ID: 1103733811

View in Genome Browser
Species Human (GRCh38)
Location 12:123045844-123045866
Sequence CTTTGGTACCATGAGTAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 276}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103733811_1103733824 30 Left 1103733811 12:123045844-123045866 CCACCCTACTCATGGTACCAAAG 0: 1
1: 0
2: 0
3: 17
4: 276
Right 1103733824 12:123045897-123045919 GACTCCTTCTGCAATAGCTATGG 0: 1
1: 0
2: 2
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103733811 Original CRISPR CTTTGGTACCATGAGTAGGG TGG (reversed) Intronic
901300597 1:8197605-8197627 CTGTGGTCCCATGACTCGGGAGG + Intergenic
902137276 1:14320190-14320212 CTTTGGTAGAATGAGGAGGCAGG + Intergenic
902317716 1:15635646-15635668 CTTTGGGAGGATGAGGAGGGTGG - Intronic
902867627 1:19289883-19289905 CTTTGGGAGCCTGAGAAGGGAGG + Intergenic
903406619 1:23102714-23102736 CTTTGGTAAGATGAGCGGGGAGG + Intronic
903470418 1:23582987-23583009 ATTTGGTACCAGGTGTGGGGTGG + Intronic
904079054 1:27860649-27860671 CTTTGGGACGTTGAGGAGGGTGG - Intergenic
904136649 1:28317706-28317728 CTTTGGGACACCGAGTAGGGAGG - Intergenic
905735848 1:40325307-40325329 TTTTGGTATTATGAGTAGAGAGG + Intergenic
907346966 1:53790119-53790141 CTTTGGGACGATGAGGTGGGTGG + Intronic
907645786 1:56242125-56242147 CTTTGGGAGGATGAGTTGGGAGG - Intergenic
908621269 1:65983008-65983030 CTTTGGGCCCATGAATGGGGTGG - Intronic
910324874 1:85995566-85995588 CCATGGTACCCTGAGGAGGGAGG + Intronic
912385265 1:109268292-109268314 CTGTGGTACCATGGGCTGGGAGG + Intronic
912525736 1:110281324-110281346 CTTTGGAAACAGGTGTAGGGTGG - Intronic
913101615 1:115572905-115572927 AATTGGTACCAGGAGTGGGGTGG + Intergenic
913282109 1:117195905-117195927 CTTTAGGAGGATGAGTAGGGAGG + Intronic
916503331 1:165405794-165405816 CTTTGGTGCAATGAATAGGCAGG - Intronic
916891998 1:169121188-169121210 CTTTGGGAGGATGAGTTGGGTGG - Intronic
917130136 1:171733212-171733234 CTTTGGGAAGATGAGGAGGGAGG + Intronic
917140242 1:171828025-171828047 AATTGGTACCAGGAGTAGTGGGG - Intergenic
918167406 1:181963371-181963393 CTTTGGGAGCCTGAGTTGGGAGG + Intergenic
918326496 1:183416346-183416368 CTTTGGAACCAAGAGAAAGGAGG - Intronic
924648304 1:245900773-245900795 CTTAGGTGCCATGAATATGGTGG - Intronic
924667657 1:246090023-246090045 CTTTGGTACCAAGAGGACAGAGG - Intronic
1064588261 10:16861905-16861927 CTTTGGGAGCCTGAGGAGGGTGG + Intronic
1064894385 10:20217563-20217585 CTTGGGTACCTTCTGTAGGGAGG - Exonic
1065291662 10:24236485-24236507 CTTTGGGAGGCTGAGTAGGGTGG - Intronic
1065802247 10:29363208-29363230 CTCTGATACCAGGAGTAAGGTGG + Intergenic
1066410564 10:35164804-35164826 CTTTGGGAGCCTGAGTTGGGTGG + Intronic
