ID: 1103735170

View in Genome Browser
Species Human (GRCh38)
Location 12:123056568-123056590
Sequence CAGGAGTGGCCTCCTGCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 334}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103735162_1103735170 -1 Left 1103735162 12:123056546-123056568 CCAACTCCAGGAGGCCCAGACCC 0: 1
1: 0
2: 3
3: 56
4: 503
Right 1103735170 12:123056568-123056590 CAGGAGTGGCCTCCTGCTGCCGG 0: 1
1: 0
2: 2
3: 34
4: 334
1103735164_1103735170 -7 Left 1103735164 12:123056552-123056574 CCAGGAGGCCCAGACCCAGGAGT 0: 1
1: 0
2: 3
3: 42
4: 326
Right 1103735170 12:123056568-123056590 CAGGAGTGGCCTCCTGCTGCCGG 0: 1
1: 0
2: 2
3: 34
4: 334
1103735159_1103735170 30 Left 1103735159 12:123056515-123056537 CCTGGGTCAGGTTCTCAGTCAGC 0: 1
1: 0
2: 2
3: 10
4: 193
Right 1103735170 12:123056568-123056590 CAGGAGTGGCCTCCTGCTGCCGG 0: 1
1: 0
2: 2
3: 34
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103735170 Original CRISPR CAGGAGTGGCCTCCTGCTGC CGG Intronic
900805607 1:4765845-4765867 CAGCAGTGGCCTCACCCTGCTGG - Intronic
901634303 1:10663491-10663513 GAGGAGTGGGCTCTGGCTGCTGG + Intronic
901659575 1:10790004-10790026 CCCCAGTGGCCTCCTGCTGCTGG + Intronic
902905924 1:19557455-19557477 CAGGCGTGAACTCCTGCTCCCGG + Intergenic
902979615 1:20113573-20113595 CAGGCATGGCCTCCACCTGCAGG + Exonic
903020369 1:20389575-20389597 CTGGAGTGGCCTCCAGATGTGGG + Intergenic
903118613 1:21198567-21198589 CAGGAAGGGGCTGCTGCTGCAGG + Intergenic
903131730 1:21284004-21284026 CTGGAGAGGCCTCCTGATCCTGG - Intronic
904676008 1:32199697-32199719 CAGGAGTGGCTTCCTGGGGTTGG - Intergenic
905278499 1:36834293-36834315 CAGGAGTGCCATCCTGCAGTTGG + Intronic
906227046 1:44130727-44130749 CAGGACAGTCCTCCTGCTGCTGG + Exonic
916040929 1:160960835-160960857 CAGGAATGGCCTGCATCTGCAGG - Intergenic
916920536 1:169461403-169461425 CAGGAGTGGCTTCCTGAAGATGG - Intergenic
920311863 1:205053196-205053218 CAGGTGTGGCTTCCTCCTGGTGG - Exonic
920357062 1:205381610-205381632 CAAGCGAGGCCTCCTGCTTCAGG - Exonic
920514090 1:206571691-206571713 CAGAATTGGCCTCCTGCCCCTGG - Intronic
920541890 1:206785011-206785033 CAGGAGTTGCCAGCTGCTACGGG + Intergenic
921180877 1:212630357-212630379 CAGGGGTGGCCGCCAGCTGAGGG - Intergenic
921255017 1:213331306-213331328 CAGGAGGGGTCTCCTTGTGCTGG + Intergenic
921324082 1:213973464-213973486 CTGGGGTGGCCTCTTGCTGCTGG - Intergenic
922639675 1:227216384-227216406 CAGGAATGCCATGCTGCTGCAGG + Intronic
922790085 1:228306481-228306503 CAAGGGTGGCCTGCAGCTGCAGG + Exonic
924164214 1:241265178-241265200 CTGCAGTGGCCTCCTCCTGTAGG + Intronic
1065632774 10:27697927-27697949 CAGGACAGGCTGCCTGCTGCTGG - Intronic
1065739285 10:28782409-28782431 CAGGTGTGACCTGCTGCTCCTGG + Intergenic
1069344416 10:67451102-67451124 CAGGAGTGGGCTCCTGATAAAGG + Intronic
1070588204 10:77781910-77781932 CCCGAGTGGCCACCTGCCGCAGG + Intergenic
1071880917 10:89897578-89897600 CAGGAGTGCCCTCCAGGTTCAGG - Intergenic
1075312534 10:121426705-121426727 CAGCAGTGGCCTCCTGCCCAGGG + Intergenic
1075331738 10:121578982-121579004 CAGGTGAGGCCTGATGCTGCTGG + Intronic
1075489997 10:122858611-122858633 GAGGAGTGATCTCCTGCTGTGGG - Intronic
1075666417 10:124233972-124233994 CAGGAGAGGCCCCCCGCTCCAGG + Intergenic
1076289581 10:129334806-129334828 CTGGGGTGGCCTCTTGCTGGAGG - Intergenic
1076345384 10:129775500-129775522 CAGGAATGTCCTTCAGCTGCAGG + Intergenic
