ID: 1103737998

View in Genome Browser
Species Human (GRCh38)
Location 12:123072667-123072689
Sequence AACCTTGAGCAGCTGTTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103737998_1103738003 13 Left 1103737998 12:123072667-123072689 CCTGTCAACAGCTGCTCAAGGTT 0: 1
1: 0
2: 0
3: 12
4: 114
Right 1103738003 12:123072703-123072725 TTCATCTGAAAGGGGCTTTCAGG 0: 1
1: 0
2: 0
3: 28
4: 170
1103737998_1103738004 23 Left 1103737998 12:123072667-123072689 CCTGTCAACAGCTGCTCAAGGTT 0: 1
1: 0
2: 0
3: 12
4: 114
Right 1103738004 12:123072713-123072735 AGGGGCTTTCAGGATGCCGAAGG 0: 1
1: 0
2: 0
3: 12
4: 130
1103737998_1103738000 3 Left 1103737998 12:123072667-123072689 CCTGTCAACAGCTGCTCAAGGTT 0: 1
1: 0
2: 0
3: 12
4: 114
Right 1103738000 12:123072693-123072715 AGGTTAAACATTCATCTGAAAGG 0: 1
1: 0
2: 1
3: 17
4: 184
1103737998_1103738002 5 Left 1103737998 12:123072667-123072689 CCTGTCAACAGCTGCTCAAGGTT 0: 1
1: 0
2: 0
3: 12
4: 114
Right 1103738002 12:123072695-123072717 GTTAAACATTCATCTGAAAGGGG 0: 1
1: 0
2: 1
3: 14
4: 232
1103737998_1103738001 4 Left 1103737998 12:123072667-123072689 CCTGTCAACAGCTGCTCAAGGTT 0: 1
1: 0
2: 0
3: 12
4: 114
Right 1103738001 12:123072694-123072716 GGTTAAACATTCATCTGAAAGGG 0: 1
1: 0
2: 1
3: 9
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103737998 Original CRISPR AACCTTGAGCAGCTGTTGAC AGG (reversed) Intronic
902297704 1:15479759-15479781 AACCTTGAGCAGAGACTGACAGG + Intronic
902801873 1:18835454-18835476 AGCCTTGAGCACTTGTTGGCTGG - Intergenic
906843535 1:49165480-49165502 AACTTTGGGAAGCTGTTGTCGGG + Intronic
907228363 1:52970779-52970801 AAACGTGAGCAGTTGTTGGCTGG + Intronic
907657270 1:56356997-56357019 CACCTTGAGCACGTGTTGTCAGG - Intergenic
908153090 1:61324641-61324663 AACCTTGAAGAGCTGTTCAGAGG - Intronic
909515811 1:76505911-76505933 TACCCTCAGCAGCTATTGACAGG - Intronic
910786097 1:90999514-90999536 TTCCTTCAGGAGCTGTTGACAGG - Intronic
912263808 1:108134172-108134194 TGCCTTGTGCAGCTGTGGACAGG + Exonic
919275650 1:195412715-195412737 AACCTTCAGGATCTGTTGACTGG - Intergenic
924004791 1:239597398-239597420 AACCTGTAGCAGATGTTGAAAGG + Intronic
1063381115 10:5586911-5586933 CACCTTGGGCACCTGTTGTCAGG + Intergenic
1066679981 10:37928910-37928932 AACATTCATCAGCTGTTGAGAGG - Intergenic
1068661908 10:59631276-59631298 AACCTTGAGAAGCTGGTAAATGG - Intergenic
1070642052 10:78177319-78177341 ATCCTTGGGCTGCTTTTGACGGG + Intergenic
1073706108 10:105986378-105986400 AATATTGAGTTGCTGTTGACAGG - Intergenic
1074462282 10:113648718-113648740 CACCTTCAGCAGCTGTTGAGAGG - Intronic
1075371124 10:121935944-121935966 AACCTTGTGCAGATGTTCAAAGG + Intergenic
1075389150 10:122079825-122079847 CACCTTGCACAGCTGTTGGCAGG + Intronic
1075801282 10:125155253-125155275 AAACTTCAGGAGCTGTGGACGGG - Intronic
1075859905 10:125666678-125666700 AACCTTGAATAGCTGTTTATTGG + Intronic
1080850742 11:36067509-36067531 AACCTTGCTCAGTTGTTGAGGGG - Intronic
1083443567 11:62692333-62692355 AACCTTGGGCAACTCTTCACGGG - Intronic
1084431707 11:69114977-69114999 AGCTTGGAGCAGCTGGTGACAGG + Intergenic
1084586901 11:70067668-70067690 AACCTTGAGAAGATGCTCACAGG + Intergenic
1086960233 11:92973573-92973595 AAGGAGGAGCAGCTGTTGACTGG - Intronic
1087711640 11:101560343-101560365 AACCCTGACCAGTTGTTGCCTGG - Intronic
1089902271 11:121999516-121999538 AATCTTGAGCAGCTGTAGGCAGG + Intergenic
1090026229 11:123169709-123169731 AACCTTGAGCATATGTTGTCAGG - Intronic
