAAGG + Exonic
1144094624 17:11888878-11888900 CCCAGATAGGCCAACGTGGCAGG + Intronic
1144123156 17:12176421-12176443 CCCAGCAAGGCCGAGGCAGGCGG - Intergenic
1144406857 17:14960195-14960217 ACCTGGGAGGCCAAGGTGGAAGG + Intergenic
1144485999 17:15664789-15664811 CTCTGGAAGGCCAAGGTGGGTGG + Intronic
1144608290 17:16686962-16686984 CCCAGCTAGGCCAAGGGGTAGGG + Intergenic
1145032562 17:19516058-19516080 CTTAGGAAGGCCAAGGTGGAGGG + Intronic
1145059788 17:19725194-19725216 CCTAGCAAGGCCCACGAGGAAGG - Intergenic
1145062021 17:19739500-19739522 TCCAGCAACGACAAGGTGGGTGG - Exonic
1145115661 17:20208906-20208928 CCCAGAAAGGCTGAGGTGGGAGG - Intronic
1145128062 17:20317913-20317935 CCCAGCTAGGCCAAGGGGTAGGG + Intronic
1145196550 17:20899300-20899322 CCCAGCTAGGCCAAGAGGTAGGG - Intergenic
1145836925 17:27961363-27961385 CTCTGGAAGGCTAAGGTGGAAGG + Intergenic
1146272743 17:31495053-31495075 TCCAGCTAGGCACAGGTGGATGG - Intronic
1146660301 17:34661179-34661201 CCCATCAAGGCCAAGTTGCCAGG + Intergenic
1146775367 17:35609716-35609738 CTGAGGAAGGCCAAGGTGGGAGG - Intronic
1146906175 17:36619422-36619444 CTTTGGAAGGCCAAGGTGGATGG + Intergenic
1146994597 17:37307829-37307851 CCTTGGGAGGCCAAGGTGGATGG - Intronic
1147512329 17:41081704-41081726 CCCAGCAAAGCCATGGGGCAGGG + Intergenic
1147514502 17:41102875-41102897 CCCAGCAAAGCCATGGGGCAGGG + Intronic
1148034331 17:44647140-44647162 CCTTGGGAGGCCAAGGTGGAAGG + Intergenic
1148520683 17:48272373-48272395 CCCTGGGAGGCCAAGGTGGATGG - Intronic
1148715371 17:49711899-49711921 CTTTGGAAGGCCAAGGTGGATGG + Intronic
1148905294 17:50908123-50908145 CCCAGCAAGGCAGAGGGAGATGG + Intergenic
1148980946 17:51574451-51574473 CCCAGCAAGATCAATGCGGAAGG + Intergenic
1149727240 17:58908681-58908703 CCTTGAAAGGCCAAGGTGGGCGG - Intronic
1149756246 17:59188693-59188715 CTTTGCAAGGCCAAAGTGGATGG + Intronic
1150204141 17:63388483-63388505 CCAAGCAAAGCCTAGGTGGGGGG - Intronic
1150251077 17:63704776-63704798 CCTAGCCAGGCCAACGTGAAAGG + Intronic
1150719107 17:67599099-67599121 CTCTGGGAGGCCAAGGTGGATGG - Intronic
1151300525 17:73221643-73221665 CTTTGGAAGGCCAAGGTGGAAGG + Intronic
1151956557 17:77383012-77383034 CACAGCAAGGCCAGGCTGGGAGG + Intronic
1152085366 17:78214540-78214562 CCCAGCGAGGCCACTGTGGCTGG + Intronic
1152221110 17:79067163-79067185 ACCGGCAAGGCCGAGGTGGGAGG + Intergenic
1152251987 17:79217098-79217120 CCCCGCACGGCCAAGCTGAAAGG + Intronic
1152425529 17:80216626-80216648 CCCAGGAACGCCATGGTGCAGGG - Intronic
1152790528 17:82276356-82276378 CTCTGGAAGGCCAAGGTGGATGG - Intergenic
1153138210 18:1941779-1941801 CCCAGCAAAGCCATGGGGGCAGG + Intergenic
1153980230 18:10302598-10302620 CCAGGCAGAGCCAAGGTGGAGGG + Intergenic
1154247200 18:12709741-12709763 CTCTGGAAGGCCAAGGTGGTTGG - Intronic
1154418802 18:14204688-14204710 CTTTGCAAGGCCAAGGTGGGTGG - Intergenic
1154518446 18:15198342-15198364 CCCAGCAATGCCAAGCTGTGCGG - Intergenic
1155375368 18:25151262-25151284 CCCAGGAAGGCCAAGGAAGAAGG - Intronic
1155492332 18:26411540-26411562 CTTTGAAAGGCCAAGGTGGAAGG - Intergenic
1155533980 18:26796421-26796443 CTTTGGAAGGCCAAGGTGGATGG + Intergenic
1155816292 18:30315519-30315541 CTTTGCAAGGCCAAGGTGGGAGG + Intergenic
1156084465 18:33382433-33382455 CCCAGCAAGACCAACATGGAAGG + Intronic
1157492405 18:48133311-48133333 CCAAGCAAGGCCTAGATGGAGGG + Intronic
1157600905 18:48892628-48892650 GCCAGCACGGCCACAGTGGAGGG + Intergenic
1157660104 18:49433964-49433986 CCCTGAGAGGCCAAGGCGGATGG + Intronic
1158556476 18:58479396-58479418 CTCTGGAAGGCCAAGGTGGGTGG - Intergenic
1158805468 18:60966691-60966713 CTTTGCAAGGCCAAGGTGGGAGG + Intergenic
1159254616 18:65930613-65930635 CCCAGCAAGACCAATGCAGAAGG + Intergenic
1159673038 18:71246788-71246810 CTTTGGAAGGCCAAGGTGGATGG + Intergenic
1159675745 18:71282831-71282853 CTCAGGAAGGCCGAGGTGGGTGG - Intergenic
1159973488 18:74681484-74681506 CCTTGGAAGGCCAAGGTGGGAGG - Intronic
1160391431 18:78536484-78536506 CCCACCAAGGGCAGAGTGGAGGG + Intergenic
1160756064 19:757682-757704 CCCATCAAGCCCCAGGTGAAGGG + Exonic
1161069851 19:2254535-2254557 CCCAGCAGGGCCAGGGGAGAGGG - Intronic
1161212014 19:3071724-3071746 CTCTGGAAGGCCAAGGTGGGAGG - Intergenic
1161283262 19:3456816-3456838 CCCCCCAGGACCAAGGTGGAGGG - Intronic
1161833051 19:6623813-6623835 TCCAGCAAGGCCAATTTAGAAGG - Intergenic
1162097304 19:8318104-8318126 CCTTGGGAGGCCAAGGTGGAAGG + Intronic
1162359399 19:10208913-10208935 CTTTGGAAGGCCAAGGTGGAAGG - Intronic
1162651094 19:12089642-12089664 CTTTGGAAGGCCAAGGTGGATGG - Intergenic
1162714064 19:12618159-12618181 CCTTGCAAAGCCAAGGTGGGTGG - Intronic
1162737522 19:12754816-12754838 CCGGGCAAGGACCAGGTGGAGGG + Intronic
1163436131 19:17296295-17296317 CTTTGGAAGGCCAAGGTGGAAGG - Intronic
1163529741 19:17842397-17842419 CCCAGGGAGGCCCACGTGGAAGG + Exonic
1164817871 19:31220043-31220065 CTTGTCAAGGCCAAGGTGGATGG + Intergenic