1076524479 10:131102861-131102883 CAGGAGGGGCCTGTTGTTGCTGG - Intronic
1076795150 10:132794733-132794755 CTGGGGTGGACTTCTGCTGCCGG - Intergenic
1077014940 11:395348-395370 CAGGACTGGCCTCCAGCCACTGG + Intronic
1077192571 11:1261581-1261603 CAGCAGTGGCCTCCTGGGCCGGG - Exonic
1077935865 11:6785157-6785179 CAGCAATGGCCTACTGCTCCTGG + Exonic
1078876497 11:15403761-15403783 CAGGAATGGCCTCCTTCTATTGG + Intergenic
1079763061 11:24355617-24355639 CAGGAGGGCCCTCCTCCTGTGGG + Intergenic
1081687245 11:45051642-45051664 CAAGAATGCCCTCTTGCTGCAGG - Intergenic
1081889311 11:46527200-46527222 CAGGAGTGAGCAACTGCTGCTGG - Intronic
1082723430 11:56706512-56706534 CAGGAGTGCCCTCCAGATTCAGG + Intergenic
1082782964 11:57301346-57301368 CAGGAGTTGGCTCCTGGAGCTGG - Intronic
1082796465 11:57381456-57381478 CAGGAGTAGCCTCCTGCTGGTGG + Intergenic
1082803575 11:57432227-57432249 CAGGAGTCGTCTCCTTCTCCTGG - Intergenic
1083331173 11:61899065-61899087 CAGGGGTGGCCCCCTTGTGCGGG + Intronic
1083528943 11:63398671-63398693 CAGCAGTGGCTGCCTGGTGCAGG - Intronic
1085235273 11:75009722-75009744 GGGTAGGGGCCTCCTGCTGCTGG + Exonic
1085941556 11:81211729-81211751 GAGGAGTGGGCTACTTCTGCAGG + Intergenic
1088988405 11:114929548-114929570 CAGGAGGGGCCGCCTGCCCCAGG - Intergenic
1089101161 11:115963766-115963788 AAGTAGAGGCCTCCTGCTTCAGG + Intergenic
1089151743 11:116369743-116369765 CAGGCATTGCCTCCTGCTCCCGG + Intergenic
1089802029 11:121040129-121040151 CAGAAATGGCTTCCTGCTTCAGG + Intronic
1090221443 11:125030389-125030411 CAGCAGTGGGCTCCTGCTCATGG - Intronic
1090331788 11:125938583-125938605 CAGGAGGGGCCTGCTGTTCCTGG - Intergenic
1090790526 11:130089720-130089742 CAGGACTGGACTCCTTCTGAAGG + Intronic
1091099389 11:132856411-132856433 CAGGAGAGGCCCCCCGCTCCAGG + Intronic
1091252106 11:134152971-134152993 TCGGAGGGACCTCCTGCTGCAGG + Exonic
1092069849 12:5623644-5623666 CAGGAGAGGACGCCAGCTGCAGG + Intronic
1092734604 12:11568605-11568627 CAGAGGTGGCGTTCTGCTGCTGG + Intergenic
1093266919 12:17015227-17015249 GAGGAGTGGCCTCCAGGTTCAGG - Intergenic
1093866062 12:24228829-24228851 CTGGTGTGGCCTTCTGCAGCAGG - Intergenic
1095947584 12:47762358-47762380 GAGGAGAGGCCTCCTGGGGCAGG - Intronic
1097191483 12:57221512-57221534 TTGAGGTGGCCTCCTGCTGCTGG - Intronic
1097892688 12:64793753-64793775 CACAAGAGGCTTCCTGCTGCCGG - Intronic
1100528729 12:95444941-95444963 CAGGAGTTGATTCCTGCTGGTGG + Intergenic
1101104598 12:101427645-101427667 CAGGAGTGGGCTCCTGATAAAGG - Intergenic
1102360585 12:112284351-112284373 CAGGACTGGCCTGCAGCTGTGGG + Intronic
1103735170 12:123056568-123056590 CAGGAGTGGCCTCCTGCTGCCGG + Intronic
1103923065 12:124409491-124409513 CAGCAGTGGCCTCCTGACCCTGG + Intronic
1104809961 12:131614227-131614249 GATGAGAGGCCTGCTGCTGCTGG - Intergenic
1104892324 12:132146174-132146196 CAGGAGTGGCTGCCTGGGGCTGG - Intronic
1106135559 13:26970772-26970794 CAGGATTGGCCTCCTGGAGTAGG - Intergenic
1106385574 13:29282265-29282287 CAGGAGTGCCATGCTCCTGCTGG + Intronic
1108630660 13:52278646-52278668 CAGGAGTGACCTACTGCATCTGG + Intergenic
1108656028 13:52533894-52533916 CAGGAGTGACCTACTGCATCTGG - Intergenic
1113464818 13:110505789-110505811 CAGCAGTGGCCTCCCTCCGCTGG - Intronic
1114469513 14:22949776-22949798 TGGGAGTGTCCTCCTGCTGCAGG - Intronic
1115301879 14:31893895-31893917 CAGGTGTGGCCTCCTGGTTTAGG - Intergenic