1066492159 10:35904259-35904281 CTTTGGTAGGCTGAGGAGGGAGG - Intergenic
1067058697 10:43066712-43066734 CTTGGGAACCATGAGCAGGGTGG + Intergenic
1068026246 10:51648958-51648980 CTTTGGTAGGATGAGGCGGGCGG + Intronic
1070235034 10:74615440-74615462 CTTTGGTATCATAACTATGGTGG - Intronic
1072689017 10:97558235-97558257 CTCTGATACCAGGAGTAAGGTGG + Intronic
1073670100 10:105578744-105578766 CTGTGGGACCATGGGTAGTGAGG + Intergenic
1073756938 10:106590896-106590918 CTTTGGGAGCATGAGGTGGGTGG - Intronic
1075481009 10:122781808-122781830 CATTGGTACCATGAGTGAGAAGG + Intergenic
1075662589 10:124208480-124208502 CTTAGGTAACTTCAGTAGGGAGG - Intergenic
1076712963 10:132348911-132348933 CTTTGGTACAGTGAGTTTGGGGG + Intronic
1076803243 10:132842604-132842626 AATTGGTACCAGGAGTGGGGTGG - Intronic
1076865094 10:133162555-133162577 CTTTGGGACCATGTCAAGGGAGG - Intronic
1080921782 11:36716353-36716375 CTTTGGTACCTGGTGTAGGTAGG + Intergenic
1081126762 11:39332270-39332292 CTTTGGTATGATGAGGTGGGCGG - Intergenic
1083362449 11:62120359-62120381 CTTTGGTAGGCTGAGGAGGGTGG - Intergenic
1084102744 11:66960520-66960542 CTTTGGGAGGCTGAGTAGGGAGG + Intergenic
1086385072 11:86298801-86298823 CTTTGGGAGGATGAGTTGGGTGG + Intergenic
1086956138 11:92936197-92936219 CTTTGGGAGCCTGAGGAGGGTGG + Intergenic
1088989666 11:114941340-114941362 CATTGTGACCGTGAGTAGGGGGG + Intergenic
1090777434 11:129977709-129977731 CTTTGGGAGCATGAGGAGGGTGG + Intronic
1091276981 11:134359286-134359308 CTTGGGTTCCATGAGTGGGGAGG + Intronic
1093455182 12:19357881-19357903 CTTTGGGACCCTGAGGTGGGTGG - Intronic
1094563343 12:31576637-31576659 CTTTTGTAGGATGAGGAGGGAGG + Intronic
1094580130 12:31727096-31727118 TTTTGGGACCCTGAGGAGGGTGG - Intronic
1094693096 12:32788810-32788832 CTTTGGGAGCCTGAGTGGGGTGG + Intergenic
1095777961 12:46030454-46030476 TTATGGTAACAAGAGTAGGGAGG - Intergenic
1097522543 12:60687692-60687714 CTTTGGAAGGATGAGGAGGGAGG + Intergenic
1097831833 12:64233141-64233163 CTTTGGGAGCCTGAGGAGGGCGG - Intergenic
1099535793 12:83842702-83842724 CTTATGTACCATGATTATGGAGG + Intergenic
1100037022 12:90264322-90264344 AGTTGGGCCCATGAGTAGGGTGG + Intergenic
1100949423 12:99829405-99829427 CTTTGGGAGGCTGAGTAGGGCGG + Intronic
1101078943 12:101161996-101162018 CTTTGGTAACATTATTAGTGGGG - Exonic
1102477679 12:113199460-113199482 CTTGGGCACCATGGGTAGGCCGG + Intronic
1103142496 12:118561233-118561255 CTTTGGGAGCCTGAGTGGGGAGG + Intergenic
1103455062 12:121059077-121059099 CTTTGGGACGCTGAGTGGGGAGG - Intergenic
1103733811 12:123045844-123045866 CTTTGGTACCATGAGTAGGGTGG - Intronic
1105287543 13:19018011-19018033 CTATAGAACCATGAGTAGGTGGG - Intergenic