1165241507 19:34472111-34472133 CTTGGCAAGGCCAAGGTGGGAGG - Intergenic
1165505349 19:36224136-36224158 CTTTGCAAGGCCAAGGTGGGTGG + Intronic
1165805882 19:38580301-38580323 CCCAGCATGGGCAGGGTGGGGGG + Intronic
1165885883 19:39077912-39077934 CTCTGGGAGGCCAAGGTGGAAGG + Intergenic
1165995335 19:39839930-39839952 AACAGCAAGGCCAGGGTGGCTGG + Intronic
1166135810 19:40776494-40776516 CCAAGTAAGGCCAAGTTGGGAGG + Intronic
1166665034 19:44674411-44674433 CACTGGGAGGCCAAGGTGGAAGG - Intronic
1166674073 19:44728607-44728629 CTTTGCAAGGGCAAGGTGGATGG - Intergenic
1167156292 19:47741334-47741356 CTCATCGAGGCCAAGCTGGAAGG + Exonic
1167828474 19:51997194-51997216 CCCAGCTAGGCTAAAGTGGGAGG + Intronic
1167839347 19:52101584-52101606 CTTTGCGAGGCCAAGGTGGATGG + Intergenic
1167929787 19:52854779-52854801 CTCTGAAAGGCCAAGGTGGGTGG + Intronic
1167937160 19:52918524-52918546 CTCTGGAAGGCCAAGGTGGGTGG + Intergenic
1167970178 19:53184407-53184429 CCCAGCAGACCCAGGGTGGATGG - Intronic
1167992414 19:53371610-53371632 CTCTGGAAGGCCAAGGTGGGTGG - Intronic
1168675145 19:58272316-58272338 CAGACCAAGGCCCAGGTGGAAGG + Intronic
1202642609 1_KI270706v1_random:109074-109096 CTTTGCAAGGCCAAGGTGGGTGG + Intergenic
925020197 2:562798-562820 CCCCGCAGGGCCCAGGTGAACGG - Intergenic
925328416 2:3040179-3040201 ACCAGGGAGGCCAGGGTGGAGGG + Intergenic
925575444 2:5355538-5355560 CTCTGGAAGGCCAAGGTGGGTGG + Intergenic
926009437 2:9396518-9396540 CTCTGAAAGGCCAAGGTGGGAGG - Intronic
926524142 2:13955423-13955445 ACTAGCTAGGCCAAGGTGGGAGG - Intergenic
926533440 2:14081861-14081883 CCCAGCAAGGTCAACGCAGAAGG + Intergenic
926681965 2:15670989-15671011 TCCAACAAGGCCAGGGAGGAAGG - Intergenic
926899289 2:17732453-17732475 CTCTGCGAGGCCAAGGTGGATGG + Intronic
927541132 2:23912251-23912273 CTTAGGAAGGCCAAGGTGGGAGG + Intronic
927586634 2:24313190-24313212 CTCAGGGAGGCCAAGATGGAAGG - Intronic
927970046 2:27299914-27299936 CTCTGGGAGGCCAAGGTGGACGG - Intronic
928195525 2:29214053-29214075 TCCAGCATGGCCAGGGAGGAGGG + Exonic
928321369 2:30285072-30285094 CTTGGGAAGGCCAAGGTGGATGG - Intronic
928491637 2:31790264-31790286 CTTTGCAAGGCCAAGGTGGGTGG + Intergenic
929094905 2:38254284-38254306 CCCAGGCAGGCCAAGTGGGAGGG - Intergenic
929243411 2:39676027-39676049 CACTGGAAGGCCAAGGTGGGAGG - Intronic
929914436 2:46122469-46122491 CTCTGGGAGGCCAAGGTGGATGG - Intronic
929954463 2:46444852-46444874 CTTTGGAAGGCCAAGGTGGAAGG + Intronic
930041246 2:47126432-47126454 CTCAGCGAGGCTAAGGTGGGAGG - Intronic
930238597 2:48911839-48911861 CACTGGGAGGCCAAGGTGGAAGG + Intergenic
930819115 2:55627521-55627543 CTCTGGAAGGCCAAGGTGGGAGG + Intergenic
931061087 2:58530663-58530685 CTTTGGAAGGCCAAGGTGGAAGG + Intergenic
931697227 2:64880321-64880343 CCCAGCAGGGCCAGGGTGAGAGG + Intergenic
931974694 2:67630130-67630152 CTTTGCAAGGCCAAGGTGGGTGG + Intergenic
932646885 2:73511563-73511585 CCCAGCAAGACCAACGCAGAAGG - Intronic
932900991 2:75699818-75699840 CTTCGGAAGGCCAAGGTGGAAGG - Intronic
933233717 2:79840687-79840709 CCCGGGGAGGCCAAGGTGGGAGG + Intronic
933941250 2:87246836-87246858 ACCTGGGAGGCCAAGGTGGAAGG + Intergenic
934718244 2:96555362-96555384 CACAGCAAGGCCACGATGCAGGG + Intergenic
935265596 2:101391038-101391060 CCTCGGAAGGCCAAGGTGGGAGG - Intergenic
935399333 2:102644076-102644098 CCCAGCAAGTCCAATGCAGAAGG + Intronic
935996407 2:108778971-108778993 CTGTGCAAGGCCAAGGTGGCAGG - Intronic
936181915 2:110274456-110274478 CCCAGCAAGTCCAATGCAGAAGG - Intergenic
936230653 2:110697223-110697245 CCCAGCAAGTCCAATGCAGAAGG + Intergenic
936338970 2:111614754-111614776 ACCTGGGAGGCCAAGGTGGAAGG - Intergenic
936653329 2:114455299-114455321 CTTAGGGAGGCCAAGGTGGACGG + Intronic
938367217 2:130744523-130744545 GCCACCTATGCCAAGGTGGAGGG - Intergenic
938484176 2:131686885-131686907 ACCAGCAAGGCAGAGGAGGAGGG - Intergenic
939595806 2:144121076-144121098 CCTATCAAGGCCAATGGGGATGG + Intronic
939783217 2:146475395-146475417 TCCGGGGAGGCCAAGGTGGAAGG + Intergenic
940179765 2:150918923-150918945 CTTAGGAAGGCCAAGGTGGGTGG + Intergenic
940372484 2:152918487-152918509 CCCAGCAAAGCCATGGGGGCAGG + Intergenic
940408187 2:153329199-153329221 CCCAGCAAGACCAATGCAGAAGG - Intergenic
940905655 2:159167256-159167278 CCCACCAAGGCACAGGTAGAAGG - Intronic
941717208 2:168776826-168776848 CACATCAAGGCCAAGGTGAGAGG - Intergenic
941955407 2:171199265-171199287 CTTTGCAAGGCCAAGGTGAAAGG + Intronic
942431398 2:175914696-175914718 CCCAGCAAGACCAACGCAGAAGG - Intergenic
942566431 2:177268718-177268740 CCCAGGGAGGCCAAGGTGGGCGG + Intronic
942576975 2:177374020-177374042 CCCAGCAAGACCAATGCAGAAGG - Intronic
943045547 2:182857375-182857397 CTCTGTAAGGCCAAGGTGGGTGG + Intronic
943063409 2:183061859-183061881 CCCAGCAGAGCCAATGTGGAGGG + Intergenic
943338835 2:186652296-186652318 ACTATAAAGGCCAAGGTGGAAGG - Intronic