1115899149 14:38125715-38125737 CAGGAGCTGTCTCCTGCTTCCGG + Intergenic
1117275871 14:54192735-54192757 CAGGAATTGCCTTCTGCTGAAGG - Intergenic
1117450099 14:55841709-55841731 CAGGGGTGTCATCCTGCTCCAGG - Intergenic
1118392653 14:65308551-65308573 CAGCAGTGGTTTCCTGCTCCAGG - Intergenic
1119522827 14:75298769-75298791 CCGGAGAGGCCTCCAGCTCCTGG - Intergenic
1120103772 14:80472175-80472197 CCTGAGTGGGCTGCTGCTGCAGG + Intergenic
1122024805 14:98867935-98867957 CTGGCATAGCCTCCTGCTGCAGG - Intergenic
1122060532 14:99133981-99134003 CAGGTGTGCCCTCCTGCCCCGGG - Intergenic
1122153878 14:99738829-99738851 CAGGTCTGGCCTCCTCCAGCAGG + Intronic
1122346476 14:101064203-101064225 CTGGAGAGGGCTCCGGCTGCAGG - Intergenic
1122393914 14:101409284-101409306 CAGGAGGGGCCTCGTGAGGCTGG - Intergenic
1122539960 14:102492635-102492657 CAGACGTGGCCTCCTCCTGCAGG + Intronic
1123943146 15:25226220-25226242 GAAGAGTGGCCTCCTGATGTGGG + Intergenic
1124126051 15:26938964-26938986 GAGTAGTGGTCTGCTGCTGCAGG - Intronic
1124192187 15:27589453-27589475 CTGGGGTGGCCTCCTGCGGCCGG + Intergenic
1124635259 15:31361035-31361057 CAGCTGCAGCCTCCTGCTGCAGG + Intronic
1129112609 15:73346546-73346568 CTGGAGGGACCTCCTGCTACTGG - Intronic
1129604158 15:77016657-77016679 CAGGAGAGTCCACCTGCTGAGGG + Intronic
1129777623 15:78247041-78247063 CAGGAGTGGCTTCCTGGTGAAGG + Intergenic
1130356281 15:83133711-83133733 CATGAGAGGCCTTGTGCTGCTGG + Exonic
1131525482 15:93149189-93149211 CAGATCTGTCCTCCTGCTGCTGG + Intergenic
1131658861 15:94492509-94492531 CAGCAGTGGACTCATGCTCCTGG + Intergenic
1132218160 15:100083248-100083270 CAGGAGTGACCTCACTCTGCAGG + Intronic
1132749267 16:1449933-1449955 CAGGAGTGGGCGCTTCCTGCCGG + Intronic
1132891701 16:2207994-2208016 CAGGCGTGGCCTCCTGTTCTTGG + Intronic
1133055145 16:3142035-3142057 CAGGGTTGGCCTCCTGTCGCTGG - Exonic
1133820042 16:9227824-9227846 CAGCAGTGGCCACATGGTGCAGG + Intergenic
1134225285 16:12385337-12385359 CAGGATTCACTTCCTGCTGCAGG - Intronic
1136048810 16:27636241-27636263 CTGGACTTGGCTCCTGCTGCTGG - Intronic
1136297001 16:29309396-29309418 CAGGAGGGGCCACATGCTCCAGG - Intergenic
1136672807 16:31873613-31873635 GAGGTGGGGCCGCCTGCTGCGGG - Intergenic
1136922932 16:34346447-34346469 CAGGAGTGGCCCCTTTCTGGGGG - Intergenic
1136981641 16:35065359-35065381 CAGGAGTGGCCCCTTTCTGGGGG + Intergenic
1137811720 16:51359128-51359150 CTGGGCTGGCCTCCTGCTGCTGG + Intergenic
1138083664 16:54115149-54115171 CAGGAGGGGGCTGCTGCTGATGG - Exonic
1138086999 16:54142426-54142448 CAGGGGTGGCCTCCTGGAGGAGG + Intergenic
1138228041 16:55315733-55315755 CAGTCATGGCCTCCTGCTCCTGG - Intergenic
1139026029 16:62819249-62819271 CAGGAGTGACCCACTGCTCCCGG - Intergenic
1141661842 16:85445706-85445728 CAGGAGAGGGCTGCTGCTGCTGG - Intergenic
1141899102 16:86978751-86978773 CAGAAGTTGCCTCATGCTTCAGG - Intergenic
1142020875 16:87781583-87781605 GGTGTGTGGCCTCCTGCTGCTGG + Intergenic
1142051573 16:87961874-87961896 GAGGAGTGCCTTCCTGCTGGTGG - Intronic
1142058552 16:88015500-88015522 CAGGAGGGGCCACGTGCTCCAGG - Intronic
1142574560 17:897956-897978 CAGGTGTGAACCCCTGCTGCTGG + Intronic
1142848756 17:2694403-2694425 CAGGAGTGGGAGCCTGCAGCAGG + Intronic
1142929451 17:3270489-3270511 CAGCAGTGGGCTTCTGCTCCTGG - Intergenic
1143773999 17:9185996-9186018 CAGGAGTGAGCTCCTCCTGCTGG + Intronic
1143918058 17:10309341-10309363 CAGGAATGGCCTCCTGCTGGAGG - Exonic
