ID: 1103733873

View in Genome Browser
Species Human (GRCh38)
Location 12:123046180-123046202
Sequence CCTTCAGGAAAGGCAGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 300}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103733873_1103733885 19 Left 1103733873 12:123046180-123046202 CCCAGTCCTGCCTTTCCTGAAGG 0: 1
1: 0
2: 2
3: 33
4: 300
Right 1103733885 12:123046222-123046244 CCCCTCCTGAAAATGGTGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 146
1103733873_1103733887 20 Left 1103733873 12:123046180-123046202 CCCAGTCCTGCCTTTCCTGAAGG 0: 1
1: 0
2: 2
3: 33
4: 300
Right 1103733887 12:123046223-123046245 CCCTCCTGAAAATGGTGCCAGGG 0: 1
1: 0
2: 0
3: 19
4: 188
1103733873_1103733879 -5 Left 1103733873 12:123046180-123046202 CCCAGTCCTGCCTTTCCTGAAGG 0: 1
1: 0
2: 2
3: 33
4: 300
Right 1103733879 12:123046198-123046220 GAAGGTATTCCCAGTGTGAATGG 0: 1
1: 0
2: 0
3: 13
4: 144
1103733873_1103733882 12 Left 1103733873 12:123046180-123046202 CCCAGTCCTGCCTTTCCTGAAGG 0: 1
1: 0
2: 2
3: 33
4: 300
Right 1103733882 12:123046215-123046237 GAATGGCCCCCTCCTGAAAATGG 0: 1
1: 0
2: 0
3: 12
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103733873 Original CRISPR CCTTCAGGAAAGGCAGGACT GGG (reversed) Intronic
900343135 1:2198006-2198028 ACTTGAGGACAGGCAGGACAAGG - Intronic
900431079 1:2603482-2603504 CCCTCAGGGCAGGCAGGACTGGG + Intronic
900603192 1:3511921-3511943 CCTTCAGCCAAAGCAGGCCTCGG + Intronic
901078640 1:6571248-6571270 CCTTCAGGCAAGTCTGGGCTGGG + Intronic
901098230 1:6700037-6700059 TCTTCAGTTAAGGCAGGACCTGG - Intronic
901643528 1:10704926-10704948 GCCTGAGGAAAGGCAGGACATGG + Intronic
902076875 1:13794068-13794090 CCTTCAGGAAATTCTGAACTTGG - Intronic
902083211 1:13835589-13835611 CTTTCAGTAGGGGCAGGACTGGG - Intergenic
902845697 1:19109045-19109067 CCTTCAGAAAAGGCAGCACGGGG - Intronic
903241323 1:21984440-21984462 CCTCCAGGCCAGGCAGGACTTGG + Intronic
903244829 1:22007624-22007646 CCTCCAGGCCAGGCAGGACTTGG + Intronic
903447249 1:23430584-23430606 CCTGCAGAAGAGGCAGGATTAGG - Intronic
904895304 1:33812873-33812895 ACTTCAGGAAAGGCAGAAAAAGG - Intronic
905168740 1:36098231-36098253 CCTTCAGGCCCGGCAGGCCTTGG + Exonic
905323108 1:37131649-37131671 CCTTCACCTAGGGCAGGACTGGG - Intergenic
905533068 1:38697365-38697387 CCTTAAGGAAAGCCAGAATTGGG - Intergenic
905582239 1:39090995-39091017 CCTACAGGAAAGCCAAGACAGGG - Intronic
906970179 1:50505122-50505144 CTTTCAGGAAAGACATGAATGGG + Intronic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
910762160 1:90744468-90744490 CCTTCAGGCAAGGAAGGTCTAGG - Intergenic
912261083 1:108112037-108112059 ACTTCAGGGGAGGCAGGTCTGGG - Intergenic
912723237 1:112037538-112037560 CCTTCAGCAGAAGTAGGACTTGG - Intergenic
912991464 1:114491397-114491419 CCTAGAGGAAATGCAGGATTAGG + Intronic
913013368 1:114708016-114708038 CCTCCAGGGAAGTCAGGACCAGG + Exonic
913059675 1:115193610-115193632 CCTGCAGGAATGGCAGCAGTGGG - Intergenic
914802155 1:150969712-150969734 CCTGCAAGACAGGCAGGACCTGG + Intronic
915905024 1:159871304-159871326 CCATCAGGGAAGGCAAGACTGGG + Intronic