1108336275 13:49444631-49444653 CTTGGGTGCCAGGAGAAGGGAGG - Exonic
1109470538 13:62799021-62799043 CTTGGGGACCAGGAGCAGGGAGG + Intergenic
1110092458 13:71470568-71470590 CTTTGGGAGGCTGAGTAGGGCGG - Intronic
1113419842 13:110162554-110162576 TTTTGGTAACATGAATAGGTAGG - Intronic
1113487929 13:110668630-110668652 CTGTGGGACCAGGAGTGGGGAGG + Intronic
1114611021 14:24040574-24040596 CTTTGGTACGGCCAGTAGGGAGG - Intergenic
1114651092 14:24284937-24284959 CTTTGGGCCCATGAGTAGAAGGG - Intergenic
1114905624 14:27122446-27122468 TTTTGGTACCAGAAGTGGGGTGG - Intergenic
1114954742 14:27804223-27804245 AATTGGTACCAGGAGTGGGGTGG + Intergenic
1115076899 14:29403500-29403522 CTTTGCTGGTATGAGTAGGGTGG + Intergenic
1115090240 14:29566375-29566397 AATTGGTACCAGGAGTGGGGTGG - Intergenic
1115366463 14:32563057-32563079 TTTTGGTACCATGAGCAAGGTGG - Intronic
1116729306 14:48602260-48602282 CTTTGGGAGGATGAGGAGGGTGG + Intergenic
1118194893 14:63615997-63616019 CTTTGGGAGCCTGAGGAGGGTGG + Intronic
1119746857 14:77051009-77051031 CTTTGGGAGGATGAGGAGGGTGG - Intergenic
1119840996 14:77792946-77792968 CTTTGGGAGGCTGAGTAGGGAGG + Intergenic
1120830150 14:88990812-88990834 TTTTGGTACCAGGATTTGGGGGG + Intergenic
1122143520 14:99675920-99675942 CTGTGGGACCCTGAGGAGGGAGG + Exonic
1125496954 15:40205188-40205210 CTTTGGGACGCTGAGTTGGGTGG - Intronic
1126171363 15:45697873-45697895 CTTTGGGACACTGAGGAGGGCGG + Intergenic
1129428923 15:75483957-75483979 ATTGGGTACCAAGAGCAGGGAGG - Intronic
1130643451 15:85701684-85701706 CTTTGGGAGCCTGAGGAGGGTGG - Intronic
1130864579 15:87921483-87921505 CTCTGAGACCAGGAGTAGGGAGG - Intronic
1131221862 15:90591205-90591227 CTTTGGGAGCATGAGGTGGGAGG - Intronic
1134653426 16:15928498-15928520 CTTTGGGAGGCTGAGTAGGGTGG + Intergenic
1135258712 16:20962900-20962922 CTTTGGGAGAATGAGTTGGGAGG - Intronic
1139636611 16:68261935-68261957 GTGGGGTGCCATGAGTAGGGGGG - Intergenic
1140875909 16:79152426-79152448 CTTTGGGACGATGAGGCGGGCGG + Intronic
1141143431 16:81512978-81513000 CTTTGGGACGCTGAGGAGGGCGG - Intronic
1142779985 17:2174153-2174175 CTTTGGGAACATGAGAAGGGAGG + Intronic
1147000095 17:37355923-37355945 CTTTGGGAAGATGAGGAGGGCGG + Intronic
1147279345 17:39345782-39345804 CTTTGGGACACTGAGTTGGGAGG - Intronic
1148095479 17:45050285-45050307 CTTTGGTAGGTTGAGGAGGGTGG - Intronic
1148596755 17:48862528-48862550 ATTTGGTAGCATAAGTAGGGAGG + Intronic
1149329034 17:55562511-55562533 CTTTGGGACGCTGAGGAGGGCGG + Intergenic
1150455067 17:65300677-65300699 CTTTGGGAGGCTGAGTAGGGTGG + Intergenic
1150815826 17:68391146-68391168 CCTTGGTAGCCTTAGTAGGGTGG + Intronic
1151466013 17:74285770-74285792 CTTTGACTCCATGAGGAGGGAGG + Intronic
