ID: 1103739038

View in Genome Browser
Species Human (GRCh38)
Location 12:123078839-123078861
Sequence GCTGAAGCCAGTATCGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 63}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103739038_1103739042 0 Left 1103739038 12:123078839-123078861 CCAGCTTCGATACTGGCTTCAGC 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1103739042 12:123078862-123078884 CACCTGGCCCCACTCATACTGGG 0: 1
1: 0
2: 0
3: 15
4: 164
1103739038_1103739041 -1 Left 1103739038 12:123078839-123078861 CCAGCTTCGATACTGGCTTCAGC 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1103739041 12:123078861-123078883 CCACCTGGCCCCACTCATACTGG 0: 1
1: 0
2: 0
3: 15
4: 158
1103739038_1103739048 14 Left 1103739038 12:123078839-123078861 CCAGCTTCGATACTGGCTTCAGC 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1103739048 12:123078876-123078898 CATACTGGGAGCAGCGAAATGGG 0: 1
1: 0
2: 0
3: 2
4: 81
1103739038_1103739050 19 Left 1103739038 12:123078839-123078861 CCAGCTTCGATACTGGCTTCAGC 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1103739050 12:123078881-123078903 TGGGAGCAGCGAAATGGGGCTGG 0: 1
1: 0
2: 3
3: 32
4: 209
1103739038_1103739051 20 Left 1103739038 12:123078839-123078861 CCAGCTTCGATACTGGCTTCAGC 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1103739051 12:123078882-123078904 GGGAGCAGCGAAATGGGGCTGGG 0: 1
1: 0
2: 3
3: 20
4: 295
1103739038_1103739049 15 Left 1103739038 12:123078839-123078861 CCAGCTTCGATACTGGCTTCAGC 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1103739049 12:123078877-123078899 ATACTGGGAGCAGCGAAATGGGG 0: 1
1: 0
2: 1
3: 13
4: 113
1103739038_1103739047 13 Left 1103739038 12:123078839-123078861 CCAGCTTCGATACTGGCTTCAGC 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1103739047 12:123078875-123078897 TCATACTGGGAGCAGCGAAATGG 0: 1
1: 0
2: 0
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103739038 Original CRISPR GCTGAAGCCAGTATCGAAGC TGG (reversed) Intronic
901433244 1:9231007-9231029 GCTGAAGCCAGCAAGGAAACGGG + Intergenic
903066080 1:20700373-20700395 GCTGTAGCCAGTTTTGAAGGTGG + Intronic
907993962 1:59610616-59610638 GATGAACCCAGTATCTCAGCTGG - Intronic
1063921380 10:10936739-10936761 GCTGAAACAAGTGTCGATGCTGG + Intergenic
1069298525 10:66877434-66877456 GCTGGAGCCAGCATCAGAGCTGG - Intronic
1070847887 10:79538804-79538826 GGATAAGCCAGTATGGAAGCAGG + Intergenic
1070925894 10:80221339-80221361 GGATAAGCCAGTATGGAAGCAGG - Intergenic
1074602910 10:114933621-114933643 GTTGAAGGCAGCATGGAAGCTGG + Intergenic
1083414584 11:62517336-62517358 GCAGAGGCCAGCATCCAAGCTGG - Exonic
1087237301 11:95734301-95734323 GCAGAAGCCAGTTTCAAGGCAGG + Intergenic
1088431661 11:109765504-109765526 GATGAGGCCAGTATCTGAGCTGG - Intergenic
1091709979 12:2732796-2732818 GCTGAAGGCAGCATGGAGGCTGG - Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1097970454 12:65627693-65627715 GCAGAAGCCAGTCTCCAAGATGG - Intergenic
1101556302 12:105813139-105813161 CCTGAAGCCTGTTACGAAGCTGG + Intergenic
1103739038 12:123078839-123078861 GCTGAAGCCAGTATCGAAGCTGG - Intronic
1107086160 13:36430403-36430425 GCTGAAGCCAGTGTTGGAGTCGG - Intergenic
1118018991 14:61691577-61691599 GCTGAAGCTAGTTTCACAGCTGG - Intergenic
1121632091 14:95428836-95428858 GCTGAAGCCACTGACGTAGCTGG + Intronic
1123831903 15:24147936-24147958 GCTGAAGTCAGTAAAGAAGATGG - Intergenic