1143948624 17:10615912-10615934 CAGGAGGGGCTGCCTTCTGCTGG + Intergenic
1144504509 17:15818348-15818370 GAGGCCTGCCCTCCTGCTGCTGG + Intergenic
1144677885 17:17173477-17173499 CAGGAGGGCCGTCCTCCTGCAGG - Intronic
1144736413 17:17557991-17558013 CTGCAGTAGCTTCCTGCTGCAGG + Intronic
1144816462 17:18038986-18039008 GAGGAGCTGCCTCCGGCTGCGGG - Exonic
1144874326 17:18389373-18389395 CAGAGGTGGCCTCCTCCTCCAGG + Exonic
1145157902 17:20555045-20555067 CAGAGGTGGCCTCCTCCTCCAGG - Intergenic
1145403840 17:22569267-22569289 CAGCAGTGGCCTCCTTCTTCTGG - Intergenic
1145723089 17:27090561-27090583 CAGCAGTGGTCTCCTTCTTCTGG + Intergenic
1146005876 17:29160368-29160390 CAGGAGAGGCCTCCTGGTGAAGG - Intronic
1146164455 17:30576825-30576847 GAGGCCTGCCCTCCTGCTGCTGG + Intergenic
1148566331 17:48635122-48635144 CAGGAGTGAGGTCCAGCTGCAGG + Intergenic
1149073613 17:52573667-52573689 CTGGAGTTGGCTCCTGCTGGTGG - Intergenic
1151334545 17:73432192-73432214 CAGGACAGACCTCCTTCTGCAGG + Intronic
1152307921 17:79531952-79531974 CAAGAGGGGCCAGCTGCTGCAGG + Intergenic
1152633688 17:81421797-81421819 CTGGGGTGGCCTCTTGCTTCTGG - Intronic
1152642849 17:81456419-81456441 CGGGGGTAGCCTCCTTCTGCTGG - Exonic
1152773223 17:82183571-82183593 CAGAAGGGGCCGCCTGCTGGAGG - Intronic
1153855586 18:9142602-9142624 CAGGAGTGACCTACTGCACCTGG - Intronic
1153878839 18:9403144-9403166 CTGGAGTTGGCTCCTGCTGGTGG - Intergenic
1155500763 18:26484780-26484802 CAGGGAAGGCCTCCTGCTGGAGG + Intronic
1156525697 18:37765511-37765533 CAGGAGTGGCCTTCTGAAGCAGG + Intergenic
1157569446 18:48702941-48702963 CAGCAGAGGCTTCCTCCTGCTGG - Intronic
1157575548 18:48740749-48740771 AAGGAGTGGACTCCAGCTCCTGG + Intronic
1159916149 18:74189500-74189522 CAGAGGTGCCCTCTTGCTGCAGG - Intergenic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1161083199 19:2321676-2321698 CAGGCTAGGCGTCCTGCTGCTGG + Exonic
1162689189 19:12414512-12414534 CAGGCCTTCCCTCCTGCTGCAGG - Intronic
1162760951 19:12887783-12887805 CAGGGGCTTCCTCCTGCTGCAGG - Intergenic
1163786259 19:19276478-19276500 CAGGAGGGGCTTCCTGCAACAGG + Intronic
1164589050 19:29496128-29496150 CAAGGCTGGCCTCCTGCTGAAGG + Intergenic
1165447143 19:35862562-35862584 CTGGGGTGGCCCTCTGCTGCTGG + Exonic
1165470796 19:36003407-36003429 CAGCAGGGGCCTCCTGACGCGGG + Exonic
1166312139 19:41969034-41969056 CAGGTGTGTCTTCCTTCTGCGGG + Intronic
1166351287 19:42199599-42199621 CCTGAGTGGCGCCCTGCTGCAGG - Exonic
1167558541 19:50210770-50210792 CGTGAGTGGGCTCCTGCTGGGGG + Exonic
1167712337 19:51120098-51120120 CAGGAGTGGCTTCATCCTGTTGG - Intergenic
1168489516 19:56796475-56796497 CAGCAGTGGCATCCAGCTTCGGG - Intronic
926127701 2:10282101-10282123 CAGGCCTCACCTCCTGCTGCTGG - Intergenic
927152515 2:20204070-20204092 GGGGGGTGGCCTCCTGCTCCCGG + Exonic
927541734 2:23918087-23918109 CAGGAGTGAGCTACTGCTCCTGG - Intronic
927639329 2:24836824-24836846 CAGCACAGGACTCCTGCTGCAGG + Intronic
930030521 2:47055772-47055794 CTGGGGTGGCCTCCAACTGCGGG - Intronic
931872928 2:66481114-66481136 CCTGGGTGCCCTCCTGCTGCAGG - Intronic
932335213 2:70927269-70927291 CAGGACTCCCCTCCTGCAGCTGG + Intronic
932347760 2:71006897-71006919 CAAGAGAGGCCCCCTGCAGCTGG + Intergenic
932737608 2:74265301-74265323 CAGGTGAGGCCTCCTCCTGAGGG - Intronic
933991015 2:87633880-87633902 CAGGTGTGGCCTCCAGCCTCAGG - Intergenic
935732284 2:106074045-106074067 TAGGTGTTGCCTCCGGCTGCAGG + Intronic