943796459 2:192002584-192002606 CCCTGGGAGGCCAAGGTGGGCGG + Intronic
945089628 2:206166686-206166708 CCTTGGAAGGCCAAGGTGGAAGG - Intergenic
945207124 2:207344206-207344228 CCCAGCAAGACCAATGCAGAAGG + Intergenic
945303251 2:208234149-208234171 CCTTGGGAGGCCAAGGTGGAAGG + Intergenic
946305572 2:218855247-218855269 CCCAGCACGGTCAAGGTTGTTGG + Intergenic
946469118 2:219940027-219940049 CCCAGCAAAGCCAGGGGGCAGGG + Intergenic
947257345 2:228181125-228181147 CCCGCCCAGGTCAAGGTGGAAGG + Intronic
947492023 2:230603390-230603412 CCCAGCAAGATCAACATGGAAGG + Intergenic
947985665 2:234445650-234445672 CTCTGGAAGGCCAAGGTGGGCGG - Intergenic
948134611 2:235627466-235627488 CCTTGGGAGGCCAAGGTGGACGG - Intronic
948143638 2:235692570-235692592 CCCAGGAAGGCAAGGGGGGAGGG - Intronic
948188219 2:236038135-236038157 CCCAGTAAAGCCAGGGTGTATGG - Intronic
948358672 2:237401926-237401948 CTTAGGAAGGCTAAGGTGGAAGG - Intronic
948894476 2:240921865-240921887 CCAAGGATGGCCTAGGTGGAGGG - Intronic
948942330 2:241202782-241202804 CCCTGCTCGGCCAAGGGGGAAGG - Intronic
948955848 2:241290365-241290387 CCTTGAAAGGCCAAGGTGGGTGG + Intronic
1168953225 20:1816923-1816945 CCCAGGAAGGCCTCGGGGGAGGG - Intergenic
1169960438 20:11153155-11153177 CCCAGCAAGACCAATGCAGAAGG - Intergenic
1170088770 20:12567084-12567106 CCCATCAAGGCCTAGGTGGCTGG - Intergenic
1170133805 20:13052118-13052140 CCCAGCAAGATCAATGTAGAAGG + Intronic
1170185688 20:13587880-13587902 CTTAGGGAGGCCAAGGTGGAAGG + Intronic
1170710577 20:18786971-18786993 CCCTGCTAGGCCAGTGTGGAAGG - Intergenic
1171000748 20:21413573-21413595 CCCAGCAAGACCAATGCAGAAGG + Intergenic
1171187032 20:23130031-23130053 CCCCTGGAGGCCAAGGTGGAAGG - Intergenic
1171889715 20:30699257-30699279 CTTTGCAAGGCCAAGGTGGGTGG + Intergenic
1172467529 20:35167129-35167151 CTCTGGGAGGCCAAGGTGGATGG - Intergenic
1172572728 20:35983103-35983125 CTTTGCAAGGCCAAGGTGGGAGG + Intronic
1173002495 20:39114583-39114605 CCCAGAAAGAACAAGGTGGAAGG - Intergenic
1173223813 20:41150078-41150100 ACCTGAAAGGCCAAGGTGGGAGG + Intronic
1173857843 20:46262289-46262311 CCCAGGAAGGCAAAGGTGGAAGG + Intronic
1174771293 20:53302904-53302926 CCCTCCACGGCCAAGGTGGCTGG + Intronic
1175171284 20:57082923-57082945 CCCTGTAAGGCCAAGGTTGCTGG + Intergenic
1175770174 20:61618505-61618527 GGCAGCAACACCAAGGTGGAAGG - Intronic
1175919154 20:62441919-62441941 CCCAGCGAGGGCAAGGGCGAGGG + Intergenic
1176045475 20:63090627-63090649 CCCTGGGAGGCCAAGGTGGGCGG - Intergenic
1176113196 20:63419797-63419819 CCAAGCAAGGCCAGCGAGGAAGG + Intronic
1176172814 20:63703802-63703824 CCCAGCAGGGCCGCAGTGGACGG + Intronic
1176609266 21:8863539-8863561 CTTTGCAAGGCCAAGGTGGGTGG - Intergenic
1176918049 21:14649524-14649546 CTTTGAAAGGCCAAGGTGGATGG + Intronic
1177694475 21:24554635-24554657 CCCAGCCAGGCCAATGCAGAAGG + Intergenic
1177857890 21:26419957-26419979 CTCAGCTAGGGCAATGTGGAAGG - Intergenic
1178180133 21:30150518-30150540 CCCAAAATGGCCAAGATGGAAGG + Intergenic
1178576638 21:33798341-33798363 CTCTGAAAGGCCAAGGTGGGAGG - Intronic
1180055638 21:45357923-45357945 CACAGCATGTCCAACGTGGAAGG + Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180359360 22:11873382-11873404 CTTTGCAAGGCCAAGGTGGGTGG - Intergenic
1180485260 22:15789374-15789396 ACCAGCAAGGCAGAGGAGGAGGG - Intergenic
1180795199 22:18600357-18600379 CTTTGGAAGGCCAAGGTGGATGG - Intergenic
1180908671 22:19432830-19432852 GACAGCAAGGTCAACGTGGAAGG - Intronic
1180990294 22:19931744-19931766 CCTTGGGAGGCCAAGGTGGAAGG - Intronic
1181226540 22:21394955-21394977 CTTTGGAAGGCCAAGGTGGATGG + Intergenic
1181252109 22:21539883-21539905 CTTTGGAAGGCCAAGGTGGATGG - Intergenic
1181672740 22:24433297-24433319 CCCAGCCCGGCCCAGGCGGAGGG - Exonic
1182426781 22:30277795-30277817 CCCAGGAAAGCCAAGGGGGCTGG + Intergenic
1182443333 22:30376599-30376621 CCCAGCAAGTCCTTGCTGGAGGG + Exonic
1182452191 22:30428298-30428320 CCCAGGTAGCCCAAGGTGGAAGG + Intronic
1182651657 22:31856350-31856372 AACAACAAGGCCATGGTGGAGGG + Intronic
1182727833 22:32461928-32461950 CCTTGGAAGGCCAAGGTGGGCGG + Intronic
1182980439 22:34665697-34665719 CCCCGCATGGCAAAGCTGGAGGG + Intergenic
1183297441 22:37038932-37038954 CTTTGCAAGGCCAAGGTGGGCGG + Intergenic
1183332298 22:37228202-37228224 CCCAGCTGGGCCCAGGTTGAGGG - Intronic
1183536717 22:38406057-38406079 CTTAGGAAGGCCAAGGTGGACGG - Intergenic
1183613766 22:38928925-38928947 CTTTGGAAGGCCAAGGTGGATGG - Intergenic
1183629812 22:39026185-39026207 GGCTGCAAGTCCAAGGTGGAGGG + Intronic
1183633254 22:39046044-39046066 GGCTGCAAGTCCAAGGTGGAGGG + Intronic
1183639008 22:39082105-39082127 GGCTGCAAGTCCAAGGTGGAGGG + Intronic
1183683426 22:39348636-39348658 CCTTGGGAGGCCAAGGTGGATGG - Intergenic
1184016688 22:41791241-41791263 CTCAGGGAGGCCAAGGTGGGTGG + Intronic
1184040553 22:41940627-41940649 CCTAGGGAGGCCGAGGTGGAAGG - Intronic