920136595 1:203774318-203774340 CATCCAGGAAAGGCAGCTCTGGG + Exonic
920178928 1:204120641-204120663 CCTGCAGGATGGGCAGGATTTGG - Intronic
920837928 1:209528975-209528997 CCTTCAGGAAAGAAATTACTAGG + Intergenic
923077187 1:230620449-230620471 GGTGCAGGACAGGCAGGACTAGG - Intergenic
1064636810 10:17377068-17377090 TCATCAGTAAAGGCAGGAATTGG - Intronic
1064668379 10:17681800-17681822 ACTTCAGTAAATGGAGGACTTGG + Intronic
1066680873 10:37936245-37936267 CTGACAGAAAAGGCAGGACTGGG - Intergenic
1067037705 10:42932250-42932272 CCTTGAAGTAAGGCAGGACAAGG + Intergenic
1067833248 10:49622139-49622161 CCTGCTGGACAGGTAGGACTGGG + Exonic
1069454687 10:68544865-68544887 CCTTCAGGAGATGCAGGCCTGGG - Intergenic
1069943413 10:71970394-71970416 CATTCAGGAGAGGCTGAACTGGG - Intronic
1070816557 10:79328204-79328226 CCCTGGGGAAAGGCAGGAGTGGG + Intergenic
1072777214 10:98210715-98210737 CCTTTAGGAAAGGCAGAATCAGG + Intronic
1073255487 10:102148280-102148302 CCTAAAAGAAAGGCAGGACTGGG + Intronic
1074569539 10:114611975-114611997 GTGTCAGGAAAGGCAGGACTGGG - Intronic
1075644114 10:124086461-124086483 CCATGGGGAAAGGCAGGGCTGGG - Intronic
1075708631 10:124518383-124518405 TTTGCAGGAAAGGCAGGATTGGG - Intronic
1076353809 10:129838162-129838184 GCTGCAGGAGGGGCAGGACTGGG - Intronic
1078060329 11:8039121-8039143 CCATCAGGAAGGGGAGGCCTTGG - Intronic
1079188225 11:18256076-18256098 CATTAAGGAAAGTCAGGATTTGG + Intergenic
1079416892 11:20246008-20246030 CCTTGAAGAAGGGCAGGACTTGG - Intergenic
1079453112 11:20614540-20614562 CCTTCAGGAAAGGATTAACTGGG - Intronic
1079828750 11:25234219-25234241 CCATCAGGACGGGGAGGACTTGG + Intergenic
1081661985 11:44894019-44894041 CCTTGAGGAAGGGCAGCCCTTGG + Intronic
1082027140 11:47580885-47580907 CCCTGAGGAAAGTCAGCACTGGG - Exonic
1084166764 11:67378707-67378729 ACTTCAGCAACAGCAGGACTTGG + Intronic
1085525553 11:77161556-77161578 CCTGCTGGAAAGTCAGGACCTGG + Intronic
1085745806 11:79113223-79113245 CATTCAGGAAAGGGAGGAGGAGG + Intronic
1087012297 11:93525560-93525582 CCTGCAGGAGAGCCAGGAGTGGG - Intronic
1089052912 11:115561558-115561580 CCTTCAGGAAAAGGAGGGATGGG - Intergenic
1089121805 11:116141470-116141492 CCTTCAGGAGGGGCAGAGCTGGG - Intergenic
1089157164 11:116411145-116411167 GTGTCAGGAAAGGGAGGACTTGG + Intergenic
1089256705 11:117198046-117198068 CCTGCAGGAAAAGCAGGAAGAGG - Intergenic
1089678318 11:120105416-120105438 CCTGATGGAAAAGCAGGACTTGG - Intergenic
1090093769 11:123724203-123724225 CCTTGAGGAAAGGAAGGGTTGGG - Exonic
1090154745 11:124425466-124425488 CCATCAGGAAAGACAGGATTCGG + Intergenic
1090263830 11:125341868-125341890 GCTTCAGGAAAGCCAGCCCTGGG - Intronic
1090884258 11:130862075-130862097 CCATCAAGAAAGGCAAGGCTGGG - Intergenic
1091698915 12:2647226-2647248 CTTTCTAGAAAGTCAGGACTTGG - Intronic
1092385830 12:8034844-8034866 TCTTCAGAAAAGGCAGGAAAAGG + Intronic
1094243572 12:28259421-28259443 CCTGCAGGAAAGGCAGCCCAAGG - Exonic
1095203335 12:39411032-39411054 CCTTGAAGAGAGGCAGGAATTGG - Intronic
1095975453 12:47938101-47938123 CCTCCAGGAAGGCCAGGACCTGG - Intronic
1096526487 12:52213116-52213138 CCGTCAGGAAAGACAGGCCAGGG - Intergenic