1091574556 12:1721128-1721150 CACCTTGAGCACATGTTGTCAGG + Intronic
1093932054 12:24963850-24963872 CACCTTGAGCACATGTTGCCAGG + Intergenic
1096356000 12:50941556-50941578 AACCTTGAGAATCTGATGAAAGG + Intergenic
1096898382 12:54848130-54848152 AACCTGCAGCAGCTGTGGCCTGG - Intronic
1099980633 12:89597581-89597603 AACCTTGAGAAGCTGCAGAGAGG - Intronic
1101901423 12:108793882-108793904 GACCTTGAGTAGCTGCTGGCTGG - Intronic
1103089024 12:118084259-118084281 AACCTTTTGCAGCTCTTGACTGG - Intronic
1103737998 12:123072667-123072689 AACCTTGAGCAGCTGTTGACAGG - Intronic
1107490540 13:40876893-40876915 AACCTTGGGCATCAGTGGACTGG - Intergenic
1108992756 13:56682984-56683006 ACTCTTGAGCAGCTGTTAAATGG - Intergenic
1113874980 13:113588541-113588563 ATCTTTGAACAGCAGTTGACAGG + Intronic
1113945132 13:114039708-114039730 AGCCTGGAGCAGCTGTTGCCGGG + Intronic
1114730355 14:24986524-24986546 AGCCTGGATCAGCTGTTGACAGG + Intronic
1118597103 14:67444205-67444227 CACCTTGAGCATATGTTGTCAGG + Intergenic
1121147717 14:91599621-91599643 CACCTTGGGCAGATGTTGTCAGG - Intronic
1121424942 14:93843676-93843698 AACCTTGGGCAAATGTTGTCAGG - Intergenic
1122975589 14:105169385-105169407 ACCCTGGAGCATTTGTTGACTGG - Intergenic
1125144817 15:36454556-36454578 AACCTTAAGCAGCTCGTGAATGG + Intergenic
1127110937 15:55669676-55669698 AGTATTGTGCAGCTGTTGACTGG - Intronic
1128774509 15:70309414-70309436 CACCTTGGGCACCTGTTGTCAGG - Intergenic
1132512109 16:348474-348496 AGCCGTGAGCAGCTGTTGGCTGG - Intronic
1136855093 16:33649046-33649068 CACCTTGACAAGCTGTTGCCAGG + Intergenic
1137237376 16:46626654-46626676 AACATTGTGCAGCTGCTGATCGG - Intergenic
1140140204 16:72248962-72248984 TACCTTGAGTAGCTGTTTAAAGG - Intergenic
1140657541 16:77155916-77155938 AACCTAGATGAGCTGTTGAAAGG + Intergenic
1203116675 16_KI270728v1_random:1497530-1497552 CACCTTGACAAGCTGTTGCCAGG + Intergenic
1142481785 17:223514-223536 AACCCTGAGCCGCTGGTGAGAGG + Intronic
1143494014 17:7300608-7300630 AAGCCTGAGGAGCTGTTGGCTGG - Intergenic
1146830669 17:36066471-36066493 AACCATGAGGAGCTGGAGACTGG + Intronic
1151533741 17:74725256-74725278 AATTTTCAGCAGCTGTTGAGTGG + Intronic
1151690070 17:75678263-75678285 AACCTTGAGCATCTGAGGAGGGG - Intronic
1153092773 18:1367230-1367252 AACTTTATGCAGCAGTTGACTGG + Intergenic
1155850601 18:30769433-30769455 CACCTTGAGCACGTGTTGTCAGG + Intergenic
1158301202 18:56055238-56055260 AACCTTGGGCACCTGTCGTCAGG + Intergenic
1158737473 18:60099853-60099875 TGCCTGGAGCAGCTGATGACAGG - Intergenic
1159810598 18:73014042-73014064 AACCTTGATCAGCTTTTTATAGG + Intergenic
1159912064 18:74154882-74154904 AACCTACAGCAGTTGTGGACTGG + Intronic
1162007576 19:7789812-7789834 AACCTTGCGCAGGTGTTGCACGG - Intergenic
1166293201 19:41876602-41876624 AACCATGATCAGCTCTTTACTGG - Intergenic
1167000312 19:46741875-46741897 AAGCTTCAGCAGCTGCTGGCAGG + Intronic
1167903807 19:52641806-52641828 AACCTTGGGCACCTGTGGTCGGG - Intronic
925301047 2:2812759-2812781 AACATTGAGCATCTCTAGACAGG + Intergenic
927770237 2:25854725-25854747 AACCTTGATCAGCTGCAGTCTGG + Intronic
937050029 2:118881114-118881136 AACCATGAGCTACTGATGACAGG + Intergenic
937142227 2:119612029-119612051 CACCTTGAGGACCTGTGGACAGG - Intronic
937413518 2:121696757-121696779 GGCCTTGAGCATCTGTGGACGGG + Intergenic
937460086 2:122078005-122078027 ATCCGTGACCATCTGTTGACAGG - Intergenic
942487315 2:176453051-176453073 CTCCTGGAGCAGCTGTTGAATGG - Intergenic
944062748 2:195586395-195586417 CACCTTGAAGAGCTGTTGCCAGG + Intronic