1184047668 22:41981624-41981646 CCCTGCAGAGCCAAGGTGGGAGG - Exonic
1184468333 22:44681906-44681928 CACAGGGAGGCCAATGTGGAAGG + Intronic
1184685807 22:46095903-46095925 CCCAGCCAGCCCAGGGTGGCAGG + Intronic
1185190502 22:49433253-49433275 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190518 22:49433334-49433356 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190549 22:49433456-49433478 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185300238 22:50075885-50075907 GACAACAAGGCCAAGGCGGAGGG + Intronic
949524139 3:4886784-4886806 CTCTGGAAGGCCAAGGTGGGAGG - Intronic
950106713 3:10393206-10393228 CACAGCCAGGCAAAGGTGGGAGG + Intronic
950319285 3:12035254-12035276 CCCAGCAAAGCCAAGGGGGCAGG - Intronic
950486437 3:13276659-13276681 CAGAGCAAGGCCAAGGCTGATGG + Intergenic
950733728 3:14987324-14987346 CTCTGCGAGGCCAAGGCGGAAGG - Intronic
951328994 3:21343016-21343038 CCCAGGGAGGCCAAGGCGGGCGG + Intergenic
951629217 3:24699864-24699886 CCCAGCGAGACCAAGGTAGAAGG - Intergenic
951676542 3:25247716-25247738 CCCAGCCAGGCCAACGCAGAAGG - Intronic
951741580 3:25931226-25931248 CCCAGCAAGACCAATGCAGAAGG + Intergenic
953152896 3:40341340-40341362 CTCTGCGAGGCCAAGGTGGGTGG + Intergenic
954211727 3:49101514-49101536 CCCAGGAAGGCCATGGTGATGGG + Intronic
954309542 3:49754438-49754460 CTTTGGAAGGCCAAGGTGGAAGG + Intronic
954582799 3:51712164-51712186 CCAAGGAAGGCCTGGGTGGAGGG - Intronic
954820467 3:53322207-53322229 CCCTGGAAGGCCAAGGCGGGTGG + Intronic
955326625 3:58013579-58013601 CCCTGGGAGGCCAAGGTGGGTGG + Intronic
955341812 3:58130779-58130801 CCCAGCAAGGTCAAGATTGCCGG + Exonic
955347006 3:58168637-58168659 CCCTTCAAGGCCAAGGTGACAGG + Exonic
955736151 3:62040683-62040705 CTCTGGAAGGCCAAGGCGGACGG - Intronic
956021475 3:64937921-64937943 CTTTGGAAGGCCAAGGTGGAAGG - Intergenic
956524175 3:70139449-70139471 CCCAGCAAGGCCATGGGGTAGGG - Intergenic
956590987 3:70914495-70914517 AACAGCAAGGCCAACGTTGAAGG - Intergenic
957334392 3:78808444-78808466 CTTTGCAAGGCCAAGGTGGGTGG - Intronic
957768280 3:84655453-84655475 CACAGAAAGGTGAAGGTGGAAGG + Intergenic
959278115 3:104304057-104304079 CCCAGCGAGACCAATGTCGAAGG + Intergenic
959375266 3:105581862-105581884 CCCAGAAAGCTCAAGGAGGAAGG - Intergenic
959842763 3:110998345-110998367 CCCAGCAAGACCAATGCAGAAGG + Intergenic
960344544 3:116516548-116516570 CCCAGCAAGACCAGGGTGCCTGG - Intronic
961452939 3:127010609-127010631 CGCATCAAGGCCAATGTGGCTGG - Intronic
961668621 3:128509986-128510008 CCCAGTAAGGGAAAGGAGGATGG + Intergenic
961690478 3:128665954-128665976 CTCTGCAAGGCCAAGGTGGGCGG - Intronic
962634869 3:137319979-137320001 CCCAGCAAGATCAAGGCAGAAGG - Intergenic
963027343 3:140933130-140933152 CCCAGCAAGACCAAAGCAGAAGG + Intergenic
963288083 3:143456804-143456826 CTCTGGGAGGCCAAGGTGGATGG - Intronic
964293607 3:155209438-155209460 CTCAGGGAGGCCAAGGTGGAAGG - Intergenic
964391345 3:156201210-156201232 CCCAGCAAGACCAATGCAGAAGG - Intronic
964466273 3:156996819-156996841 CTCTGGGAGGCCAAGGTGGATGG + Intronic
965091181 3:164163827-164163849 CCCAGCAAGACCAATGCAGAGGG - Intergenic
965520036 3:169662367-169662389 CCCAGCAAGCCCGAGGTGCGCGG + Intronic
966551796 3:181213598-181213620 CCCTGCAAGTCCCAGGTGGTAGG - Intergenic
966638016 3:182157102-182157124 CCCAGCAAGATCAAGGCAGAAGG - Intergenic
966723469 3:183087623-183087645 CCCAGCAAGGCCAAGGCGGGCGG + Intronic
966817429 3:183900627-183900649 CTCTGGAAGGCCAAGGTGGGAGG + Intergenic
967715482 3:192757802-192757824 CCCAGCAAGACCAACGCAGAGGG + Intronic
967761914 3:193235340-193235362 CTTTGGAAGGCCAAGGTGGATGG - Intergenic
968979873 4:3841477-3841499 CTCAGAAAGGCCATGGAGGATGG - Intergenic
969122522 4:4920533-4920555 CCCAGGATGGCCAAGGTGTGTGG - Intergenic
969350486 4:6595478-6595500 GCCGGGAAGTCCAAGGTGGAGGG + Intronic
969441868 4:7222021-7222043 CCCACCCGGGCCAGGGTGGATGG + Intronic
969571410 4:8010881-8010903 CCCAGCAAGTCCCAGGGAGAAGG + Intronic
970304622 4:14718688-14718710 CCCAGCAAGACCAACGCAGAAGG + Intergenic
971248773 4:24954230-24954252 CCCAGCAAAGCCATGGGGGCAGG - Intronic
971270713 4:25142031-25142053 CCCTGGGAGGCCAAGGTGGGGGG + Intronic
972291277 4:37692319-37692341 ACCTGAAAGGCCAAGGTGGGAGG + Intergenic
972442334 4:39106973-39106995 CTCTGAGAGGCCAAGGTGGAAGG - Intronic
972450847 4:39196838-39196860 CTCAGCAAGGACAATGTGGTTGG - Intronic
973321691 4:48817034-48817056 CCCAGCAAGACCAACGCAGAAGG + Intronic
974326404 4:60419773-60419795 CCCAGCAAGACCAATGCAGATGG - Intergenic
974676820 4:65101948-65101970 CTTTGCAAGGCCAAGGTGGGAGG - Intergenic
976106048 4:81618623-81618645 CTTTGGAAGGCCAAGGTGGAAGG - Intronic
976208602 4:82645068-82645090 CTTTGGAAGGCCAAGGTGGAAGG + Intronic
976277722 4:83294512-83294534 ACCTGGAAGGCCAAGGTGGGAGG + Exonic
976446075 4:85130512-85130534 CCCAGCAAGATCAATGTAGAAGG - Intergenic
977425444 4:96862589-96862611 CCCAGCAAGACCAATGCAGAAGG + Intergenic