1154532878 18:15365289-15365311 CTTTGGTAGGCTGAGGAGGGTGG + Intergenic
1155355363 18:24947187-24947209 ATGTGGTACCATGAGAAGAGAGG + Intergenic
1156323738 18:36053713-36053735 CTATGTTAACATGAGTAAGGAGG + Intronic
1156705398 18:39875487-39875509 CTTTGGGAGGATGAGGAGGGTGG + Intergenic
1157687897 18:49657467-49657489 CTTTGGGACAGTGAGGAGGGAGG + Intergenic
1158178797 18:54688383-54688405 CTTTGGGAGGATGAGGAGGGCGG + Intergenic
1159407198 18:68019513-68019535 CTTTGGAACCATGTGCCGGGTGG - Intergenic
1160964320 19:1739398-1739420 CTTTGGTAGGATGAGGCGGGCGG + Intergenic
1161213377 19:3079975-3079997 CTTTGGTAGGCTGAGTGGGGAGG + Intergenic
1162071607 19:8155708-8155730 CTTTGGGAGGATGAGTTGGGAGG - Intronic
1162081691 19:8221767-8221789 CTTTGGTAGGCTGAGGAGGGCGG - Intronic
1162135648 19:8553627-8553649 CTTTGGGAGCCTGAGGAGGGCGG + Intronic
1162399840 19:10438847-10438869 CTTTGGTAGGATGAGGTGGGCGG - Intronic
1163075172 19:14884346-14884368 CTTTGGGAGGCTGAGTAGGGAGG + Intergenic
1164096635 19:22016068-22016090 CTTTGGTAGGATGAGGTGGGTGG - Intergenic
1164199833 19:23008193-23008215 CTTTGGTAGGATGAGGTGGGTGG - Intergenic
1165698397 19:37918624-37918646 CTTTGGGAGGATGAGGAGGGCGG + Intronic
1166916252 19:46197773-46197795 CTTTGGGAGGATGAGGAGGGAGG - Intergenic
1167003270 19:46758280-46758302 CTTGGGGACCATGACTAGAGAGG - Exonic
1167270519 19:48503289-48503311 CTTTGGGAGCCTGAGGAGGGTGG - Intronic
1167751187 19:51381065-51381087 CTTTGGGAGGCTGAGTAGGGTGG + Intronic
1167935318 19:52901594-52901616 CTTTGATACTAGGAGTAAGGTGG + Intergenic
925422313 2:3722965-3722987 TTTTGTTACCATGAGTATGCAGG + Intronic
926958746 2:18331635-18331657 CTTTGGTACCCTGAGGTGGGAGG - Intronic
929599446 2:43195958-43195980 CTTTGGAAGCCTGAGGAGGGTGG - Intergenic
931698435 2:64889577-64889599 CTCTGGTACCGGGAGTAAGGTGG + Intergenic
931837463 2:66113923-66113945 CTTTGGGACACTGAGTTGGGAGG - Intergenic
932018455 2:68057866-68057888 CTTTTGTACCATGAGAATAGAGG - Intronic
932150135 2:69363345-69363367 CTTTGGGAGCCTGAGTTGGGAGG - Intronic
933350178 2:81144534-81144556 CAGTGGTTCCATGAGTAGGCAGG + Intergenic
934482574 2:94665057-94665079 AATTGGTACCAGGAGTGGGGTGG - Intergenic
935689479 2:105717669-105717691 CTTTGGGAGCCTGAGTTGGGAGG + Intergenic
936459758 2:112704692-112704714 CTTTGGGACGCTGAGGAGGGCGG - Intergenic
940617667 2:156070363-156070385 CTTTGGGATCCTGGGTAGGGAGG + Intergenic
940932100 2:159445182-159445204 CATTGGTTCCAGGAGTAGGGTGG - Intronic
942006072 2:171700872-171700894 CTTTGGGAGGCTGAGTAGGGTGG - Intronic
942056226 2:172185416-172185438 CTTTGCTATTATGAGTAGGGCGG + Intergenic
942381364 2:175394625-175394647 ATTTGGAACCATTAGTAGAGAGG + Intergenic