1096812196 12:54178257-54178279 CCTTAGGGAAAGGCAGGCCCAGG + Intronic
1096867808 12:54575646-54575668 CCTGCAGGAAGGGGAGGACTGGG + Intronic
1099932058 12:89086268-89086290 GCTTGAGGAAAGGAAGGATTTGG + Intergenic
1102505360 12:113381152-113381174 TTGTCAGGAAAGGCTGGACTTGG + Intronic
1103733873 12:123046180-123046202 CCTTCAGGAAAGGCAGGACTGGG - Intronic
1103743323 12:123105974-123105996 TCTTCAGGACAGGCAGGGCCAGG - Intronic
1103975711 12:124701301-124701323 CCTTCAGGAAAGAGAGGGCCAGG - Intergenic
1104118444 12:125773322-125773344 CCTTCAGAAAAGGAAGGGCAGGG + Intergenic
1104406059 12:128517756-128517778 CCTTCACCAAAGACAGGACATGG - Intronic
1104669828 12:130673103-130673125 CCTTCAGGAAGGGCGGGAGCAGG - Intronic
1104870795 12:131994098-131994120 CAGTCAGGAAAGGCAGCACCTGG + Intronic
1106224986 13:27778492-27778514 CCTTCAGGAAGGGCAGAGCTTGG - Intergenic
1107604749 13:42047093-42047115 CCTTTAGGAAAGGAAGGAGTTGG - Intronic
1109726375 13:66346649-66346671 ACTTCTGGAAATGCAGAACTGGG + Intronic
1110702513 13:78565724-78565746 CTATCCGGAAAGACAGGACTAGG + Intergenic
1111512704 13:89287442-89287464 CCTTCAGGAGAGGCCTTACTGGG + Intergenic
1112527463 13:100165311-100165333 CATTAAGGAAAGGCATGATTTGG - Intronic
1112952230 13:105013720-105013742 CCTTCAGGAATGACATGACACGG + Intergenic
1114186093 14:20403663-20403685 TCTCCAGGAAGGGCAGGACAAGG - Intronic
1114192609 14:20451709-20451731 ACTTCAGGAAAGGAATGAATGGG - Intronic
1114281040 14:21192576-21192598 CCTTCAGGCCAAGGAGGACTGGG + Intergenic
1114557239 14:23569005-23569027 CCTTCAGGGAAGGATGGAATTGG + Exonic
1114668599 14:24397101-24397123 CCTCCAGGAGAGGCAGGAGCTGG + Intergenic
1114683591 14:24507225-24507247 CTTTCAGGAGAGGGAAGACTTGG - Intronic
1115499488 14:34036596-34036618 CATTCTGGAAAAGCAGGCCTAGG - Intronic
1118174156 14:63421296-63421318 CCTTCAGAGAAGGCAGCACAAGG + Intronic
1119211647 14:72836443-72836465 CCTTCAGGGCAGGCAGGAGCAGG - Intronic
1122540837 14:102496939-102496961 CTTTCAGGGAAGGCAGGAGTTGG - Intronic
1123704831 15:22943753-22943775 CCTTCAGCAAAGGGAGGAGATGG - Intronic
1124137652 15:27048917-27048939 CCTGAAGGAAAGTCAGGACCTGG - Intronic
1124693601 15:31845619-31845641 CCCTCAGGAAGGGCTGGCCTGGG + Intronic
1125527577 15:40387504-40387526 CCTTCAGGAGAGGAAGGGCTGGG + Intronic
1125550026 15:40538207-40538229 CCTTCAGGAAAGACATGAAGGGG - Intronic
1125609355 15:40960316-40960338 CCTGGAGGAAAGGCAGGAGCTGG + Intergenic
1128806240 15:70533127-70533149 CCTTCAGGAAGGGTGGGACCTGG - Intergenic
1130617860 15:85429538-85429560 CCTTCAGGAAATTTAGGATTCGG + Intronic
1131651814 15:94408446-94408468 CCTTCATGAAAAGGAAGACTAGG - Intronic
1131751328 15:95511023-95511045 TCTGCAGGAAAGGCAGGGCATGG - Intergenic
1132543988 16:524736-524758 CCTTCAGCAGAGGCAGGATGGGG - Intergenic
1133447456 16:5874285-5874307 CTTGAAGGAAAGGCAGGAGTTGG + Intergenic
1135878187 16:26225459-26225481 CCTTCAGGAGAGGATGGACTAGG - Intergenic
1135928250 16:26714206-26714228 TCTGCAGGAAAGACAGGATTTGG - Intergenic
1137006125 16:35275631-35275653 CTGACAGAAAAGGCAGGACTGGG + Intergenic
1138415967 16:56871469-56871491 CCTACAGGCAGGGCAGGACCTGG + Intronic
