ID: 1103738240

View in Genome Browser
Species Human (GRCh38)
Location 12:123074222-123074244
Sequence CTGTTAAATCAGATGAGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103738239_1103738240 3 Left 1103738239 12:123074196-123074218 CCAAGTACTTCTAGGGTGGCTGC 0: 1
1: 0
2: 0
3: 4
4: 87
Right 1103738240 12:123074222-123074244 CTGTTAAATCAGATGAGACTTGG 0: 1
1: 0
2: 0
3: 14
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103738240 Original CRISPR CTGTTAAATCAGATGAGACT TGG Intronic
903102246 1:21040825-21040847 CTGTAAAAACAGCTGAGTCTTGG + Intronic
903227021 1:21899703-21899725 CTGTCAACTCAGGTGATACTAGG - Intronic
905246933 1:36621573-36621595 CTGTGAATACAGATGAGGCTTGG + Intergenic
908488781 1:64622007-64622029 CTGGTAAATCAGAATGGACTGGG - Intronic
908923927 1:69230380-69230402 CTGTGAACTCAGATGAGTCAAGG - Intergenic
909046606 1:70718186-70718208 CTCTGAAATCAGATGGAACTGGG - Intergenic
909335139 1:74464658-74464680 CTGTGTACACAGATGAGACTGGG - Intronic
910465621 1:87496200-87496222 CTGTTAACACAGAAGAGACCAGG + Intergenic
912083184 1:105964391-105964413 CTGTACAATCATATTAGACTAGG - Intergenic
912118310 1:106435674-106435696 CTGTTAAATTAAATTAAACTTGG - Intergenic
912143825 1:106766564-106766586 CTGTGAACTCAGATGTGACTAGG + Intergenic
913319707 1:117579561-117579583 CTGTGGGATCAGAAGAGACTTGG + Intergenic
914360433 1:146931282-146931304 CTGTTAACACAGAAGAGACCAGG + Intergenic
914493314 1:148168616-148168638 CTGTTAACACAGAAGAGACCAGG - Intergenic
919217061 1:194570741-194570763 ATGTTACATGAGATAAGACTTGG + Intergenic
922708693 1:227809153-227809175 TTGTTCAATCAGAAGACACTGGG + Intergenic
923805251 1:237250599-237250621 CAGTGAAATCAGCTGAGAATGGG - Intronic
924161801 1:241240506-241240528 CTGTTAGATTAGATCAAACTAGG + Intronic
1063790389 10:9438743-9438765 TTGTTAAATAAGATGAGTTTAGG - Intergenic
1065661895 10:28012795-28012817 CTGGTAAATCAGCTGAAAGTAGG + Intergenic
1066660290 10:37732175-37732197 TTTCTAAATCAGATGAAACTTGG - Intergenic
1067183888 10:44011021-44011043 CTGTGAGCTCAGAGGAGACTTGG + Intergenic
1067764834 10:49076937-49076959 CTGTGGCATCAGATGAGCCTAGG - Intronic
1071710905 10:88048199-88048221 ATGTAAAATCAGAGGAGACAGGG - Intergenic
1072211903 10:93253933-93253955 GTATTAAAACAGAAGAGACTAGG - Intergenic
1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG + Intergenic
1074079179 10:110153851-110153873 CTGTTTAACCACTTGAGACTTGG - Intergenic
1074313441 10:112341994-112342016 CTTTTAAATCAAAAGAGACATGG - Intergenic
1074813724 10:117129280-117129302 CTGATTCATCAGATGGGACTAGG + Intronic
1076621716 10:131793154-131793176 CTGTTGGATCAGAGGAGGCTTGG + Intergenic
1078765537 11:14293471-14293493 CAGTTAAAAAAGATGAGATTTGG - Intronic
1078884236 11:15484137-15484159 ATGTTAAATAAGATTAGATTGGG - Intergenic
1080142677 11:28941662-28941684 CTCTGAAATCACATGAGTCTTGG + Intergenic
1080479955 11:32637450-32637472 CTATTAAATGATGTGAGACTTGG - Intronic
