ID: 1103731361

View in Genome Browser
Species Human (GRCh38)
Location 12:123029917-123029939
Sequence GGGTCTGTTTTCCCAGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 276}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103731361_1103731369 19 Left 1103731361 12:123029917-123029939 CCAGAAACTGGGAAAACAGACCC 0: 1
1: 0
2: 2
3: 21
4: 276
Right 1103731369 12:123029959-123029981 TGAGACACTCACTGTCCAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103731361 Original CRISPR GGGTCTGTTTTCCCAGTTTC TGG (reversed) Intronic