978508810 4:109492961-109492983 CTTTGGAAGGCCAAGGTGGAAGG - Intronic
978526926 4:109677035-109677057 CCCAGCAAAGCCATGGGGGCAGG + Intronic
978664192 4:111163775-111163797 CCCAGCAAGACCAATGCAGAAGG + Intergenic
979649565 4:123114480-123114502 TCCAGAAGGGCCAAGGTGGCAGG + Intronic
979705265 4:123713323-123713345 CCCAGCAAGACCAATGCAGAAGG + Intergenic
980061426 4:128134242-128134264 CTTTGCAAGGCCAAGATGGAAGG - Intronic
980148661 4:129020999-129021021 CCCAGCAAGACCAACGCAGAAGG + Intronic
980629315 4:135412494-135412516 CCCAGCAAAAGCAAGGTGGGAGG + Intergenic
981816426 4:148835877-148835899 CCCAGAAAGGAAAAGGAGGATGG - Intergenic
981995122 4:150965785-150965807 CTTTGCAAGGCCGAGGTGGAAGG - Intronic
982393517 4:154891732-154891754 CCCAGCAAGACCAGTGCGGAAGG + Intergenic
982848061 4:160276309-160276331 CCCAGCGAGACCAACGTAGAAGG + Intergenic
983253511 4:165372828-165372850 CTTGGCAAGGCCAAGGTGGGTGG - Intronic
983314135 4:166105735-166105757 CCCAGAAAGGACAAAGTGAAAGG + Intergenic
983567385 4:169167891-169167913 CACTGGAAGGCCAAGGTGGTAGG + Intronic
983896262 4:173084879-173084901 CCCAGCAAGACCAACGCAGAAGG - Intergenic
984206301 4:176792298-176792320 CCCAGCAAGTGCATGGTGGAAGG + Exonic
984493577 4:180468155-180468177 CCCAGCAAGACCAATGCAGAAGG + Intergenic
984526159 4:180861131-180861153 CCCAGCAAGACCAAAGCAGAAGG - Intergenic
1202769979 4_GL000008v2_random:194973-194995 CTTTGCAAGGCCAAGGTGGGTGG + Intergenic
985632596 5:1021833-1021855 CCCAGCAGGGATAAGGCGGATGG + Intronic
985928515 5:3036107-3036129 CCCTGCAAGGCGGAGGTGGGAGG + Intergenic
986162250 5:5240604-5240626 CACAGCAAGGTGTAGGTGGATGG - Intronic
986193103 5:5514893-5514915 AGCACCAAGGCCCAGGTGGATGG + Intergenic
986608548 5:9545926-9545948 CCCTGCACGGGGAAGGTGGAGGG + Exonic
986609596 5:9553224-9553246 CCCAGCAAAGCCATGGGGGTAGG - Intergenic
988167923 5:27617691-27617713 CCCAGCAAGACCAATGCAGAAGG - Intergenic
988204024 5:28110907-28110929 CCCAGCAAGCCCAACGGAGAAGG - Intergenic
988570239 5:32358112-32358134 CTCTGGAAGGCCAAGGTGGAAGG + Intronic
989719330 5:44505326-44505348 CCCAGCAAAGCCATGGGGGTGGG + Intergenic
990447401 5:55905352-55905374 TGCAGCAAGGCAGAGGTGGAAGG - Intronic
990956359 5:61344136-61344158 CTCTGGGAGGCCAAGGTGGATGG - Intronic
991471130 5:66970180-66970202 ACCAGCAAGGGTAGGGTGGAGGG - Intronic
991706533 5:69363539-69363561 CTCAGGGAGGCCAAGGTGGGTGG + Intronic
991723872 5:69516811-69516833 CTTAGGGAGGCCAAGGTGGAAGG + Intronic
992806797 5:80345638-80345660 CCTTGGAAGTCCAAGGTGGAAGG + Intergenic
992852906 5:80828860-80828882 CCCAGGAAAGCCTAGGTGGTGGG - Intronic
993608914 5:90031209-90031231 CCCAGCAAGACCAACGCAGAAGG + Intergenic
995209674 5:109523148-109523170 CCCAGGAAGGCTGAGGTGGGAGG - Intergenic
995967962 5:117932108-117932130 CTCTGAGAGGCCAAGGTGGACGG - Intergenic
996010529 5:118477562-118477584 CCTTGCAAGCCCAAGGTGGATGG + Intergenic
997364755 5:133318800-133318822 CCCACCAAGGTCCAGGAGGAAGG - Intronic
997364814 5:133319063-133319085 CCCAGCAAGACCCACCTGGATGG - Intronic
997444950 5:133933951-133933973 CCCAGCAGGTCCCAGGTGGGAGG - Intergenic
997947589 5:138215935-138215957 ACCAACAAGGCCTAGATGGATGG + Intergenic
998174961 5:139896015-139896037 TCCAGCCAGGCCAAGGAGGCAGG - Intronic
998228068 5:140342066-140342088 CCCAGCAAGGACGAGGAGGTGGG - Intronic
998369078 5:141649719-141649741 CCCAGCAAGGACACTGTGGGTGG - Intronic
998644523 5:144047832-144047854 CCCAGCAAGACCAATGCGGAGGG + Intergenic
999305303 5:150515704-150515726 CCCAGCAGGCCCAGGGTGGTGGG + Intronic
999502490 5:152160701-152160723 CCCAGCAAGACCAATGCAGAAGG - Intergenic
999683951 5:154085722-154085744 CTCAGCAAGGTCATGGTGAATGG + Intronic
999741617 5:154559286-154559308 TCCAGCCTGGCCAACGTGGAAGG - Intergenic
1000977716 5:167783270-167783292 CCTAGCAAGTCCAAGGAGAAGGG + Intronic
1001388986 5:171363292-171363314 CCTTGGGAGGCCAAGGTGGAAGG + Intergenic
1001523743 5:172414136-172414158 CCCAAGAGGGCCGAGGTGGAAGG + Intronic
1001592457 5:172874813-172874835 CCTTGAAAGGCCAAGGTGGGAGG + Intronic
1002147268 5:177194524-177194546 CTCCGGAAGGCCAAGGTGGGAGG - Intronic
1002457889 5:179356125-179356147 TCCAGCAAGGCCAAGGTCGAAGG - Intergenic
1002457974 5:179356470-179356492 TACAGCAAGGCCAAGGTCCAAGG - Intergenic
1002996138 6:2286940-2286962 CTCAGCAAGGCCACTGTGGCCGG + Intergenic
1004545819 6:16597283-16597305 CCCAACAGGGCCAAGGGGCAAGG - Intronic
1006025784 6:31145767-31145789 ACCACCATGGCTAAGGTGGAAGG - Exonic
1006683286 6:35812480-35812502 CCCAGCAAAGCTAAGGTGAGGGG + Intronic
1007519426 6:42440049-42440071 CCCTGCCAGGCCACGGTGGGTGG - Intronic
1008367801 6:50703308-50703330 CTTTGCAAGGCCAAGGTGGGTGG + Intergenic
1008381743 6:50845293-50845315 CCCACCAAGGCAAAGCGGGAGGG - Exonic
1008425318 6:51349702-51349724 CCCAGCAAGACCAATGCAGAAGG - Intergenic
1008625321 6:53309903-53309925 CCCAGCAAGGCCTACCTGGGTGG - Intronic