1081467047 11:43330140-43330162 CTGTTAAATTAGGTGAGATAAGG - Intronic
1081730507 11:45368801-45368823 CTGTTAAGACAGATGAAAATGGG + Intergenic
1082874275 11:57972234-57972256 CTTGTAACTCAGATGTGACTGGG + Intergenic
1084519170 11:69652935-69652957 CTGTCCAATCAGATGACTCTGGG - Exonic
1086637419 11:89106041-89106063 ATGTTTTATCAGATTAGACTCGG - Intergenic
1086887164 11:92219546-92219568 AGTATAAATCAGATGAGACTTGG - Intergenic
1087258744 11:95986512-95986534 TTGTTAAATCTGATGACCCTAGG + Intronic
1087519467 11:99212852-99212874 CTGATAAATCAGTTAACACTTGG - Intronic
1088186922 11:107180938-107180960 ATGTTGAAACACATGAGACTGGG + Intergenic
1088927123 11:114313861-114313883 CTGTTGAGTCAGCTGACACTGGG - Intergenic
1089034958 11:115379175-115379197 CTGCTAAATCAAATAAGACCTGG - Intronic
1089842176 11:121427895-121427917 CTCTTGAATCTGATGAGAATTGG + Intergenic
1090688390 11:129150530-129150552 CCTGTAAATCAGAAGAGACTGGG + Intronic
1091990786 12:4954156-4954178 TTGATAAATCAGTTGTGACTTGG - Intergenic
1093115246 12:15201837-15201859 ATGTTACAGCAGAGGAGACTAGG + Intronic
1093707391 12:22289319-22289341 CTGTTTCCTCAGATGAGAATTGG - Intronic
1093987172 12:25548428-25548450 CTTTTAAAATAGATGAGATTTGG - Intronic
1094314971 12:29129630-29129652 CTGTTAGATCAGTTAAGACTAGG + Intergenic
1098276779 12:68820574-68820596 CTGTTAGATCAATTTAGACTTGG + Intronic
1099043570 12:77686741-77686763 CTGTAAAGTCAGATGAACCTAGG - Intergenic
1099251777 12:80264966-80264988 CTGTTAAATAAGATGCTAATTGG + Intronic
1099712161 12:86241927-86241949 CTCTCAAATCATCTGAGACTAGG + Intronic
1100162710 12:91879219-91879241 CTTTGAAATCAGATGGAACTGGG + Intergenic
1100451178 12:94708019-94708041 CTGTTGGAGCAGCTGAGACTTGG - Intergenic
1103190741 12:118999756-118999778 CTCTGGAATCAGATGGGACTGGG - Intronic
1103738240 12:123074222-123074244 CTGTTAAATCAGATGAGACTTGG + Intronic
1104578045 12:129986355-129986377 GCCTTAAGTCAGATGAGACTTGG - Intergenic
1107849912 13:44560958-44560980 ATCTTAAAGCAGATGAGACTAGG - Intronic
1108112141 13:47086006-47086028 CTATTAAATCAGAAGAGATTTGG + Intergenic
1110081300 13:71316852-71316874 TTCTTAAATAAGATGAGAGTTGG + Intergenic
1112190125 13:97168866-97168888 CTGAGAGATCAGATGAGACAAGG - Intergenic
1112993310 13:105540953-105540975 CTGTGAAAATAGAGGAGACTTGG + Intergenic
1113045976 13:106155441-106155463 TTGTGAGATCAGATGAGATTGGG + Intergenic
1114693267 14:24605207-24605229 GTGTGAAATTAGAAGAGACTTGG - Intergenic
1114826559 14:26087686-26087708 CTGTTTACTGAGATGACACTGGG + Intergenic
1115665797 14:35544382-35544404 CTCTGAAATCAGATCAGTCTAGG + Intronic
1116105267 14:40494768-40494790 ATCATAAATCAGATGAAACTAGG - Intergenic
1118068782 14:62222554-62222576 CTTATAAACCAGAAGAGACTGGG - Intergenic
1120969036 14:90192106-90192128 CTTATAAATCACCTGAGACTGGG + Intergenic
1125800220 15:42439467-42439489 CTTTGACATCAGCTGAGACTAGG - Exonic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127935690 15:63635389-63635411 CTGTTGAGACAGATCAGACTTGG - Intronic