942593149 2:177567570-177567592 CTTTGGTAACAGTAGCAGGGAGG - Intergenic
944229239 2:197376555-197376577 CTTTGGGAGCCTGAGGAGGGAGG + Intergenic
944426545 2:199589198-199589220 CTTTGGTACCAGAATTAGTGAGG - Intergenic
944737202 2:202577804-202577826 CTTTGGGAACCTGAGTAGGGAGG - Intergenic
945862822 2:215143203-215143225 CTTTGGGAAGCTGAGTAGGGTGG - Intergenic
946711865 2:222515160-222515182 CTTTGATACCAAGAGTAGAGTGG - Intronic
947221320 2:227795229-227795251 CTTTGGAAGCCTGAGGAGGGTGG - Intergenic
947639597 2:231699540-231699562 CTTTGGGAGCCTGAGGAGGGTGG - Intergenic
947781867 2:232774036-232774058 CTTTGGGACGTTGAGTCGGGAGG + Intronic
1168941777 20:1718879-1718901 CTTCGGCACCATGAGTGGGTGGG + Intergenic
1169008453 20:2229476-2229498 CTTTGGGACCCTGAGATGGGTGG + Intergenic
1169281936 20:4275447-4275469 CTTTGGGACCCTGAGGTGGGAGG - Intergenic
1169442071 20:5640944-5640966 CTTTGGCAGCCTGAGGAGGGTGG - Intergenic
1169793288 20:9434617-9434639 CTTTGGGAACACGAGAAGGGTGG - Intronic
1170400941 20:15982660-15982682 CTCTGATACCAGGAGTAAGGTGG + Intronic
1171429841 20:25075988-25076010 CTTTTGTAGCTTGAGCAGGGAGG - Exonic
1171434938 20:25114685-25114707 CTTTGGGAGCCTGAGGAGGGTGG - Intergenic
1172944738 20:38678358-38678380 CTGTTGTACCATCAGTTGGGAGG - Intergenic
1174096232 20:48091776-48091798 CTTTGGGAGCCTGAGGAGGGAGG + Intergenic
1174301691 20:49586829-49586851 CTTTGGGAGCCTGAGGAGGGCGG + Intergenic
1174350035 20:49960595-49960617 CTTTGGGAGCCTGAGGAGGGCGG - Intergenic
1174990987 20:55509509-55509531 CATTGGGAACATCAGTAGGGTGG + Intergenic
1177130707 21:17251098-17251120 TTTTGGCAACATGAGTAGGAAGG - Intergenic
1179827772 21:43977398-43977420 CCCTGGTCCCATGAGAAGGGTGG - Intronic
1180511774 22:16098358-16098380 CTTTGGTAGGATGAGTTGGGTGG - Intergenic
1180725456 22:17943579-17943601 CTTGGGCACCTTGAGTAAGGAGG - Intronic
1182116822 22:27761536-27761558 CTTTGGTAACATCAGTGGTGAGG - Intronic
1183994625 22:41623628-41623650 CTTTGGGATGCTGAGTAGGGCGG - Intronic
1184448474 22:44568390-44568412 CTTTGGGAGCCTGAGGAGGGCGG + Intergenic
1184478369 22:44733779-44733801 CTGTGTTACAATGAGTAGGTGGG - Intronic
949158069 3:850794-850816 CTCTGATACCAGGAGTAAGGTGG - Intergenic
949373472 3:3361262-3361284 CTTTGTTACCTTGATTAGTGTGG - Intergenic
950416206 3:12870206-12870228 CTTTGGTTCCATGGGGAAGGTGG - Intronic
950516629 3:13470700-13470722 CTTTGGGAGCCTGAGGAGGGTGG - Intergenic
951871448 3:27367051-27367073 CTTTGGGACGATGAGGTGGGTGG - Intronic
952480339 3:33754585-33754607 AATTGGTACCAGGAGTGGGGTGG - Intergenic
952730421 3:36632300-36632322 CTTTGGTAGGCTGAGGAGGGTGG - Intergenic
954623428 3:52008718-52008740 CTTTGGGAGCCTGAGTTGGGTGG + Intergenic