935997179 2:108786937-108786959 CGCGGGTGGGCTCCTGCTGCTGG + Intronic
936011835 2:108930061-108930083 CAGGGGAGGCCTCCTGCTTGTGG - Intronic
936302824 2:111316943-111316965 CAGGTGTGGCCTCCAGCCTCAGG + Intergenic
937028674 2:118720301-118720323 CAGGTCTGGCCTCCTACTGCAGG - Intergenic
938926752 2:136050183-136050205 GAGGAGTGGCCTTCTACTGTAGG - Intergenic
945066223 2:205949762-205949784 CAGGAGGGGCCGCCTGCCCCTGG + Intergenic
945407979 2:209473040-209473062 AAGGAGTAGCGTCCTGCTCCTGG - Intronic
945950472 2:216034584-216034606 CAGGAGTGGCCCCGTGATGGTGG + Intronic
946559877 2:220900678-220900700 CAGTAGTTTCCTCCTACTGCAGG - Intergenic
947014086 2:225598878-225598900 CTGGAGAAGCCTCATGCTGCAGG - Intronic
948513777 2:238490046-238490068 CAGGACTGGCCTCCTCCAGTGGG - Intergenic
948524089 2:238559790-238559812 CAGCACTTGCCTCCTGCGGCGGG + Intergenic
948695876 2:239732803-239732825 CTTGAGTGTCCTTCTGCTGCAGG - Intergenic
948811583 2:240481114-240481136 CTGGAGTGGCCGCCTGCTGACGG - Intronic
948863694 2:240764860-240764882 CAGGAGTGGACTCCATCCGCTGG - Intronic
1169141362 20:3229011-3229033 CACGAGTGCCCGTCTGCTGCAGG - Exonic
1170300631 20:14880869-14880891 CCAGAGTGGCCTCTTGTTGCTGG + Intronic
1171561978 20:26134750-26134772 CAGCAGTGACCTCCTTCTTCTGG - Intergenic
1172023996 20:31935647-31935669 CAGCAGTCACATCCTGCTGCAGG - Intronic
1173710371 20:45150415-45150437 CAGAATTGGCCTCTTGTTGCAGG + Intergenic
1173857136 20:46257717-46257739 CAGGGGTGAGGTCCTGCTGCAGG + Intronic
1174396424 20:50249879-50249901 CTGGACTGCCCTCCTGCTTCCGG + Intergenic
1175482294 20:59320373-59320395 CAGGTCTGGCCTCAGGCTGCGGG + Intronic
1175812778 20:61867691-61867713 CAGGATTTGCCTCCTGAGGCAGG + Intronic
1176110032 20:63406946-63406968 CCGGGGTGTCCTCCTGCCGCAGG + Exonic
1176314698 21:5231494-5231516 CAGGCATGACCCCCTGCTGCGGG + Intergenic
1176429022 21:6564816-6564838 CAGCCCTGGCCTCCTTCTGCGGG + Intergenic
1178479409 21:32966743-32966765 CAGGAGTGGGGTCCTGCTCCTGG - Intergenic
1179049189 21:37874207-37874229 CAGGTGTGGCCTGCGGCTGATGG - Intronic
1179704511 21:43173132-43173154 CAGCCCTGGCCTCCTTCTGCGGG + Intergenic
1179819589 21:43929120-43929142 GAGCAGTGGCCTCCTTCTGAAGG - Intronic
1180061589 21:45388130-45388152 CGGGAGTGGCTTCCAGCTCCTGG - Intergenic
1180392478 22:12297421-12297443 CAGGCATGACCCCCTGCTGCGGG + Intergenic
1180407269 22:12567347-12567369 CAGGCATGACCCCCTGCTGCGGG - Intergenic
1180581659 22:16844674-16844696 CAGGAGAGGCCTCCTGTTTACGG + Intergenic
1180656273 22:17423565-17423587 CCAGAGTGGTCTCCTGCTTCTGG + Intronic
1181022774 22:20112414-20112436 CAGGATTGGCCTGCTGCTAGGGG - Exonic
1181173472 22:21023108-21023130 CAGCAGGGGCCTCCTGCAGGTGG - Exonic
1181310040 22:21939712-21939734 TAGGTGTGGTCTCCTGCTGGGGG - Intronic
1181500988 22:23315453-23315475 CAGGGATGGCCTCCAGCTGCAGG - Exonic
1181817786 22:25451663-25451685 CAGGAGTGGTTTCCTGAGGCTGG - Intergenic
1183612900 22:38922612-38922634 CAGGAGTGGATGCCTGATGCAGG + Intergenic
1183727546 22:39597908-39597930 AAGGAGTGGGGTCCTGCAGCTGG + Intronic
1183747455 22:39699790-39699812 GAGGACTGGCTTCCTGCGGCTGG - Intergenic
1183828344 22:40405343-40405365 AAGGAGTGGCCTCCCGCTACGGG + Intronic
1183828364 22:40405401-40405423 AAGGAGTGGCCTCCCACTCCGGG + Intronic
1184472619 22:44704309-44704331 GAGGTGGGGCGTCCTGCTGCGGG + Intronic
1184831368 22:46990862-46990884 CATGGATGGCCTCCTCCTGCTGG + Intronic