1128148560 15:65346757-65346779 CTGTTAAAAGAGCTGAGTCTCGG - Intronic
1130645194 15:85719315-85719337 CTTGTAAATCAGGTGAGAATGGG + Exonic
1133818921 16:9219247-9219269 CTGTAAAATCACATGATCCTAGG - Intergenic
1134363648 16:13556207-13556229 CTGCTAAATCAGTGGTGACTCGG + Intergenic
1137658226 16:50179852-50179874 CTGTTAAATCAAATAAAACCAGG + Intronic
1138321907 16:56121543-56121565 CTGGTAGATGTGATGAGACTTGG + Intergenic
1139330045 16:66181113-66181135 CTCTGAGATCAGATGGGACTAGG - Intergenic
1141867241 16:86758969-86758991 GTGTTGAATCAGATGAAACTAGG + Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1148814568 17:50318224-50318246 CTGTGAAATCAGATGGCTCTGGG + Intergenic
1151091920 17:71449991-71450013 CTGTTAAATCAGCTAAGTCTCGG + Intergenic
1156623875 18:38885143-38885165 CAGTTAAATGAGATTAGAGTTGG + Intergenic
1156747415 18:40409192-40409214 TTGAAAGATCAGATGAGACTTGG + Intergenic
1157562133 18:48655710-48655732 CTGCTACATCAGGTGACACTGGG - Intronic
1157950109 18:52026984-52027006 TTCTGAAATCAGAAGAGACTAGG - Intergenic
1158847532 18:61460435-61460457 CTGTTAAATTAGATGTGTTTTGG - Intronic
1159348082 18:67233343-67233365 CAGATAGATCAGATGAGACAGGG - Intergenic
1163029307 19:14533696-14533718 CTCTCAGATCAGATGAGATTTGG - Intronic
1163932024 19:20404227-20404249 CTATTAATTCAGATGAGAGCTGG - Intergenic
1166397558 19:42453043-42453065 CTCTTACTTCAGAAGAGACTGGG + Intergenic
1168379183 19:55905886-55905908 CTATTAAATTAGTTGAAACTGGG - Intronic
925254267 2:2468847-2468869 CTATTGAGGCAGATGAGACTGGG + Intergenic
925813517 2:7724552-7724574 CTGTTAAAACCCATGACACTAGG + Intergenic
926002702 2:9346543-9346565 ATGTTAGATTAGATGAGACTAGG + Intronic
926047864 2:9723365-9723387 CTGTTAAATGACATATGACTGGG + Intergenic
926960349 2:18351382-18351404 CAGTTTAATTTGATGAGACTGGG - Intronic
929438784 2:41949172-41949194 CTGTTAAACCAGAAGAGACAGGG + Intronic
929772601 2:44904884-44904906 CAGTTAAATCAAATGAGTCTGGG + Intergenic
939293128 2:140220906-140220928 CTGTTAAATCAAAAGGGGCTCGG + Intergenic
939890077 2:147726176-147726198 CATTTAAATTAGTTGAGACTTGG - Intergenic
942112728 2:172698592-172698614 TTGTTAAAACAGAGGTGACTGGG + Intergenic
943072089 2:183153357-183153379 GCCTTAACTCAGATGAGACTTGG - Intronic
944368518 2:198953917-198953939 CTGTCAAAGCAGAAGTGACTTGG - Intergenic
944398825 2:199301814-199301836 ATGGTAAATCAGATGATGCTTGG + Intronic
944781754 2:203025720-203025742 CTGTGAACTCAGAGGACACTTGG + Intronic
944907715 2:204279516-204279538 CTTCTAAATCAGATGATAGTCGG - Intergenic
945031231 2:205665530-205665552 CTGATCCATCAGAGGAGACTGGG - Intergenic
948537508 2:238657173-238657195 CTATTAAATCAAATGACACTTGG - Intergenic
1169352769 20:4882693-4882715 CTGTTAAATGGGATAACACTAGG + Intronic
1170541943 20:17398021-17398043 CTGTTAAAGCAGATAATATTGGG + Intronic
1173848890 20:46205468-46205490 CTTTGAAATCAGAGGAGACCTGG - Intronic
1177809083 21:25905472-25905494 CTGTAAAATAAGATAAGATTGGG - Intronic