1138433434 16:56983793-56983815 CCTTTAGGATAGGGAGGAGTTGG - Exonic
1138499860 16:57434028-57434050 CCTTCAGGTAAGGCTGGCCTAGG - Exonic
1138575846 16:57906874-57906896 GCTTCAGGATGGGCAGAACTGGG + Intronic
1139105021 16:63818081-63818103 TCTTCAGGAAAGACAGGGCAGGG + Intergenic
1139870714 16:70106965-70106987 CATTAAGGAAATGCAGGGCTGGG + Intergenic
1140054648 16:71515427-71515449 ACTTCAGAAGAGGCAGGATTCGG + Intronic
1140384734 16:74525589-74525611 CATTAAGGAAATGCAGGGCTGGG - Intronic
1141009338 16:80382720-80382742 CCTTCAGATTAGGAAGGACTAGG + Intergenic
1141082115 16:81061703-81061725 CCTTCAGGGGAGGCAGAACTAGG + Exonic
1141192002 16:81831758-81831780 CTTTCAGACAAGGCAGGATTGGG - Intronic
1141698637 16:85632432-85632454 CTATCAGGAGAGGGAGGACTTGG + Intronic
1141987207 16:87587789-87587811 CCTTCTGGAAGGGCAGGGCCAGG + Intergenic
1142562062 17:816048-816070 CCATCAGGAGGGGCAGGACACGG + Intronic
1142599591 17:1047148-1047170 CCTGTAGGAAAGGCAGGAGGAGG - Intronic
1142690860 17:1605528-1605550 CCTGCAGGCCAGGGAGGACTCGG - Intronic
1142782871 17:2194974-2194996 TGTTCTGGAAAGACAGGACTTGG - Intronic
1144451293 17:15381556-15381578 CCCTCAAGAAAGGCAGGGCAGGG - Intergenic
1147308362 17:39578989-39579011 CCTCCTGGAAAAGCAGGTCTGGG + Intergenic
1147403162 17:40192921-40192943 CGTGCAGGAAAGTCAGGTCTAGG - Exonic
1147617545 17:41838591-41838613 CCTTCTGAAGAGGCATGACTAGG + Intronic
1148105564 17:45116860-45116882 CCTTCAGGACAGGCAGGCAAAGG + Intronic
1148243289 17:46013772-46013794 CTTGCTGGAAAGGCAGGAGTGGG - Intronic
1148760653 17:49998117-49998139 CCTCCACCAGAGGCAGGACTCGG - Intergenic
1148864351 17:50620830-50620852 CTTTCAGGAAGGGGAGGCCTCGG - Intronic
1150223342 17:63509401-63509423 TCTTCAGGAAGGGCAGGACCGGG - Intronic
1151490781 17:74431357-74431379 CCTCCTGGAAAGGACGGACTCGG + Exonic
1152038823 17:77890306-77890328 CCGGCGGGGAAGGCAGGACTTGG + Intergenic
1152660704 17:81540695-81540717 CCGTCAGGGAAGGTAGGACCTGG - Exonic
1152664448 17:81559206-81559228 GCTTCAGGAAGGGCTGGGCTGGG + Exonic
1152812786 17:82390310-82390332 CCCTCTGGAAAGTCAAGACTGGG + Intronic
1156318473 18:35994345-35994367 TCTCCAGGAAAGAAAGGACTAGG + Intronic
1157930727 18:51820309-51820331 CCTCCAGCAAAGGCAGGAGGTGG - Intergenic
1158870425 18:61681823-61681845 ACCTCAGGAAGGGCTGGACTGGG + Intergenic
1160070461 18:75623580-75623602 CTCTCAGGAAAGGCAGGCATGGG + Intergenic
1161070530 19:2257731-2257753 CCTTCAGCAAAGCAAGGGCTGGG + Intronic
1161470115 19:4453031-4453053 CCTCCAAGGCAGGCAGGACTGGG + Intronic
1162019109 19:7860650-7860672 CCTTCGGGAGATGCAGGACAAGG + Exonic
1162461302 19:10815836-10815858 GCCCCAGGATAGGCAGGACTGGG + Intronic
1163008177 19:14409231-14409253 ACTTGAGGAAAAGCAGGGCTGGG + Intronic
1163150078 19:15406276-15406298 CTTTCAGAAAGGGCAGGTCTTGG - Intronic
1164063759 19:21696471-21696493 CTGACAGAAAAGGCAGGACTGGG + Intergenic
1164157078 19:22603444-22603466 CCTTCAGCAAAGCCAGGAGAAGG + Intergenic
1165148527 19:33748010-33748032 CCCTCAGGACAGGCAGGAAGAGG + Intronic
1165253707 19:34559770-34559792 CTGACAGAAAAGGCAGGACTGGG + Intergenic