1124119835 15:26879704-26879726 GCTGAGGTCAGAATCGATGCAGG - Intronic
1125534072 15:40432923-40432945 ACTGATTCCAGTATGGAAGCAGG + Intronic
1130412030 15:83655070-83655092 GCTGAAACCAGGAGGGAAGCGGG - Intronic
1137512376 16:49113001-49113023 GCTGCAGCCAGCAAGGAAGCAGG - Intergenic
1142813009 17:2404571-2404593 GGTGGAGCCAGGATAGAAGCTGG + Intergenic
1145006670 17:19342445-19342467 GCTGAGGGCAGTATCTAGGCTGG + Intronic
1150807190 17:68328802-68328824 GAGGAAGCCAGTGTCGATGCAGG + Intronic
1156897373 18:42261530-42261552 GGTGAAGCCAGTAGCAAAGTAGG - Intergenic
1156992195 18:43422692-43422714 GCTGTTGACAGTATCGCAGCTGG + Intergenic
1157110118 18:44812751-44812773 GATGAAGCCAATATGTAAGCTGG + Intronic
1161759361 19:6159936-6159958 GCAGAAGCCCGTATAGCAGCTGG - Intronic
1163530165 19:17844130-17844152 GCAGAAGTCAGCATCGGAGCTGG - Intronic
927132840 2:20074990-20075012 GCTGAAGGCAGGATGGAGGCAGG - Intergenic
928442346 2:31302964-31302986 CCTGAAGCCAGAATCGGAGTAGG - Intergenic
932194036 2:69767319-69767341 TCTGAATCCAGTGTCGAAACAGG - Intronic
938551414 2:132385854-132385876 GCTGAAACCAGTGACAAAGCAGG + Intergenic
942556948 2:177181475-177181497 GCTGAAGCCAGCTTGGAAACTGG - Intergenic
948867330 2:240782632-240782654 GCTGAGGCCCGGAGCGAAGCTGG + Intronic
948877520 2:240837557-240837579 GCTGAAGCCAGAATAGAATCTGG - Intergenic
1178829359 21:36042490-36042512 CATGAAGCCAATCTCGAAGCTGG + Intronic
955571110 3:60307722-60307744 GCTGAAGCCAGTGTTGACCCTGG + Intronic
960054654 3:113268474-113268496 GCTGAGGCCAGAAGGGAAGCTGG + Intronic
962737520 3:138339064-138339086 GCTGAAGCCAGAGTCGCAGCAGG + Intergenic
970905397 4:21210280-21210302 GCCAAAGCCAGTATGGAAGGAGG + Intronic
976443707 4:85106487-85106509 TATGAAGCCAGTTTAGAAGCAGG - Intergenic
978633614 4:110777634-110777656 GCTGAAGCTAGTCACTAAGCAGG + Intergenic
985572697 5:658249-658271 GCTGCAGCCAGTGTCCAAGCAGG + Intronic
990799109 5:59579607-59579629 GCTGGAGCCCGTATCAAAGCAGG + Intronic
993917503 5:93761160-93761182 GCTGAACCCAGTATCTCAGTTGG - Intronic
999421382 5:151447679-151447701 GCTGAAGCCAGAGCCGGAGCCGG + Exonic
1006773028 6:36569563-36569585 CCTGAAACCAGTATTGATGCAGG + Intergenic
1010733912 6:79420581-79420603 TCTGAAGCCACTATTAAAGCGGG - Intergenic
1011178568 6:84592833-84592855 GCTTAAGACAGTATTGTAGCTGG + Intergenic
1020481587 7:8668901-8668923 GCTGAAGCCAGATTCGACTCTGG + Intronic
1020781249 7:12519049-12519071 GCTGAAGCCACTACTGCAGCAGG - Intergenic
1029652170 7:101901123-101901145 GCTGAATCCAGGATGGAACCTGG + Intronic
1030046907 7:105505461-105505483 GCTGAAGCCAGAATCTGACCTGG + Intronic
1037128267 8:15376403-15376425 GCTGATTCCAGGATGGAAGCAGG - Intergenic
1044434855 8:92150282-92150304 GATGAAGCCAATATCAAAGTAGG - Intergenic
1046489585 8:114932691-114932713 GGTGAATACAGTATTGAAGCTGG - Intergenic
1050826007 9:9946644-9946666 CCAGAAGCCAGTGTCGATGCAGG - Intronic
1057497619 9:95573238-95573260 GCTGAGGCCAGAATGGAAACAGG + Intergenic
1059243203 9:112826285-112826307 ACTGAAGGCAGTATCACAGCTGG + Intronic
1059460123 9:114424300-114424322 GCTGAAGCCAGTTGGGAGGCAGG + Intronic
1061291263 9:129651474-129651496 GCTGAAGCCAGCTTTGAAGCAGG - Intergenic
1185633614 X:1535587-1535609 GCTGAAGCCCGTGGGGAAGCAGG - Intronic
1187697206 X:21934485-21934507 GCTGAAGAAGGTATCAAAGCAGG + Intergenic
1193486542 X:82090998-82091020 ACTGAAGCAAGTATCAGAGCAGG - Intergenic
1196217496 X:113071312-113071334 CCTGAAGCCAGTATAGTAGTGGG + Intergenic