ID: 1103741490

View in Genome Browser
Species Human (GRCh38)
Location 12:123094551-123094573
Sequence CAGAGTTGGAGGCAGCTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 145}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103741490_1103741494 -9 Left 1103741490 12:123094551-123094573 CCAAATAGCTGCCTCCAACTCTG 0: 1
1: 0
2: 1
3: 13
4: 145
Right 1103741494 12:123094565-123094587 CCAACTCTGGCCATAAAGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 112
1103741490_1103741496 -1 Left 1103741490 12:123094551-123094573 CCAAATAGCTGCCTCCAACTCTG 0: 1
1: 0
2: 1
3: 13
4: 145
Right 1103741496 12:123094573-123094595 GGCCATAAAGCCAGGAACTTGGG 0: 1
1: 0
2: 3
3: 15
4: 190
1103741490_1103741500 13 Left 1103741490 12:123094551-123094573 CCAAATAGCTGCCTCCAACTCTG 0: 1
1: 0
2: 1
3: 13
4: 145
Right 1103741500 12:123094587-123094609 GAACTTGGGAAGCTGGTAATTGG 0: 1
1: 0
2: 1
3: 13
4: 155
1103741490_1103741495 -2 Left 1103741490 12:123094551-123094573 CCAAATAGCTGCCTCCAACTCTG 0: 1
1: 0
2: 1
3: 13
4: 145
Right 1103741495 12:123094572-123094594 TGGCCATAAAGCCAGGAACTTGG 0: 1
1: 0
2: 2
3: 9
4: 210
1103741490_1103741498 6 Left 1103741490 12:123094551-123094573 CCAAATAGCTGCCTCCAACTCTG 0: 1
1: 0
2: 1
3: 13
4: 145
Right 1103741498 12:123094580-123094602 AAGCCAGGAACTTGGGAAGCTGG 0: 1
1: 0
2: 3
3: 34
4: 469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103741490 Original CRISPR CAGAGTTGGAGGCAGCTATT TGG (reversed) Intronic
900175667 1:1290395-1290417 CAGAGTGGGAGGCAGCGAGCAGG - Intronic
900693655 1:3996760-3996782 CAGAGGTGGAGGCAGGGATTGGG - Intergenic
900794330 1:4698919-4698941 CAGGGTTGCAGGCAGCTAAGGGG + Intronic
901570550 1:10156586-10156608 CAGAATTGGGTGCAGATATTGGG + Intronic
902227502 1:15005965-15005987 CAGATGTGCAGGCAGCTCTTAGG + Intronic
905304239 1:37006544-37006566 GAGAGGAGGAGGCAGCTAATGGG + Intronic
905814040 1:40934108-40934130 CTGAGTTGGAGGCTGCAAATGGG + Intergenic
909284603 1:73799175-73799197 CAGAGTAGAACACAGCTATTAGG - Intergenic
915281584 1:154826260-154826282 CATGGATGGAGGCAGCTCTTAGG - Intronic
916275781 1:162991663-162991685 CAGAGCTGGAGGGGGCTGTTTGG + Intergenic
917638872 1:176962826-176962848 CAGGGTTGGAGACTGCTTTTTGG + Intronic
917783819 1:178429959-178429981 CAGAGTTGGACTCAGGTAGTTGG - Intronic
920493155 1:206434447-206434469 CAGACTTGGACTAAGCTATTTGG - Intronic
922774561 1:228208755-228208777 CAGAGTGGGAGGCAGCTCCCAGG - Intronic
924102766 1:240621537-240621559 CAGAGTTGGATGCTAATATTAGG - Intergenic
924470164 1:244336311-244336333 CATGGTTGGAGGCAGCCATGGGG + Intergenic
1065271256 10:24036100-24036122 CAGTGAAGGAGGCAGCTGTTGGG - Intronic
1067444116 10:46329905-46329927 CTGGGTTGAAGGCAGCTCTTTGG - Exonic
1068512754 10:57986734-57986756 CTGAGTTGGAGGTGGCAATTTGG - Intergenic