1008719047 6:54327197-54327219 CCCAGCGAGACCAACGTAGAAGG + Intronic
1009418580 6:63441433-63441455 CCCGGCCTGGCCAAGGTGGCAGG + Intergenic
1009455161 6:63848428-63848450 CCCAGCAAGACCAACGGAGAAGG + Intronic
1009663893 6:66651495-66651517 CCCACCAAGACCAAAGTGGTAGG - Intergenic
1010082367 6:71878760-71878782 CTTTGAAAGGCCAAGGTGGAAGG + Intergenic
1010213055 6:73377916-73377938 TTCAGGAAGGCCAAGGTAGAAGG - Intronic
1010615260 6:78005371-78005393 CCCAGCAAGACCAATGCAGAAGG + Intergenic
1011065394 6:83320899-83320921 CCCAGCAAGACCAATGCAGAAGG + Intronic
1011416386 6:87123993-87124015 CTCCGGGAGGCCAAGGTGGACGG + Intergenic
1011678529 6:89759826-89759848 CTCTGGAAGGCCAAGGTGGGTGG + Intronic
1011691250 6:89871484-89871506 CCCAGCACAGCCAAGGTGGGAGG + Intronic
1011868451 6:91861698-91861720 CCCTGGGAGGCCAAGGTGGGTGG + Intergenic
1011938647 6:92814564-92814586 CCCTGGGAGGCCAAGGTGGGTGG - Intergenic
1012701048 6:102458348-102458370 CCCAGCAAGACCAATGCAGAAGG + Intergenic
1012889373 6:104881261-104881283 CCAAGCAAGGCTAAGGTTAAAGG + Intergenic
1012905188 6:105056002-105056024 CCTTGGGAGGCCAAGGTGGAAGG - Intronic
1013136956 6:107291607-107291629 CTCTGGAAGGCCAAGGTGGGAGG - Intronic
1013452882 6:110302908-110302930 CCCAGCAAGACCAATGCAGAAGG + Intronic
1013811703 6:114052068-114052090 CCCCTCAAGGCTATGGTGGAAGG + Intergenic
1013920258 6:115394992-115395014 CCCAGCAAGGACAATGCAGAAGG - Intergenic
1014129197 6:117811378-117811400 CCCAGCAAGACCAATGCAGAAGG - Intergenic
1014223648 6:118823491-118823513 CCCAGCAAGACCAATGCAGAAGG - Intronic
1014392240 6:120877133-120877155 CCCATGAAGGCCAAGGTAGTAGG - Intergenic
1014714582 6:124849253-124849275 CCCTGCTAGGGCAATGTGGAAGG + Intergenic
1014753594 6:125279985-125280007 CCCAGCAAGACCAAGGCAGAAGG + Intronic
1014872725 6:126615477-126615499 CCCAGAGAGATCAAGGTGGAAGG - Intergenic
1014960806 6:127682176-127682198 CCCAGGAATTCCAAGGTGGGAGG + Intergenic
1015211212 6:130701358-130701380 CCCAGCAAGACCAATGTAGAAGG + Intergenic
1015293158 6:131561100-131561122 CTTTGGAAGGCCAAGGTGGAAGG - Intergenic
1015533549 6:134244710-134244732 CCCAGCAAGACCAATGCAGAAGG - Intronic
1015937865 6:138420659-138420681 CCAAGCAAGGCCATGGTACAAGG + Exonic
1016665110 6:146630312-146630334 ACTTGGAAGGCCAAGGTGGAAGG + Intronic
1016973143 6:149783936-149783958 CTCTGAAAGGCCAAAGTGGAAGG - Intronic
1017723785 6:157262663-157262685 CCCAGCGAGGCTGAGGTGGGAGG + Intergenic
1018284291 6:162220430-162220452 CCCAGCAAGGCCAGAGTTCATGG + Intronic
1018507925 6:164491337-164491359 CCCAGCAAGACCAATGTAGAAGG - Intergenic
1018900929 6:168051408-168051430 ACCAGCAAGGCCATGGTGTTAGG + Intergenic
1019059539 6:169246192-169246214 GCCAGCAAGGCCAGGGAGGTAGG - Exonic
1019344699 7:523488-523510 CTCACCAAGGCCAAGGTCAAGGG - Intergenic
1019345362 7:527032-527054 ACCAGCAGGGCTGAGGTGGAGGG + Intergenic
1019446769 7:1075268-1075290 CTTAGGAAGGCCAAGGTGGGCGG + Intronic
1019827800 7:3299151-3299173 CCCAGCAAAGCAGAGGTGGTTGG + Intergenic
1019928248 7:4207158-4207180 CCCAGCAAGAGCAAGGCGGGCGG + Intronic
1020066904 7:5195241-5195263 CTATGCAAGGCCAAGGTGGGAGG + Intronic
1020283811 7:6664738-6664760 CCCTGCAAGGCCAAGGCGGGAGG - Intergenic
1020447071 7:8280343-8280365 CTTAGGGAGGCCAAGGTGGATGG - Intergenic
1021624954 7:22583938-22583960 CCCAGGAGGGCCAAGATGGTGGG - Intronic
1021940255 7:25672094-25672116 CCCAGGGAGGCCAAGGCGGGTGG + Intergenic
1022615529 7:31926534-31926556 CCCAGCAAGACCAAGGCAGAAGG + Intronic
1023677629 7:42646992-42647014 GCCAGGAAGTCCAAGGTTGAGGG - Intergenic
1023864150 7:44230957-44230979 CCCAGCAATGCCAAGGCCGCTGG + Intronic
1024479701 7:49851123-49851145 CCCAGGAAGCCCAGGGTGGCGGG - Intronic
1025096771 7:56102058-56102080 CTCTGGAAGGCCAAGGTGGGAGG - Intronic
1025249822 7:57344285-57344307 CCAAGCAGGGCCATGGGGGAGGG + Intergenic
1025720950 7:64012554-64012576 CTTTGCGAGGCCAAGGTGGAAGG - Intergenic
1025735396 7:64142595-64142617 ACTAGGAAGGCCAAGGTGGGAGG - Intronic
1025923055 7:65932339-65932361 CTCTGGGAGGCCAAGGTGGATGG - Intronic
1026411029 7:70123117-70123139 CTTTGGAAGGCCAAGGTGGATGG - Intronic
1026777156 7:73237684-73237706 CTCTGGGAGGCCAAGGTGGAAGG + Intergenic
1026823013 7:73562287-73562309 CTTTGGAAGGCCAAGGTGGACGG + Intergenic
1026852660 7:73734947-73734969 CCCTGCCAGGCCAAGGAGGAAGG - Intergenic
1026982743 7:74536245-74536267 CCCAGCAAGGTCAAGGACGGTGG - Exonic
1027018002 7:74791056-74791078 CTCTGGGAGGCCAAGGTGGAAGG + Intergenic
1027070024 7:75154856-75154878 CTCTGGGAGGCCAAGGTGGAAGG - Intergenic
1027197979 7:76044391-76044413 CTCTGGAAGGCCAAGGTGGGAGG - Intronic
1027413383 7:77946876-77946898 CTTTGGAAGGCCAAGGTGGATGG + Intronic
1027582764 7:80019871-80019893 CCCAGCAAGACCAATGCAGAAGG + Intergenic
1028638340 7:93016043-93016065 CCCAGCAAAGGGAAGGGGGAGGG - Intergenic
1028815252 7:95136345-95136367 ACCAGGGAGGCCAAGGTGGGAGG + Intronic