1184847856 22:47100135-47100157 CAGGACCGGCCTGCAGCTGCAGG - Intronic
1184989161 22:48155615-48155637 CAGGGGTGGCCTCCTGTTTTCGG - Intergenic
1185003151 22:48258547-48258569 CAAGCGGGGCCACCTGCTGCTGG + Intergenic
1185202353 22:49515722-49515744 CAGGAGTCGCTTCCTGCAGGGGG - Intronic
1185264432 22:49892486-49892508 CAGGAATAGGCACCTGCTGCAGG - Intergenic
949373647 3:3363194-3363216 CAGAAGTGGCCTCCTTCTGAAGG + Intergenic
949538410 3:5013354-5013376 AAGGAGAGGCCTCCTGGGGCTGG + Intergenic
949895444 3:8764760-8764782 CTGGACTGGGCTCCTGCTCCTGG + Intronic
950481793 3:13248549-13248571 CAGGAATGGCCTCCTGGAGAAGG - Intergenic
950577346 3:13840193-13840215 CAGGAGAGGCCTCCTGGAGAAGG - Intronic
953129897 3:40127841-40127863 CAGGAGTAGCATCCTGGAGCTGG - Intronic
953530466 3:43735785-43735807 CAGGAGAGGCCTCCAGCTCAGGG - Intergenic
954303788 3:49714984-49715006 CAGGCCTGTCCTGCTGCTGCGGG + Intronic
954429922 3:50465094-50465116 CTGGAGTGGCCTCCTCCTCCGGG - Intronic
954629137 3:52038820-52038842 CAGGAGTGGACTCCTGATGTTGG - Intergenic
955090951 3:55749911-55749933 CCGGAGTTGGCTCCTGCTGGTGG - Intronic
955919839 3:63943996-63944018 CAGTATTGGCCCTCTGCTGCTGG + Intronic
956756754 3:72395676-72395698 CATCAGTGGCCTCCTGGAGCTGG - Intronic
957975156 3:87433748-87433770 CAGCAGGGGCCACCTGCTTCAGG + Intergenic
959778439 3:110199475-110199497 CAGGAGTGGGATCCTGGTGAGGG - Intergenic
960057468 3:113285472-113285494 CAGGAGCAGCCTGCTGCTGTGGG + Exonic
961037320 3:123651669-123651691 CAGGGAAAGCCTCCTGCTGCCGG - Intronic
961205106 3:125075640-125075662 CAGAGCTGGGCTCCTGCTGCAGG - Intergenic
961494857 3:127284214-127284236 CAGGAGCCACCTCCTGCTCCTGG - Intergenic
961618633 3:128205411-128205433 CAAGGCTGGACTCCTGCTGCGGG + Intronic
961739569 3:129024696-129024718 CAGGAGTGGGCTCCAGATACAGG - Intronic
961825816 3:129598529-129598551 CTGGTGTGGACTCCTGCTACCGG - Intronic
962198067 3:133380264-133380286 CTGGAGTGGCCACCAGGTGCAGG - Exonic
962422886 3:135243615-135243637 CAGGAGGGGCTCCCAGCTGCCGG + Intronic
962845434 3:139270071-139270093 CAGGAGTGGCCTATGGCAGCAGG + Intronic
966863243 3:184242098-184242120 CAGGGCTGGCCTCTTGGTGCTGG + Exonic
967072785 3:185976369-185976391 CAGGAATGGCCTCCTTGTGTGGG + Intergenic
968518809 4:1026513-1026535 CAGGAGTCCCCTACTGCTGTGGG + Exonic
969375973 4:6763438-6763460 AAGGAGTGGCCACATGCAGCTGG - Intergenic
970419756 4:15894585-15894607 CAGGAGAGGCTTCCTGGTGTTGG - Intergenic
970755922 4:19426930-19426952 CAGAAGTTGGCTCCTGCTGCTGG + Intergenic
971369549 4:26005522-26005544 CAAGAGTGGCCTCCTCTTGGCGG + Intergenic
979441049 4:120749842-120749864 CAGGAGAGGTCTGCTGCTGCGGG + Intronic
981360500 4:143840210-143840232 CAGGAGGGACTTCCTGTTGCAGG - Intergenic
981371267 4:143961275-143961297 CAGGAGGGACTTCCTGTTGCAGG - Intergenic
981490340 4:145332641-145332663 CAGGAGTGGGCTCCTGATAAAGG + Intergenic
982099865 4:151957440-151957462 GTGGGGTGGCCTCCTGCTGGTGG + Intergenic
983657143 4:170094348-170094370 CAGGAGAAGCCTTCTGCTGTTGG - Intergenic
983776104 4:171609496-171609518 CAGGTGAGGCTTACTGCTGCCGG + Intergenic
985528551 5:420504-420526 CAAGACTGGCTTCCTCCTGCAGG - Intronic
985633898 5:1026770-1026792 CAGCAGTGACCTCCTGCCTCGGG - Intronic
985671294 5:1208319-1208341 CAGGAGTGGCACGCTGCTGTTGG + Intronic
985689256 5:1298185-1298207 CAGCCGTGCCTTCCTGCTGCAGG + Intergenic