956824575 3:72985768-72985790 AATTGGTACCAGGAGTGGGGTGG - Intronic
956996170 3:74828585-74828607 CTCTGATACCAGGAGTAAGGTGG - Intergenic
959064800 3:101645384-101645406 CTTTGGGACCCTGAGATGGGCGG - Intergenic
961171656 3:124801723-124801745 CTTTGGTGGCAGGAGTTGGGAGG - Intronic
964932838 3:162047287-162047309 CTCTGATACCAGGAGTAAGGTGG + Intergenic
965179106 3:165378416-165378438 CTTTGGGAGGCTGAGTAGGGAGG + Intergenic
966567195 3:181396543-181396565 CTCTGGTTCCATGAGTGGGCAGG + Intergenic
970072974 4:12183407-12183429 CTTTGGGATGCTGAGTAGGGGGG + Intergenic
970565679 4:17330353-17330375 CTTTGGGAGCCTGAGGAGGGTGG + Intergenic
972275085 4:37549670-37549692 CTCTGATACCAGGAGTAAGGTGG - Intronic
972423945 4:38915316-38915338 CTTTTGCACCATGAGGTGGGGGG - Intronic
972583626 4:40416995-40417017 CTTTGGTAGGATGAGATGGGAGG + Intergenic
972925904 4:44006884-44006906 CTTTGGGAGCTTGAGGAGGGAGG + Intergenic
974988121 4:69054545-69054567 CTCTGATACCAGGAGTAAGGTGG - Intronic
976710956 4:88071291-88071313 CTTTGGGAGCCTGAGCAGGGAGG - Intronic
978802974 4:112772728-112772750 CTTTGGTACCCTCAGCAGGATGG + Intergenic
980044154 4:127970124-127970146 CTTTGGGACGCTGAGGAGGGAGG - Intronic
980066827 4:128198579-128198601 CTTTTGTACCATCAGTAGAAAGG + Intronic
980849566 4:138364672-138364694 CTTGGGTTCCTTGAGAAGGGGGG + Intergenic
981546320 4:145897909-145897931 CTTTGGGGGCCTGAGTAGGGTGG + Intronic
983762387 4:171427168-171427190 ATTTGGTAACATGAGAAAGGTGG + Intergenic
984334205 4:178366971-178366993 CTTTGATTCCATGAATTGGGTGG - Intergenic
986676474 5:10189899-10189921 CTTTGGTATGATGAGTATTGTGG - Intergenic
988396206 5:30700251-30700273 ATTTGGTACCAAGAGTAGTGAGG + Intergenic
988467151 5:31501813-31501835 CTTTGGTATTATGAGTGGGTGGG - Intronic
988580584 5:32465442-32465464 CTATAGTACAATGAGTAGAGAGG - Intergenic
989037859 5:37194163-37194185 CTTTGGGAGGATGAGTTGGGCGG - Intronic
989360158 5:40592923-40592945 CTTTGGGAGGCTGAGTAGGGAGG + Intergenic
990674472 5:58168085-58168107 CTTTGGGAGCATGAGGCGGGCGG - Intergenic
992039231 5:72812940-72812962 CTTTGCTGACATGAGTAGGATGG + Intergenic
993451171 5:88073574-88073596 AATTGGTACCAGGAGTAGTGGGG + Intergenic
997956222 5:138280578-138280600 CTTTGGGAGCCTGAGGAGGGTGG - Intergenic
998193497 5:140046240-140046262 CTTTGGTAGGCTGAGTGGGGTGG + Intergenic
998325977 5:141280180-141280202 CTTTGGGAGCATGAGGTGGGAGG + Intergenic
998471665 5:142388564-142388586 CTTTGGGAGGATGAGGAGGGTGG - Intergenic
1003894378 6:10592982-10593004 CTTTGGGACCCTGAGGTGGGTGG - Intronic
1004698246 6:18054229-18054251 CTTTGGGAGCATGAGGTGGGAGG + Intergenic
1006032006 6:31183208-31183230 CTCTGTTACCAGGAGTAAGGTGG + Intergenic