1029083077 7:97990036-97990058 TCCAGGAATGCCAAGGTAGAGGG - Exonic
1029728339 7:102423355-102423377 CCCTGGGAGGCCGAGGTGGATGG - Intronic
1029846549 7:103417983-103418005 CACTGGAAGGCCAAGGTGGGTGG - Intronic
1030289223 7:107855729-107855751 CTTTGGAAGGCCAAGGTGGAAGG + Intergenic
1030343362 7:108405873-108405895 CTCTGGAAGGCCAAGGTGGGAGG + Intronic
1030482206 7:110119452-110119474 CCCAGCAAGACCAATGCAGAAGG + Intergenic
1030640715 7:112003135-112003157 CTCTGGAAGGTCAAGGTGGAAGG + Intronic
1031362999 7:120869098-120869120 CCCAGAAAGGCCAAGGAAGTTGG - Intergenic
1032075751 7:128835325-128835347 GACAGCAAGGCCATCGTGGATGG + Exonic
1032296038 7:130639124-130639146 CCCAGCGAGATCAACGTGGAAGG - Intronic
1034484790 7:151352684-151352706 CCCTGGGAGGCCAAGGTGGGAGG - Intronic
1034624733 7:152483981-152484003 CCCAGCAAGGCCAAGGGTCGTGG - Intergenic
1035336523 7:158133027-158133049 CCCAGCAAGGCACAAGTGGCTGG - Intronic
1035412099 7:158653123-158653145 CCTTGAAAGGCCAAGGTGGGTGG + Intronic
1035454093 7:158997727-158997749 CCCAGGAAGGCCGAGGGGCATGG - Intergenic
1037137955 8:15486035-15486057 CCATGGGAGGCCAAGGTGGATGG - Intronic
1037298975 8:17431626-17431648 CTCAGCAAGGCTGAGGTGGGAGG + Intergenic
1037607971 8:20453493-20453515 CTCTGGGAGGCCAAGGTGGAAGG - Intergenic
1038315532 8:26481464-26481486 CCAAATAAGGCCAAGGTGAATGG - Intronic
1038382807 8:27112804-27112826 CCCAGCAAGCCCAGGCTGCAGGG + Intergenic
1038414264 8:27382189-27382211 CTTTGGAAGGCCAAGGTGGATGG - Intronic
1038453366 8:27654513-27654535 CCTTGGGAGGCCAAGGTGGAAGG + Intronic
1040061017 8:43102798-43102820 CCGTGCAAGGCCATGGTGGAGGG - Intronic
1040401585 8:47055402-47055424 CTCTGCAAGGCCAAGGTGAGTGG + Intergenic
1040826276 8:51623848-51623870 CTCTGTGAGGCCAAGGTGGAAGG + Intronic
1041287202 8:56273286-56273308 CCCAGCAAGACCAATGCAGAAGG + Intergenic
1041735876 8:61109913-61109935 CCTAGGAAGTCCAAGGTTGATGG - Intronic
1042635305 8:70867693-70867715 CTCTGGAAGGCCAAGGTGGGTGG - Intergenic
1043253771 8:78106972-78106994 CCCAGCAAGGCCAACACCGAAGG - Intergenic
1043615010 8:82114631-82114653 CCCAGCAAAGCCAAGGAAGTGGG - Intergenic
1044463954 8:92482019-92482041 ACCAGCAAGGCAAAGCTGAAAGG - Intergenic
1044865723 8:96569250-96569272 CTTTGGAAGGCCAAGGTGGAAGG - Intronic
1045367140 8:101486784-101486806 CTTTGGAAGGCCAAGGTGGATGG + Intergenic
1045839253 8:106560755-106560777 CCCAGCAAGACCAATGCAGAAGG + Intronic
1046545061 8:115639310-115639332 CTCTGGAAGGCCAAGGTGGCAGG - Intronic
1047105574 8:121727268-121727290 CCCAGCAAAGCCACAGTGGTGGG - Intergenic
1047110472 8:121784073-121784095 CTCGGAAAGGCCAAGGTGGGTGG + Intergenic
1047636358 8:126767529-126767551 CACAACAATGCCAAGGGGGATGG - Intergenic
1048856331 8:138689470-138689492 CTCTGCAAGGCCAAGGCAGACGG + Intronic
1049005457 8:139852746-139852768 CCCAGCCAGCCCAAGGTAGCTGG - Intronic
1049060069 8:140269853-140269875 CTTTGGAAGGCCAAGGTGGATGG + Intronic
1049437703 8:142595356-142595378 CCCACACAGGCAAAGGTGGAGGG + Intergenic
1049512255 8:143034507-143034529 CTTAGGGAGGCCAAGGTGGATGG + Intergenic
1049514831 8:143048711-143048733 CTTAGGGAGGCCAAGGTGGATGG - Intronic
1050435168 9:5601102-5601124 CCCTGGGAGGCCAAGGTGGGTGG - Intergenic
1050717048 9:8541610-8541632 CACTGGAAGGCCAGGGTGGAAGG - Intronic
1050736048 9:8764552-8764574 CTTAGGAAGGCCAAGGTGGGTGG + Intronic
1051231685 9:14961838-14961860 CCCAGCAAAGCAAAGGAAGAAGG - Intergenic
1051322046 9:15915041-15915063 CCCAGCAAGACCAATGCAGAAGG - Intronic
1051583202 9:18699431-18699453 ACCAGGAAGGCTAAGGTGGGAGG - Intronic
1051642537 9:19237260-19237282 CTCTGGAAGGCCAAGGTGGGCGG - Intronic
1052144144 9:25026258-25026280 CCCAGCGAGACCAATGTAGAAGG - Intergenic
1053028211 9:34749487-34749509 CCTTGAAAGGCCAAGGTGGGAGG + Intergenic
1053245925 9:36534757-36534779 CTCAGGGAGGCCAAGGTGGGTGG - Intergenic
1053458740 9:38251860-38251882 CCGGCCAAGGCCAAGGTTGAAGG - Intergenic
1053658704 9:40248004-40248026 CTTTGCAAGGCCAAGGTGGGTGG - Intronic
1053909080 9:42877273-42877295 CTTTGCAAGGCCAAGGTGGGCGG - Intergenic
1054359371 9:64098959-64098981 CTTTGCAAGGCCAAGGTGGCTGG - Intergenic
1054370823 9:64394278-64394300 CTTTGCAAGGCCAAGGTGGGTGG - Intronic
1054525894 9:66128218-66128240 CTTTGCAAGGCCAAGGTGGGTGG + Intronic
1054678456 9:67884026-67884048 CTTTGCAAGGCCAAGGTGGGTGG - Intronic
1054907583 9:70424189-70424211 CCGTGGAAGGCCAAGGTGGGAGG + Intergenic
1055061328 9:72072242-72072264 CCCAGCAAGACCAATGCAGAAGG + Intronic
1055221226 9:73934348-73934370 CTTTGCAAGGCCAAGGTGGGAGG + Intergenic
1055628656 9:78200699-78200721 CCCAGCAAGACCAACGCAGAAGG + Intergenic
1056335463 9:85564109-85564131 CCCAGCAAAGCCATGGGGGCAGG + Intronic
1057044516 9:91874690-91874712 CACAGAAAGGCCGAGGTGGGTGG + Intronic
1057203241 9:93154835-93154857 ACCAGGAAGGCCCATGTGGAAGG - Intergenic
1057206297 9:93174975-93174997 ACCATCAGGGCCAAGGGGGAAGG + Intergenic