1165272549 19:34723459-34723481 CTGACAGAAAAGGCAGGACTGGG - Intergenic
1165398702 19:35583645-35583667 GAGCCAGGAAAGGCAGGACTAGG - Intergenic
1166486991 19:43222063-43222085 CCTTCTGGCAGGGCAGGGCTCGG - Intronic
1167143392 19:47667565-47667587 CCTTCAGGCCAGGCAGGAACAGG + Intronic
1168406890 19:56115112-56115134 CCCTCAGGGAGGGCAGGCCTGGG - Intronic
925041669 2:735866-735888 ACTGCAGGAGAGGCAGGAGTGGG + Intergenic
925317705 2:2938421-2938443 CCTTCTGCAAAGGCAAGACGTGG - Intergenic
926383383 2:12313323-12313345 CATACAGGAGAGGCAGGATTTGG + Intergenic
926461999 2:13141362-13141384 TCTGCAGGAAAGGCAAGACAGGG - Intergenic
928409010 2:31039636-31039658 CCTTCATAAATGACAGGACTAGG - Intronic
929156809 2:38795821-38795843 CCTTCGGGAAAGCCAGCTCTTGG - Intergenic
932340730 2:70961269-70961291 GCTTCAGGAACGGGAGGCCTGGG + Intronic
932362334 2:71119071-71119093 TCTTCAGGAAGGGAAGGAATGGG + Intronic
932615171 2:73227009-73227031 CCTCCAGGAAAGGGAGGCATTGG - Exonic
935207935 2:100912818-100912840 CCTTGAATAAAGGCTGGACTTGG - Intronic
935540109 2:104338554-104338576 CCTCAAGGGAAGGCAGCACTGGG + Intergenic
935789769 2:106580438-106580460 CCTTCAGGAGAGGCAGCCCTGGG + Intergenic
935963286 2:108448561-108448583 CCTTCGGGAAAGGGTGGCCTCGG + Exonic
937681606 2:124650407-124650429 CCGTCTGGAAAAGCAGGAATGGG + Intronic
937723046 2:125126162-125126184 CCATCAGGTGAGGCAGGGCTAGG + Intergenic
939230484 2:139418995-139419017 TCCTCAGGAAAAGCATGACTTGG - Intergenic
940987148 2:160061802-160061824 CCTTAAGGAAGGGATGGACTGGG + Intronic
942261179 2:174165549-174165571 TCTCCAGCAAAGGCAGGAATAGG - Intronic
942380068 2:175381588-175381610 CATTCATGAAAGGCAGGAAGTGG - Intergenic
945181072 2:207091765-207091787 CCTACTGGAAAGGCAGGTCAGGG + Intronic
945368347 2:208984621-208984643 GCTCCATGGAAGGCAGGACTAGG + Intergenic
945928379 2:215829372-215829394 ACTTCAGGAAAGGTGTGACTTGG - Intergenic
946439802 2:219685614-219685636 GCATCAGCCAAGGCAGGACTCGG + Intergenic
948109206 2:235440705-235440727 CCATCAGGAAAGACAGGAGCTGG + Intergenic
948922677 2:241073093-241073115 CCTTCAGGGGAGGCAGCTCTGGG + Intronic
949019711 2:241734430-241734452 CCCTCAGGAAACGCAGGACGAGG + Intergenic
1170529361 20:17274701-17274723 AATTCAGGAAAGACATGACTGGG - Intronic
1170578861 20:17682900-17682922 CCTTCAGTAAATGGAGGAATTGG + Intergenic
1171391995 20:24807551-24807573 CGTTCAGCAGCGGCAGGACTGGG - Intergenic
1171482085 20:25461521-25461543 CCTTGAGGAAAGTCAAGACCAGG - Exonic
1173893829 20:46534510-46534532 CCTTCAGGCCAGGCAGGGCCTGG + Intergenic
1175177450 20:57120738-57120760 CCTTCAGGAAGGTCATGAATAGG - Intergenic
1175795736 20:61769597-61769619 CGTTCAGCAGAGGCAGGATTCGG - Intronic
1175924045 20:62463303-62463325 CCAGCAGGCAGGGCAGGACTTGG + Intergenic
1175973835 20:62700378-62700400 CCTCTGGGAAAGGTAGGACTGGG - Intergenic
1179320411 21:40285952-40285974 GCTTCAGGAAATGAAGGACATGG + Intronic
1179442299 21:41403767-41403789 CCTTCAGCAAAGGCAAGAGAGGG + Intronic
1179915039 21:44471519-44471541 TCTTCAGGATTGGGAGGACTTGG - Intergenic
1180594344 22:16963635-16963657 CCTTCAGCACCGGCAGCACTGGG - Intronic
1180898672 22:19355649-19355671 CTCTCAGGAAAAGCAGGGCTAGG + Intronic