1006318820 6:33307042-33307064 CTTTGGTAGCCTGAGGCGGGTGG + Intronic
1012149162 6:95723951-95723973 CTTTGGGATCCTGAGGAGGGTGG - Intergenic
1012967949 6:105695791-105695813 TTTTGGTACCACAAGTAGGGTGG - Intergenic
1013559130 6:111286942-111286964 CTCTGATACCAGGAGTAAGGTGG + Intergenic
1014769903 6:125448883-125448905 CTCTGGTTCCATGAGTTTGGAGG + Intergenic
1015872067 6:137786778-137786800 CTTTGGGAGCCTGAGTTGGGTGG + Intergenic
1016456739 6:144238628-144238650 CTTTGGGACAATGAGGAGGGAGG - Intergenic
1017311391 6:152982176-152982198 GTTTGGTCCAATGAGTTGGGGGG + Intronic
1017499745 6:155012792-155012814 CTTTGGGAGCCCGAGTAGGGCGG - Intronic
1018155090 6:160978103-160978125 CTTTGGCATCATGAGTTTGGGGG + Intergenic
1018895739 6:168015693-168015715 ATTTAGTATCATGAGTGGGGAGG + Intronic
1022736937 7:33084865-33084887 CTTTGGGACGCTGAGTTGGGAGG + Intergenic
1025186796 7:56866855-56866877 CTTTGGGACGATGAGGCGGGTGG - Intergenic
1025685127 7:63710060-63710082 CTTTGGGACGATGAGGCGGGTGG + Intergenic
1025957129 7:66191726-66191748 CTTTGGGAGCCTGAGGAGGGTGG - Intergenic
1026682534 7:72478131-72478153 CTTTGGGAGGCTGAGTAGGGAGG + Intergenic
1026798941 7:73385416-73385438 CTTTGGAAGACTGAGTAGGGAGG - Intergenic
1027753589 7:82182792-82182814 CTTTGGGAGGATGAGGAGGGCGG + Intronic
1032979403 7:137264642-137264664 CTCTGATACCAGGAGTAAGGTGG + Intronic
1034433342 7:151051646-151051668 CTTTGGGAGGATGAGGAGGGAGG - Intronic
1034501595 7:151454330-151454352 CTTTGGGAGCCTGAGGAGGGCGG - Intergenic
1036770834 8:11577450-11577472 CTATGGTACCATGACGGGGGTGG + Intergenic
1037112435 8:15180128-15180150 CCTTGTTATCATGACTAGGGTGG - Intronic
1037310573 8:17551353-17551375 CTTTGGGACATTGAGGAGGGTGG + Intronic
1038448547 8:27622450-27622472 CTTTGGGAGCCTGAGGAGGGAGG - Intergenic
1039792539 8:40887243-40887265 CTTTGGGAGCCTGAGGAGGGTGG + Intronic
1040852501 8:51915469-51915491 CTTTGGGAGGCTGAGTAGGGAGG - Intergenic
1041056591 8:53992367-53992389 CTTTGGGACACTGAGGAGGGCGG + Intronic
1041756980 8:61324511-61324533 AATTGGTACCAGGAGTGGGGTGG + Intronic
1043289572 8:78580460-78580482 CTTTGTCACCATGGGCAGGGTGG + Intronic
1045286745 8:100798182-100798204 CTTTGGAAGGATGAGGAGGGTGG - Intergenic
1045629395 8:104100062-104100084 CTTTGGGAGGCTGAGTAGGGAGG - Intronic
1046933742 8:119866984-119867006 CTTTGGGAGCCTGAGGAGGGTGG - Intergenic
1047101447 8:121680646-121680668 CTTTGGGAGCCTGAGTTGGGCGG + Intergenic
1047171862 8:122501436-122501458 TAGTGGTAGCATGAGTAGGGTGG + Intergenic
1047918171 8:129604730-129604752 AGTTGGTACCAGGAGTAGAGGGG - Intergenic
1048555885 8:135475553-135475575 CTTTGGGAGCCTGAGGAGGGTGG - Intronic