985925976 5:3019301-3019323 GAGGAGTGGGCTCCTTCTACAGG + Intergenic
986768049 5:10946052-10946074 CAGGACTGCACTCCTCCTGCAGG + Intergenic
987843748 5:23255081-23255103 CAGGCATGGACTCCAGCTGCAGG - Intergenic
988019183 5:25601176-25601198 AAGGAGTTGCCACTTGCTGCTGG + Intergenic
988529958 5:32018615-32018637 CATGTGTGGCCGCCTGCTGCGGG - Intronic
988787585 5:34578976-34578998 CTGGAGTGGCCTGGGGCTGCAGG - Intergenic
989133921 5:38134788-38134810 CACGCGTTGCCTCCTGATGCTGG + Intergenic
989495883 5:42111410-42111432 CATGAGTGGGTTGCTGCTGCTGG - Intergenic
990000406 5:50885373-50885395 CAGGAATGGCTTCCTGGAGCAGG - Intergenic
991372667 5:65935933-65935955 CAGGATTGGTCTCCAGCTCCTGG + Intronic
992230423 5:74658171-74658193 CAGGAATGCCCTCCTAATGCTGG - Intronic
995776112 5:115726490-115726512 CAGCAGTGGGCTCATGCTCCTGG - Intergenic
996410588 5:123154791-123154813 CAGCAGTGGGATCCTTCTGCTGG - Intronic
997847761 5:137303728-137303750 TAGGAGTGGGCTCCTGAAGCAGG + Intronic
998449883 5:142226016-142226038 CAGGAGCGGCCCCCCGGTGCAGG + Intergenic
998712869 5:144847112-144847134 CTGGAGTGGGTTGCTGCTGCTGG + Intergenic
999433642 5:151545018-151545040 CATGAGTGTCCTGCTGCTCCCGG + Exonic
1000733095 5:164860906-164860928 CAGGATTTACCTTCTGCTGCTGG + Intergenic
1003502266 6:6712426-6712448 CAGGAGTGGTACCCTGCTGGTGG - Intergenic
1004731806 6:18366406-18366428 CAGGAGGGGCCACCTGCTCCTGG + Intergenic
1005665724 6:28052103-28052125 CAGGAGTGGACTCCTGATAATGG + Intergenic
1005665958 6:28055181-28055203 CAGGAGTGGACTCCTGATAATGG + Intergenic
1007400294 6:41599223-41599245 GAGGAGGGCCCTGCTGCTGCTGG - Exonic
1007624222 6:43233952-43233974 CAAGATTGGCCTCCTGGGGCCGG - Intergenic
1015206739 6:130649202-130649224 CTGCAGTCGGCTCCTGCTGCAGG + Intergenic
1019612212 7:1942270-1942292 CAGGCGTGGCCTCCTTCTGGAGG - Intronic
1019643789 7:2118406-2118428 CAGGGCTGACCTCCTGCTTCTGG - Intronic
1020030169 7:4927111-4927133 CAGGAGTGTCCCCCTGCAGTGGG - Intronic
1020189689 7:5985914-5985936 CAGGAGTGGCCGCAGCCTGCTGG + Intronic
1020209336 7:6146807-6146829 CAAGGGTGGGCTTCTGCTGCGGG + Intronic
1020242004 7:6402235-6402257 CAGGAGCTGCCTCCCGCTGGTGG + Intronic
1020293231 7:6738754-6738776 CAGGAGTGGCCGCAGCCTGCTGG - Intergenic
1020465818 7:8477663-8477685 TAGGAATCACCTCCTGCTGCAGG + Intronic
1022452543 7:30528463-30528485 CAGGTGTGAGCTCCTGCTCCTGG - Intronic
1023864076 7:44230549-44230571 CAGGAGTGTCCTGCTGCGGTGGG - Intronic
1023929814 7:44698407-44698429 CAGGTGTGGCCCCATGCTTCTGG + Intronic
1024866267 7:53907567-53907589 CAGCAGTGGGCTCGTGCTCCTGG + Intergenic
1027835466 7:83235868-83235890 AAGGAGTTACCTACTGCTGCTGG - Intergenic
1028183102 7:87748350-87748372 AAGGAGTGGACTGCTCCTGCAGG - Intronic
1029166447 7:98594850-98594872 AAGGGGTGGGCTCCTGCTGCAGG + Intergenic
1029188030 7:98753401-98753423 CAGCAGTGGCCTCGTGCTGGAGG + Intergenic
1032018147 7:128392676-128392698 CAGGAGGGGCCGCCTGCCCCTGG + Exonic
1032695410 7:134331571-134331593 CAGGTGTGTCCTCCTCCTCCAGG + Intergenic
1034964304 7:155382245-155382267 CAGAAGTGGGAGCCTGCTGCGGG + Exonic
1035324532 7:158056318-158056340 CAGGTGTGCCCCCCTGCTCCCGG - Intronic
1035384298 7:158459966-158459988 CAGGAGGGTCATCCAGCTGCAGG + Intronic
1035384311 7:158460039-158460061 CAGGAGGGTCATCCAGCTGCAGG + Intronic
1035384321 7:158460112-158460134 CAGGAGGGTCATCCAGCTGCAGG + Intronic
1035384334 7:158460185-158460207 CAGGAGGGTCATCCAGCTGCAGG + Intronic