1181386052 22:22546641-22546663 GCCTCAGAACAGGCAGGACTGGG + Intergenic
1181484803 22:23223919-23223941 CCTTTGGGAAAGGCAGGAAGAGG - Intronic
1182077676 22:27506002-27506024 GCTTAAGGCAAGGCAGGGCTGGG + Intergenic
1183226295 22:36552284-36552306 CCTTGAGAAAAGGCAGGAAAGGG - Intergenic
1183520520 22:38293964-38293986 CCTTCTGTAGAGCCAGGACTTGG - Intronic
1184803099 22:46774447-46774469 CCTTCATGAACCGCAGCACTCGG - Intronic
1185329523 22:50245912-50245934 CCTCCAGGAGGGCCAGGACTCGG + Exonic
952593663 3:34988605-34988627 CCTTCCGGCAGGGCAGGGCTCGG + Intergenic
953852240 3:46473143-46473165 CCCTCAGGAAAGGGTGCACTTGG - Intronic
954437645 3:50504357-50504379 CCTCCAGGACAGAAAGGACTGGG - Intergenic
954438024 3:50506178-50506200 CCTCCAGGACAGAAAGGACTAGG - Intergenic
954971776 3:54657160-54657182 TCTTCAGTTAAGGCAGGAATAGG + Intronic
956757515 3:72403674-72403696 CCTTCAGGAAAGACAGTCTTGGG + Intronic
956772269 3:72536704-72536726 CCTCCAGGCAAGGCAGGAATGGG + Intergenic
959589899 3:108067463-108067485 CCTGCAGGAACTGGAGGACTAGG + Intronic
960196566 3:114775837-114775859 CACTGAGGAAAGGCAGAACTGGG + Intronic
961142582 3:124567578-124567600 GCCTGTGGAAAGGCAGGACTAGG - Intronic
961376918 3:126473349-126473371 CCTTCAGAAAACTCAGGTCTGGG + Intronic
961561896 3:127736363-127736385 CTTCCAGAAAAGGCAGGAGTTGG + Intronic
963285427 3:143430491-143430513 CATGCAGGAAAGGCGGGACTTGG + Intronic
963997187 3:151723019-151723041 CCTTCATGGAAGCCAGGGCTGGG + Intergenic
966878553 3:184336944-184336966 GCATAAGGCAAGGCAGGACTGGG + Intronic
969474998 4:7417304-7417326 GCTCCAAGAAAGGCAGGACTTGG - Intronic
970504732 4:16716263-16716285 CCTTCAGCAAACCCAGGAGTGGG + Intronic
971455745 4:26842151-26842173 CCATCAGCAAAAGCAGGCCTGGG - Intergenic
973645879 4:52950845-52950867 CCTTCAGGACAGACAGCATTCGG + Intronic
976766237 4:88601222-88601244 CTTTCAGGAAAGGCATGAAAAGG - Intronic
976850517 4:89540202-89540224 GCTTCAGGAAAGGGAGGATGGGG - Intergenic
977616167 4:99089262-99089284 CCTTCAGGAACTGCTGGAATGGG - Intergenic
979699088 4:123647178-123647200 CCTTCAGTAAAGGAAGGTCCTGG + Intergenic
981207527 4:142060985-142061007 CTTTCAGGAAGAGCAGGAGTTGG + Intronic
981793528 4:148568277-148568299 CCTGCTGGAAAAGCAGGCCTTGG - Intergenic
982766567 4:159355912-159355934 CCTTCTGGAAAGTCAGTAATGGG - Exonic
983216889 4:165010386-165010408 CCTTCAGGACAGGAAGGTCAGGG + Intergenic
985652839 5:1114946-1114968 CCCACAGGAAAGGCAGGGCAAGG + Intergenic
985712299 5:1436159-1436181 CCTTCCTGAAGGGCAGGGCTTGG - Intronic
985893799 5:2737623-2737645 CCTACAGGACAGGCAGGAGATGG - Intergenic
987950659 5:24670597-24670619 ACTATAGGAAAGGCAGGAGTAGG + Intergenic
988778784 5:34500441-34500463 CCTTCTGGACAGGCATGATTTGG + Intergenic
989172663 5:38488222-38488244 GGTTCAGGAAATGCAGAACTTGG + Intronic
989400173 5:41000176-41000198 CCTCCAAAAAAGGCAGGACAAGG - Intronic
992213715 5:74505689-74505711 CCTTGAGGAAAGGCTGATCTGGG - Intergenic
994530557 5:100964862-100964884 CCTCCAGGGAAAGCAGGACAGGG - Intergenic
995627724 5:114097578-114097600 CCTTCAATAGCGGCAGGACTGGG - Intergenic