1173360524 20:42340380-42340402 AACCCTAAGCAGCTGTAGCCAGG + Intronic
1175604927 20:60304855-60304877 AACCTTCAGCACCTGCTTACTGG - Intergenic
1182050018 22:27305515-27305537 CACCTTGAGAAGCTGTTGCCTGG + Intergenic
1182137670 22:27920381-27920403 AACCATGAGAACCTGTTGAAAGG + Intergenic
1182667865 22:31972389-31972411 GACCTGGAGCAGCTGTGGGCTGG + Intergenic
1185233920 22:49700118-49700140 AACCCTAGGCAGCTGTGGACAGG + Intergenic
950123481 3:10497055-10497077 GACCTTGGGCAGCTGTGGGCAGG + Intronic
955191854 3:56769227-56769249 AGCCGTGAACAGCTGTGGACAGG + Intronic
956103153 3:65789337-65789359 AGCCTAGAGGAGCTCTTGACTGG - Intronic
956953524 3:74310556-74310578 AACCCTATGCAGCTGTGGACAGG - Intronic
958795160 3:98699370-98699392 AAGGTTGATCAGCTGTTGGCTGG - Intergenic
959270245 3:104198278-104198300 AACCCTTACCCGCTGTTGACAGG - Intergenic
960055603 3:113274449-113274471 AACCCTGAGCAGATGCTGAGGGG + Exonic
961751022 3:129094985-129095007 AACATTGTGCAGCTGCTGATCGG - Exonic
966862183 3:184236664-184236686 ACCCTGGAGCAGCTGGTGGCAGG - Exonic
967456505 3:189692771-189692793 AGCTGTGAGCAGCTTTTGACAGG - Intronic
977554098 4:98471255-98471277 AACCATTAGAAGCTTTTGACTGG + Exonic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
978062798 4:104358901-104358923 AACTTTGAGGAACTGTTTACAGG + Intergenic
978924247 4:114223428-114223450 AACCTTGATCACTTGTTTACAGG + Intergenic
979876124 4:125893426-125893448 GACTGTGAGCAGCTGTTAACAGG - Intergenic
981524697 4:145698291-145698313 AACCTTGGGCATATGTTGTCAGG - Intronic
983234059 4:165158917-165158939 AACCTTGACTATCTGTTGATAGG + Intronic
985784900 5:1888252-1888274 AAGCTGGAGCAGCAGGTGACCGG + Intergenic
987144253 5:14976509-14976531 AGTCTTGTGCAGCTGTTGAGAGG - Intergenic
991046760 5:62231128-62231150 AACCTTGACAAGCTGTTGCCAGG - Intergenic
991642248 5:68766773-68766795 AACCTTTAGATGCTGTTAACAGG + Intergenic
999325786 5:150642545-150642567 GATCTTGAGCAGCTGCTGCCTGG + Intronic
1003492563 6:6636429-6636451 AACTTTGTGCAGCTGATGACAGG + Intronic
1003840356 6:10113320-10113342 AACCGTGAGCCGCTGATAACCGG + Intronic
1004873643 6:19933414-19933436 AACCTGGTTCTGCTGTTGACTGG + Intergenic
1008831987 6:55775857-55775879 AAGGTTGTGCAGCTGTTGAGAGG + Intronic
1011198102 6:84803177-84803199 AGGCTTCAGCTGCTGTTGACTGG + Intergenic
1012926790 6:105275253-105275275 AACCTTGAGAGACTGGTGACAGG + Intergenic
1015090237 6:129347257-129347279 AACATGGAGTGGCTGTTGACTGG + Intronic
1020340953 7:7110535-7110557 CACCTTGAGCACATGTTGTCAGG + Intergenic
1023836452 7:44071254-44071276 AACGTTGAACATCTGTTCACTGG - Intergenic
1025024207 7:55503130-55503152 CACTCTGAGCAGCTGCTGACAGG + Intronic
1037645457 8:20788690-20788712 GACCTTGACCATCTGTTGACTGG + Intergenic
1038350749 8:26774290-26774312 TTCTTTGAGCAGCTGCTGACTGG + Intronic
1049322246 8:142002742-142002764 AATCTGGAGCAGCTGGTGTCTGG - Intergenic
1053236012 9:36454895-36454917 AACCTTGAAAATCTGTTTACAGG - Intronic
1056721036 9:89072252-89072274 GACCTTGAGCTGCTTATGACAGG + Intronic
1057420421 9:94907749-94907771 CACCTTGGTCAGCTGTTGAGAGG - Intronic
1188939561 X:36219874-36219896 CACCTTGAGCACATGTTGTCAGG + Intergenic
1190408278 X:50109575-50109597 CACCTTGAGCACATGTTGTCAGG + Intergenic
1190951820 X:55153159-55153181 CACCTTGAGCACATGTTGTCAGG + Intronic
1191689412 X:63924754-63924776 AACCTTGGGCACATGTTGTCAGG + Intergenic
1200378187 X:155806453-155806475 AGGCTTGAGCAGTTGTTCACTGG - Intergenic