1178560514 21:33635272-33635294 TTATTAAATAACATGAGACTTGG - Intronic
1181770147 22:25119324-25119346 CTCTGAGATCAGATGAGACTGGG - Intronic
1181873667 22:25923186-25923208 TTGTTAAACCAGAAGACACTGGG + Intronic
952005377 3:28836956-28836978 CTGGAAAACCAGCTGAGACTGGG + Intergenic
956486766 3:69731298-69731320 CTGATAAATCAGTTCAGGCTAGG + Intergenic
957141664 3:76367202-76367224 ATGTTAGATCAGATGATATTAGG - Intronic
957588106 3:82158645-82158667 CTGTGAAACCAGAAGAGACCAGG - Intergenic
958067358 3:88560540-88560562 CTGTTGAATTAGATGACACATGG - Intergenic
959421172 3:106130961-106130983 CTGCTATATCTGATGAGAATGGG - Intergenic
959957303 3:112253004-112253026 CTGGAAAATCTGAGGAGACTAGG + Intronic
960159653 3:114336416-114336438 CTGTTAAAACAGATCAGTTTTGG + Intergenic
963076854 3:141355260-141355282 CTCTAAAATCAGATTAAACTTGG + Intronic
967283351 3:187843885-187843907 CTGGTAGGTCAGATGAGGCTGGG - Intergenic
967637726 3:191823696-191823718 CTGTAAATTCATATGATACTGGG - Intergenic
967880637 3:194298878-194298900 CTGATACATCAGATGAGGCCTGG + Intergenic
971681193 4:29703362-29703384 CTGTTAGTTCAGATGAGAACTGG + Intergenic
972184994 4:36517915-36517937 CTGTAAATTCAGATAAGCCTGGG + Intergenic
974126645 4:57705344-57705366 CTTATAAATCAGATAAGATTGGG - Intergenic
974673438 4:65060150-65060172 CTGAGAAAGCAGGTGAGACTAGG + Intergenic
975110739 4:70623633-70623655 CTGTCAAATCAAATGATATTGGG + Intergenic
975421427 4:74168417-74168439 CTGATAAATCAGGTGACACGTGG - Intronic
975866892 4:78733025-78733047 CAGTTAAACCAGATGACAGTTGG - Intergenic
978075431 4:104523085-104523107 CTATTAAAAGAGATGAGATTGGG + Intergenic
979306930 4:119156384-119156406 CTTTAAAAACTGATGAGACTAGG + Intronic
980285905 4:130778227-130778249 CTGTTAAAACAGCAAAGACTTGG + Intergenic
981401976 4:144323535-144323557 CTTATAAACCAGAAGAGACTGGG + Intergenic
981556900 4:146004819-146004841 CTGTTAAATCACAGGAGAGCTGG + Intergenic
982484207 4:155948009-155948031 CTGATAAATCAGAACAGCCTTGG + Intronic
983098279 4:163592613-163592635 CTGTGAATTCAAATAAGACTTGG - Intronic
984541531 4:181042845-181042867 CTGTTAAATTATAAGTGACTTGG + Intergenic
985143284 4:186865144-186865166 CTGGGAAATCATCTGAGACTTGG + Intergenic
985670492 5:1204228-1204250 CTGTTAAGACACAGGAGACTCGG - Intronic
986363578 5:7006391-7006413 CTGTGAAATGAGAAAAGACTAGG - Intergenic
987669879 5:20992430-20992452 CTGACAAATCAGAAGAGATTAGG + Intergenic
988098761 5:26652166-26652188 CTTTTAAATCAGATTTGAATAGG - Intergenic
989232170 5:39099186-39099208 CTGTGGAATCAGGTGAGACTGGG + Intergenic
995299759 5:110565578-110565600 CTCTTTATTCAGATGGGACTTGG - Intronic
995462150 5:112414886-112414908 GTATTAAATTAGATGTGACTGGG - Intronic
1001287269 5:170433010-170433032 GTGTTAAATAGGAGGAGACTGGG + Intronic
1004001915 6:11603937-11603959 CTCTTAGATCAGATGAGAAAAGG + Intergenic
1008642040 6:53474137-53474159 CGCTTACTTCAGATGAGACTTGG - Intergenic