996847784 5:127919896-127919918 CTTTCAGGTAAGGCAAGACCAGG + Intergenic
997136162 5:131328796-131328818 GTTTAAGGAAAGGAAGGACTTGG + Intronic
997593562 5:135091297-135091319 TCTTCAGAAAATGCAAGACTGGG - Intronic
997612377 5:135224275-135224297 CCCTCAGGCAATGCAGAACTTGG + Intronic
997897777 5:137735407-137735429 GCTTCCGCAAAGGCAGGTCTGGG - Intronic
998430777 5:142068136-142068158 CCTGCAGGAAGGGCAGGTCTGGG - Intergenic
999115316 5:149157801-149157823 CCTTCAGGTATGGCTGGATTAGG - Intronic
1001369411 5:171182199-171182221 CCTTCAAGAAAGGCGTGAGTAGG + Intronic
1002448749 5:179307272-179307294 CCTTCAGGGACGGCAAGACCTGG + Intronic
1003375662 6:5574671-5574693 CCTAGAGGAAATGCAGGATTAGG + Intronic
1003891609 6:10568726-10568748 CTTTCAGGGAAGGCAGCAATGGG - Intronic
1004235519 6:13872052-13872074 CCTTCCGGCAGGGCAGGGCTCGG - Intergenic
1005726932 6:28658542-28658564 CATTCAGAAAAGGAAGGTCTGGG - Intergenic
1005739178 6:28774840-28774862 CTGACAGAAAAGGCAGGACTGGG + Intergenic
1007687137 6:43673658-43673680 CCTTCAGGAGAGGTAGGAAGGGG - Intronic
1009393988 6:63176058-63176080 GCAACAGGAAAGGCAGGATTAGG - Intergenic
1010569100 6:77456358-77456380 CCTTAAGGCTAGGCAAGACTGGG + Intergenic
1013623189 6:111910103-111910125 CCCACAGAAATGGCAGGACTTGG - Intergenic
1013849706 6:114498934-114498956 GCACCAGGAAAGGGAGGACTTGG + Intergenic
1013938263 6:115626980-115627002 CCTACAGAAAATGGAGGACTGGG - Intergenic
1014575127 6:123059888-123059910 CCAGCAGGAAACTCAGGACTGGG - Intronic
1014586320 6:123202181-123202203 CCTCCCAGCAAGGCAGGACTTGG + Intergenic
1017011340 6:150065777-150065799 CCAGCAGCAAGGGCAGGACTTGG - Intronic
1017118049 6:150997180-150997202 CCTACAGGAAAGACAGGTCTTGG - Intronic
1017782013 6:157722601-157722623 CCTTAAGGATAGGCAGGAGGCGG + Intronic
1019584104 7:1787387-1787409 CCTTCAGGAAAAGGCGAACTAGG - Intergenic
1020465397 7:8472863-8472885 CCTGTAGGAATGCCAGGACTAGG - Intronic
1020780744 7:12514944-12514966 CTTACAGGAAAGGAAGGAATGGG - Intergenic
1021333439 7:19368403-19368425 CAATCAGGAAAGGAAGAACTTGG - Intergenic
1021844600 7:24752334-24752356 CCTGCAGGAGAGGCAGGACATGG - Intronic
1021864898 7:24945964-24945986 AATTCAGGAAAGGCTGGGCTGGG + Intronic
1022359514 7:29644667-29644689 CTGACAGAAAAGGCAGGACTGGG + Intergenic
1023349814 7:39309188-39309210 CTTTGAGGAAACTCAGGACTTGG + Intronic
1024251175 7:47506778-47506800 TCTTTAGGAAAGCCAGGGCTGGG - Intronic
1026490723 7:70860990-70861012 CCTACAGAAAAGGCAGTAGTTGG + Intergenic
1026584470 7:71645111-71645133 TCTGCAGAAAAGGCTGGACTGGG + Intronic
1028165338 7:87532271-87532293 TTTTCAGAAAAGGCAGGTCTGGG - Intronic
1030496547 7:110307819-110307841 ATTTCAGGAAAGGCAGAATTAGG + Intergenic
1032071256 7:128808647-128808669 CCTTCAGGAGACGGAGGACTGGG + Intronic
1032452933 7:132049907-132049929 CCTGCAGGAGAGACAGGATTTGG + Intergenic
1032720849 7:134549936-134549958 CTGACAGGAAAGGCAGGACTGGG - Intronic
1033147237 7:138881907-138881929 CCTTGAGAACAGACAGGACTTGG + Intronic
1034564349 7:151901355-151901377 CCTTCAGGAAAGGGAGGGCTCGG + Intergenic
1035942199 8:3913711-3913733 CATGCAGGGAAGGCAGGAGTGGG + Intronic