1049127541 8:140805315-140805337 CTTTGGTAGGATGAGGCGGGTGG + Intronic
1050574947 9:6985096-6985118 CTATGGTGCCATGAGTGAGGAGG - Intronic
1051290542 9:15541189-15541211 CTTTGGGAAGCTGAGTAGGGGGG - Intergenic
1053156106 9:35780625-35780647 CTTTGGGAGGATGAGGAGGGTGG + Intergenic
1053675267 9:40419684-40419706 AATTGGTACCAGGAGTGGGGTGG + Intergenic
1053925052 9:43046019-43046041 AATTGGTACCAGGAGTGGGGTGG + Intergenic
1054288540 9:63258210-63258232 AATTGGTACCAGGAGTGGGGTGG + Intergenic
1054386367 9:64559747-64559769 AATTGGTACCAGGAGTGGGGTGG + Intergenic
1054509353 9:65956608-65956630 AATTGGTACCAGGAGTGGGGTGG - Intergenic
1056299462 9:85226721-85226743 CTTTGGAAGCCTGAGGAGGGTGG - Intergenic
1056394411 9:86168443-86168465 TTTTGAGACCATGAATAGGGAGG + Intergenic
1056481335 9:87009564-87009586 CTTTGGGAGCCTGAGTGGGGAGG - Intergenic
1058289061 9:103214495-103214517 CTTTGGTATCCTGAGGAGGGTGG - Intergenic
1059296176 9:113272933-113272955 CTTTGGGAAAATGAGGAGGGAGG - Intronic
1059407755 9:114112437-114112459 GTTTGGTCCCAAGAGAAGGGTGG - Intergenic
1061999016 9:134206763-134206785 GTTTGGGACCATGAGGAGTGAGG + Intergenic
1062265328 9:135684238-135684260 CTTTGGTGCCAGGACAAGGGAGG - Intergenic
1203486560 Un_GL000224v1:61235-61257 CTTTGGAAGCTTGAGTTGGGTGG - Intergenic
1203499181 Un_KI270741v1:3134-3156 CTTTGGAAGCTTGAGTTGGGTGG - Intergenic
1186449481 X:9660170-9660192 CTTTGATACCATGGGTATGTGGG - Intronic
1186558554 X:10586512-10586534 CTCTGATACCAGGAGTAAGGTGG + Intronic
1188816103 X:34716121-34716143 CTTTGGGAGGATGAGGAGGGAGG - Intergenic
1189092685 X:38103658-38103680 CATTTGTAACATGAGTAGGTTGG + Intronic
1189253304 X:39618144-39618166 CTTTGGTATCTTGATTTGGGTGG + Intergenic
1189396468 X:40627432-40627454 CTTTGGGAGGCTGAGTAGGGCGG - Intronic
1189760520 X:44317155-44317177 ATTGGGTAGAATGAGTAGGGAGG + Intronic
1189963818 X:46351532-46351554 CTTTGGTACTGAGAGTGGGGTGG - Intergenic
1190130705 X:47746223-47746245 CTTTGGGACGCTGAGGAGGGCGG + Intergenic
1190812913 X:53901907-53901929 CTTTGGGAAGCTGAGTAGGGCGG - Intergenic
1191669617 X:63737086-63737108 GTTTGGGACCCTGAGCAGGGAGG - Intronic
1192574963 X:72236208-72236230 CTTTGGCAGCCTGAGTTGGGAGG + Intronic
1194690108 X:96973936-96973958 CTTTGGGAGGATGAGGAGGGCGG - Intronic
1196508180 X:116474142-116474164 CTTTGGTAGGCTGAGAAGGGCGG + Intergenic
1197817653 X:130514713-130514735 CCTTGGTACCAAGAATAGGGAGG - Intergenic
1198188203 X:134276205-134276227 TTTTGGTATCATGATTATGGTGG + Intergenic
1198274554 X:135088699-135088721 AATTGGTACCAGGAGTAGTGAGG + Intergenic
1198322119 X:135528415-135528437 CTTTGGTTCCATGAGGGGTGGGG + Intronic
1199128374 X:144153600-144153622 CTTTGGTACCATGGTGAGGCTGG + Intergenic