1009650128 6:66465291-66465313 CTGTCAAATCAGTTGACTCTTGG + Intergenic
1012041240 6:94206536-94206558 CTTTTAAATCTAATTAGACTAGG - Intergenic
1012886383 6:104850674-104850696 GTTTTATATCAGATGAGAGTAGG - Intronic
1014280694 6:119440346-119440368 CTCTTAAATCAGTGGAGACAGGG + Intergenic
1014404073 6:121026541-121026563 CTGTTTAATGAAATGGGACTAGG + Intergenic
1014887614 6:126800794-126800816 TGGCTAAATCAGAAGAGACTGGG - Intergenic
1014893371 6:126870034-126870056 CTGTGAATGCAGATGATACTGGG - Intergenic
1016675775 6:146766193-146766215 CTGGTAGATCACTTGAGACTAGG + Intronic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1018168963 6:161128886-161128908 CTGTTAATTCAGGGGAGGCTGGG - Intergenic
1018335234 6:162779605-162779627 ATGTTATAACAGATGAGTCTTGG + Intronic
1019213075 6:170421953-170421975 CTCCTAAATCAGATCAGACCTGG - Intergenic
1019225677 6:170505620-170505642 CTTTTAAACCTGAAGAGACTGGG - Intergenic
1020836002 7:13151887-13151909 CTTTGAAATCAAATGAAACTTGG - Intergenic
1021175869 7:17449359-17449381 CTGGAAAATCTGATGTGACTAGG - Intergenic
1024445550 7:49473910-49473932 CAGTTATAACATATGAGACTGGG + Intergenic
1026651911 7:72223082-72223104 CTGTTAAAGCAGTTGGCACTGGG + Intronic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1029410908 7:100409986-100410008 CAGGTAAATCAGTTGAGATTTGG - Intronic
1033458594 7:141525071-141525093 TTGTCAAATCAGATGACTCTTGG + Intergenic
1034015494 7:147580409-147580431 CTGTAAAACTAGATGTGACTAGG - Intronic
1041283746 8:56238606-56238628 CTCTCAAATCAGATTAGATTGGG - Intergenic
1042121353 8:65491812-65491834 CTGCTAAGTCATATCAGACTGGG - Intergenic
1044560717 8:93609290-93609312 CTGTTGAAGAAGTTGAGACTTGG - Intergenic
1044636490 8:94330365-94330387 CTGTTAAATCAAACTAAACTTGG + Intergenic
1045209004 8:100075297-100075319 CTGTTAGTTCAGGTGAGACCTGG + Intronic
1045337243 8:101217603-101217625 ATGTTAAATTTGTTGAGACTTGG - Intergenic
1047183354 8:122610168-122610190 GTGTTTAGTGAGATGAGACTGGG + Intergenic
1047609558 8:126507857-126507879 CTTTGAAATCAAAGGAGACTTGG - Intergenic
1051421723 9:16895623-16895645 ATGTCAAATCAGAAGACACTTGG + Intergenic
1051433840 9:17009214-17009236 CTGTGAAATCAGATAAGAATCGG - Intergenic
1054913560 9:70476006-70476028 CTATTTAATAAGATGTGACTGGG + Intergenic
1055224991 9:73984839-73984861 CTGTAAAATCTGAAGTGACTAGG + Intergenic
1055951442 9:81733326-81733348 CGGTCCAATCAGATGACACTGGG - Intergenic
1058287054 9:103191211-103191233 ATGTTAAATCAGCTGATACATGG - Intergenic
1059679766 9:116574764-116574786 CTGATACATCTGATGAAACTGGG - Intronic
1188550069 X:31353880-31353902 CTATTAATTCAGAAGAGATTGGG - Intronic
1192604223 X:72497532-72497554 CTGATAAATCAGAAAAGACATGG - Intronic
1196321391 X:114344566-114344588 CTGTTAGAATAGCTGAGACTGGG - Intergenic
1197130040 X:122994828-122994850 CTGGTAAATCAGATGGGTCAGGG - Intergenic
1198913355 X:141638238-141638260 CTGTGAAAGCAGCTGAGAGTGGG - Intronic
1200752797 Y:6962275-6962297 CCATGAAATCAGATGATACTAGG + Intronic