1037018823 8:13943015-13943037 CCTATAGGAAAGGTAAGACTAGG - Intergenic
1038084216 8:24175391-24175413 ACTTCAGGAAAGAAAGGTCTGGG + Intergenic
1038180507 8:25222915-25222937 CCTTTAGGAAGGGCATTACTTGG - Intronic
1038604541 8:28986125-28986147 CATTCTGGAAAGGCAAAACTAGG - Intronic
1039620387 8:38991854-38991876 TCTGCAGGAAAGGCAAGACAGGG + Intronic
1040109311 8:43559621-43559643 CTGACAGAAAAGGCAGGACTGGG + Intergenic
1042654184 8:71077551-71077573 TTTTGAGGAAAGGCAGGGCTTGG - Intergenic
1047770837 8:128028503-128028525 CTCTGAGGAGAGGCAGGACTGGG + Intergenic
1048366837 8:133745712-133745734 CCTGCAGGAAAGGAAAGATTAGG + Intergenic
1048511463 8:135066153-135066175 CCAGGAAGAAAGGCAGGACTAGG + Intergenic
1048892571 8:138961033-138961055 CCTTCAGAAAATACAGGAATTGG - Intergenic
1050023425 9:1308731-1308753 CCTGCAGGGAAGGGAGGAATGGG - Intergenic
1051487983 9:17629149-17629171 ACTTCATGGAAGGCAGAACTGGG - Intronic
1054458693 9:65450321-65450343 CCTTCAGGACAGGCAGGCAGAGG + Intergenic
1056720825 9:89070340-89070362 CCTTCTGGAAAGGGCTGACTTGG + Intronic
1057182011 9:93035394-93035416 CCCTGAGGAGAGGCTGGACTCGG + Exonic
1060045034 9:120333149-120333171 CTTTGAAGAAAGGCAGGGCTTGG + Intergenic
1060201317 9:121653080-121653102 ACTTCAGGAAAGGCAGGAGTGGG - Intronic
1060266844 9:122116612-122116634 GCTTCTGGAAGGCCAGGACTGGG - Intergenic
1060655589 9:125370638-125370660 CTTTCAGCAGAGGCAGCACTGGG - Intergenic
1060776508 9:126378564-126378586 CCTCCAAGGAAGGCAGTACTGGG - Intronic
1061083855 9:128387904-128387926 GCTTCAGGGAAGGGAGGAGTGGG - Intronic
1061219690 9:129242980-129243002 CCTCCAGCAAAATCAGGACTTGG + Intergenic
1061923772 9:133796079-133796101 GCTTCAGGAAAGCCAGACCTGGG - Intronic
1062195112 9:135268774-135268796 CCTCCAGGATAGGCCAGACTGGG + Intergenic
1062195779 9:135273213-135273235 CCCTCAGGAAGTGCAGGGCTGGG + Intergenic
1062515561 9:136933357-136933379 CCTTCCACAAAGGAAGGACTGGG - Intronic
1186494482 X:10001282-10001304 CCTTCATGAAAGGGAGGAGTAGG - Intergenic
1187205396 X:17176717-17176739 CCTTCAGCAGAGCCATGACTGGG - Intergenic
1188166940 X:26873831-26873853 CCTTCAGGTGGGGCAGGGCTCGG - Intergenic
1189380243 X:40497569-40497591 CATTCTGGAAATGCAGGACTAGG + Intergenic
1189605560 X:42674100-42674122 CCTTTAGGAAGGGCAGTACTAGG - Intergenic
1192972756 X:76251249-76251271 CCTTGAGGAAAGGTAATACTTGG + Intergenic
1195128462 X:101831812-101831834 CCTTCGGGAAAGGGAGGGGTTGG + Intergenic
1195907631 X:109861391-109861413 CCTTCAGGTAACTCAGGTCTAGG - Intergenic
1198507157 X:137312322-137312344 CCTTCTGGAAATGCTGGAGTGGG + Intergenic
1198646841 X:138817312-138817334 TCTTCAGGAAATAAAGGACTAGG - Intronic
1198650087 X:138853066-138853088 CTTTCAGGAAAGACATAACTAGG - Intronic
1199741365 X:150739384-150739406 CCCTCAGCAAAGGCTGGTCTCGG + Intronic
1200024878 X:153249496-153249518 CCTTCAGTAAAGGCCCAACTGGG + Intergenic
1201642959 Y:16198881-16198903 CCGACAGAAAAGACAGGACTCGG - Intergenic
1201659856 Y:16386440-16386462 CCGACAGAAAAGACAGGACTCGG + Intergenic
1202336598 Y:23818251-23818273 CCTGGAGGAAAGGTAGGGCTGGG + Intergenic
1202534168 Y:25851820-25851842 CCTGGAGGAAAGGTAGGGCTGGG - Intergenic