1035630623 8:1104289-1104311 CAGGAGTGGGTTCCAGCCGCAGG + Intergenic
1035663571 8:1364380-1364402 GAGGAGTGGTCTCCTGCTGTGGG + Intergenic
1035936528 8:3847359-3847381 CAGAAGTGGTCCCCTCCTGCTGG + Intronic
1036799728 8:11781378-11781400 CTGCAGTAGCCTCTTGCTGCTGG - Intronic
1037593353 8:20332097-20332119 CAGCAGTGGCCCCCTCCAGCAGG + Intergenic
1037756133 8:21711172-21711194 CAGGAGTGACCTCCTGGTGTTGG - Intronic
1040302751 8:46196405-46196427 CAGGAGTGCTGTCTTGCTGCAGG + Intergenic
1040757398 8:50794610-50794632 CAGAAGTGGCCTACTACTGAAGG - Intergenic
1041345931 8:56898068-56898090 CATGAGTCTCCTTCTGCTGCAGG + Intergenic
1041830149 8:62144376-62144398 CAGGAGAGACCTCCGGCGGCAGG + Intergenic
1043867671 8:85394515-85394537 CATGAGTGGCCCTCTGTTGCTGG + Intronic
1044418200 8:91960364-91960386 CAGGTGTGTCTCCCTGCTGCTGG + Exonic
1048468034 8:134683745-134683767 CAGGATGGGCCTCCTGCTTGCGG - Intronic
1049411831 8:142477025-142477047 CAGGGCAGCCCTCCTGCTGCGGG + Intronic
1049716575 8:144095728-144095750 CAGCAATGGCCTCCTCCTGCAGG - Intronic
1049741208 8:144241870-144241892 AAGGAGTGGGCCCCTGCTGCAGG + Intronic
1051938335 9:22471922-22471944 CAGTAGTGGCTTCCTGGTGAGGG - Intergenic
1053434052 9:38063540-38063562 CAAGAGTGGCCTTCTGCTGAAGG + Intronic
1057078736 9:92155924-92155946 CAGGAGGGGCCTGTTGTTGCTGG - Intergenic
1057730108 9:97601133-97601155 CAGGAGTGGCACCATGTTGCAGG + Exonic
1058897832 9:109415316-109415338 CAGGAGAGGCTTCCTGGAGCAGG + Intronic
1059190307 9:112319258-112319280 CAGGTGTGGGCTACTGCTCCTGG - Intronic
1059235326 9:112755861-112755883 AAGGAGTGCTCTCCTTCTGCTGG - Intronic
1060407478 9:123379950-123379972 CAGGAATGGGCTCTGGCTGCTGG - Exonic
1060536559 9:124393934-124393956 CCGGTGTGGCCTCGTGGTGCAGG - Intronic
1060794424 9:126504525-126504547 CGGGGACGGCCTCCTGCTGCAGG + Exonic
1061592690 9:131608240-131608262 CAGGAGAGGACGGCTGCTGCTGG - Intronic
1062128170 9:134877593-134877615 CAGCAGTGGCTTCATGTTGCCGG - Intergenic
1062466200 9:136682689-136682711 GAGCAGTGGGCTCCTGCTGAGGG + Intronic
1062514446 9:136925578-136925600 CTGGGATGGCCTCCTGCTGGTGG + Intronic
1203773360 EBV:60311-60333 CAGAAGGCGCCTCCTGGTGCCGG - Intergenic
1185948061 X:4400411-4400433 CAGGAGAGGCTTCTTGCTGTAGG + Intergenic
1188492982 X:30755738-30755760 GTCGAGTGGCCTCCTCCTGCCGG - Intergenic
1189292505 X:39896130-39896152 CAGGACTGGCCTCAGGCTGCAGG + Intergenic
1190641265 X:52483751-52483773 CAGAAGTCCCCTCATGCTGCTGG - Intergenic
1190646407 X:52529114-52529136 CAGAAGTCCCCTCATGCTGCTGG + Intergenic
1192240487 X:69324138-69324160 CAGGAGCAGCCTCCAGATGCTGG - Intergenic
1194614883 X:96087971-96087993 GAGGAGTGCCCTCCTGATTCAGG + Intergenic
1195418052 X:104641716-104641738 CAGGTGTGGGCTGCAGCTGCCGG - Intronic
1195734113 X:107995818-107995840 AAGAAGTGGCTTGCTGCTGCAGG + Intergenic
1196818817 X:119686622-119686644 CAGGAGGAGGCTTCTGCTGCTGG - Intronic
1199615118 X:149649952-149649974 CTGGAGGGGCTGCCTGCTGCTGG - Intergenic
1200085696 X:153603544-153603566 CACAAGGTGCCTCCTGCTGCAGG - Intergenic
1200235972 X:154467859-154467881 GGGGGGTGGGCTCCTGCTGCTGG + Exonic
1201735433 Y:17255741-17255763 CAGGAGAGGCTTCCTGCTATAGG + Intergenic
1201735577 Y:17256928-17256950 AAGGAGTGGTCTCCTGCACCAGG - Intergenic
1202374372 Y:24220131-24220153 CAGGCGTGAGCTCCTGCTCCTGG - Intergenic
1202496409 Y:25449989-25450011 CAGGCGTGAGCTCCTGCTCCTGG + Intergenic