1057642489 9:96837967-96837989 CTTTGAAAGGCCAAGGTGGACGG - Intronic
1057802637 9:98199391-98199413 GCCAGCGAGGACGAGGTGGAGGG - Exonic
1059158705 9:112013299-112013321 CTTTGGAAGGCCAAGGTGGAAGG - Intergenic
1059471525 9:114508332-114508354 CCCTGGGAGGCCAAGGTGGATGG - Intergenic
1059791708 9:117647687-117647709 CTTTGCAAGGCCAAGGTGGGTGG - Intergenic
1060524622 9:124313609-124313631 CCCAGCGAGGCTGAGGTGGGTGG - Intronic
1060604205 9:124899593-124899615 CTCAGCAACGCCAGGGGGGATGG - Intronic
1060795579 9:126510625-126510647 CCCACCTAGGGCAACGTGGAAGG - Intergenic
1060853191 9:126894559-126894581 CCGAAAAAGGCCAAAGTGGATGG + Intergenic
1060916385 9:127393943-127393965 CTTTGGAAGGCCAAGGTGGAAGG + Intergenic
1061278929 9:129586038-129586060 CTTTGCAAGGCCGAGGTGGACGG - Intergenic
1061447294 9:130647409-130647431 CTTTGGAAGGCCAAGGTGGATGG + Intergenic
1061611060 9:131746208-131746230 CCCTGGAAGGCCGAGGTGGGTGG - Intergenic
1061612042 9:131753470-131753492 CTCTGGGAGGCCAAGGTGGAAGG - Intergenic
1061861127 9:133469300-133469322 CCCAGCAGGCCCAGGGAGGAGGG - Exonic
1061919798 9:133776516-133776538 CCCAGTGAGGCCAGGGTGGGGGG - Intronic
1062494767 9:136826533-136826555 CCCAACAAAGCACAGGTGGAGGG - Intronic
1203694873 Un_GL000214v1:88650-88672 CTTTGCAAGGCCAAGGTGGGTGG + Intergenic
1203732517 Un_GL000216v2:103701-103723 CCCAGGGAGGCCAATGTGGAAGG - Intergenic
1203704671 Un_KI270742v1:28784-28806 CTTTGCAAGGCCAAGGTGGGTGG - Intergenic
1203559329 Un_KI270744v1:37029-37051 CTTTGCAAGGCCAAGGTGGGTGG + Intergenic
1203641400 Un_KI270751v1:15413-15435 CTTTGCAAGGCCAAGGTGGGTGG - Intergenic
1186172104 X:6888396-6888418 CTCTGGAAGGCCAAGGTGGGTGG + Intergenic
1186848761 X:13558350-13558372 CCCAGGGAGGCTAAGGTGGGAGG - Intergenic
1187466807 X:19534745-19534767 CCCAGGAAGACCAAGGTGTTTGG + Exonic
1187719312 X:22134801-22134823 CCCAGCAAGGCCTGGGTTAATGG + Intronic
1187876711 X:23810019-23810041 CCTTGGAAGGCCAAGGTGGGAGG + Intergenic
1188704800 X:33314499-33314521 CTTTGCGAGGCCAAGGTGGACGG - Intronic
1188915554 X:35905261-35905283 CCCAGCAAGACCAATGCAGAAGG - Intergenic
1189298584 X:39936126-39936148 CCCAGCAAGCCCACAGGGGAAGG + Intergenic
1189418567 X:40835412-40835434 CGCAGCAAGGACAAGGTGTGTGG + Intergenic
1190337832 X:49273318-49273340 CCTTGCAGGGCCAAGGTGGGTGG + Intronic
1190495185 X:51021460-51021482 CCCAGCAAGACCAATGCAGAAGG - Intergenic
1191011371 X:55762942-55762964 AGCAGCAAGGCCAATGTGGCAGG + Intergenic
1191586569 X:62833771-62833793 CCCAGCAAAGCCATGGGGGCTGG - Intergenic
1192034182 X:67545627-67545649 CCCAGCAGGGACAACGTGGATGG - Exonic
1192400897 X:70834510-70834532 CCTAGGGAGGCCAAGGTGGGTGG + Intronic
1192451594 X:71248359-71248381 CCCAGCAGGGGCCAAGTGGAAGG + Intronic
1193071794 X:77314436-77314458 CCCAGCAAGACCAACGCAGAAGG + Intergenic
1193525380 X:82581730-82581752 CCCAGCAAGGTCAAGGCAGAAGG - Intergenic
1193946217 X:87738834-87738856 ACCAGGAAGTCCAAGGTTGAGGG - Intergenic
1194057917 X:89160868-89160890 CTCTGGAAGGCCAAGGTAGATGG - Intergenic
1194208044 X:91035205-91035227 CTTAGGGAGGCCAAGGTGGATGG - Intergenic
1194708046 X:97200084-97200106 CCCAGGAAGGCCAAGGAGCCAGG + Intronic
1195680611 X:107543339-107543361 GCAAGGAAGGCCAAGGTGGCTGG - Intronic
1197184644 X:123573256-123573278 CCCAGCAAGACCAATGCAGAAGG + Intergenic
1197436197 X:126430969-126430991 CCCAGCAAAGCCATGGAGGCAGG + Intergenic
1197625715 X:128800184-128800206 CCCAGCTAGGACATGGTGCAGGG + Intergenic
1198062500 X:133061546-133061568 CCCAGCAAGACCAACGCAGAAGG + Intronic
1199766621 X:150946079-150946101 CTTTGCAAGGCCAAGGTGGGTGG + Intergenic
1199830594 X:151545815-151545837 CCCAGCAAGACCAACGCAGAAGG + Intergenic
1199876580 X:151934451-151934473 TCCAGAAAGGCCAAAGTGGCTGG - Intergenic
1200064510 X:153498021-153498043 CCCAGCCAGCCCAAGGGGCAGGG + Intronic
1200215876 X:154368069-154368091 GACAGCAAGGCCATCGTGGACGG - Exonic
1200702921 Y:6417440-6417462 CCCTGCAAGGCCCAGGATGAAGG - Intergenic
1200709320 Y:6469410-6469432 CCCTGCAAGGCCCAGGATGAAGG - Intergenic
1200709930 Y:6474156-6474178 CCCTGCAAGGCCCAGGATGAAGG - Intergenic
1200749835 Y:6934794-6934816 CCCTGGGAGGCCAAGGTGGGAGG - Intronic
1200910743 Y:8529368-8529390 CCCTGCAAGGCCCAGGATGAAGG + Intergenic
1200917051 Y:8580481-8580503 CCCAGCAAGGCCCAGGATGAAGG + Intergenic
1200927913 Y:8671170-8671192 CCCTGCAAGGCCTAGGTTGAAGG + Intergenic
1200928944 Y:8679668-8679690 CCCTGCAAGGCCAAGGATGAAGG - Intergenic
1200930426 Y:8691962-8691984 CCCTGCAAGGCCCAGGATGAAGG - Intergenic
1200938470 Y:8758890-8758912 CCCTGCAAGGCCCAGGATGAAGG - Intergenic
1201024185 Y:9690552-9690574 CCCTGCAAGGCCCAGGATGAAGG + Intergenic
1201024792 Y:9695298-9695320 CCCTGCAAGGCCCAGGATGAAGG + Intergenic
1201031189 Y:9747257-9747279 CCCTGCAAGGCCCAGGATGAAGG + Intergenic
1201931902 Y:19360070-19360092 CCCAGCAAGACCAATGCCGAAGG + Intergenic
1202066293 Y:20943716-20943738 CCCAGGAAGTGCAAGGTGTAAGG - Intergenic