1070638744 10:78150507-78150529 CAGAGCCTGAGGCAGGTATTTGG + Intergenic
1070962285 10:80507455-80507477 CAGAGCAGGTGGCAGCTCTTAGG + Intronic
1075944107 10:126417776-126417798 CAGAGCTGGAGGAAGCTGTCTGG + Intergenic
1076206847 10:128610582-128610604 CAGAGCTGCAGCCAGATATTTGG - Intergenic
1076325331 10:129616373-129616395 CAGAGCAGGAGGCAGCCATGTGG + Intronic
1078648699 11:13167131-13167153 CAGAGGTGGGGGGACCTATTAGG - Intergenic
1078682222 11:13487514-13487536 CAGAGTTGTATGCAGCTGGTGGG - Intergenic
1079368789 11:19832411-19832433 CAGAGTCTGAGGCAGCTGCTCGG - Intronic
1079379341 11:19923511-19923533 CTGATTTGGAGGCTCCTATTTGG + Intronic
1081355932 11:42113677-42113699 CAGAGGTGGAGGGAGAGATTAGG - Intergenic
1081488668 11:43550033-43550055 GAGAGTTGGAGGCAGGAAGTGGG + Intergenic
1083291244 11:61691483-61691505 CACAGTTGGAGGCAGGAAGTGGG - Intronic
1084144599 11:67257843-67257865 CAGAGAAGGAGGAAGCTAGTTGG + Exonic
1084463557 11:69309286-69309308 CAGGGGTGGTGGCAGCTATCTGG + Intronic
1090212709 11:124934042-124934064 CAGGGTTGGAGAGAGGTATTTGG - Intronic
1094485966 12:30926434-30926456 CAGAGTCCGAGGCAGCTGTGCGG - Intronic
1096166380 12:49428824-49428846 AGGGATTGGAGGCAGCTATTAGG - Intronic
1102282104 12:111626594-111626616 CATAATTGAAGGCAGCAATTGGG - Intergenic
1103741490 12:123094551-123094573 CAGAGTTGGAGGCAGCTATTTGG - Intronic
1106331149 13:28740646-28740668 CAGGGTTGGAGCCAGGTAATGGG + Intergenic
1107204908 13:37772736-37772758 CCATGTTGGAGGCAGTTATTTGG - Intronic
1116104186 14:40477693-40477715 CAGAGCAGGAGGCAGCTTCTGGG + Intergenic
1118248181 14:64132424-64132446 CAGAGTTTGTTGCAGGTATTTGG + Exonic
1120153892 14:81069588-81069610 CAGAGGTTTAGGCATCTATTAGG + Intronic
1126657642 15:50996478-50996500 CAGAGTTGGAAGAAGGTGTTGGG + Intronic
1129229982 15:74191741-74191763 GAGAGTTGGAGACAGATCTTAGG - Intronic
1135100800 16:19603627-19603649 CAGGGTTGGAGGCAGTGATCTGG + Intronic
1135472236 16:22741569-22741591 CTGGTTTGGAGGCAGCTGTTGGG + Intergenic
1141896829 16:86963691-86963713 CAGAGATGGAGGCAGAGATTGGG - Intergenic
1142372857 16:89692533-89692555 CAGAGTTGGAAGCACAAATTCGG + Intronic
1142622450 17:1173486-1173508 CAGCGTTGGCGGCAGCTGTTTGG - Intronic
1143399787 17:6636827-6636849 CAGAGTGAGAGGGAGCAATTTGG - Intronic
1144511398 17:15880405-15880427 CAGAGTTGGAGGCAGGGTCTGGG + Intergenic
1145175557 17:20698123-20698145 CAGAGTTGGAGGCAGGGTCTGGG + Intergenic
1147015996 17:37491440-37491462 CAGAGCTGGAGGCAGGAATAGGG - Intronic
1149723559 17:58869345-58869367 CAGCGTTGGAGGGACCTAGTGGG + Intronic
1150105003 17:62456199-62456221 CAGGGTAGGAAGAAGCTATTCGG - Intergenic
1150437293 17:65164057-65164079 AAGAGCTGGATGCAGATATTGGG + Intronic
1151399646 17:73847733-73847755 CAGAGTTGGCTGCTGCAATTAGG - Intergenic
1151772697 17:76175428-76175450 CAAAGTTGGAGTCAGCTTTGTGG - Intronic
1152564992 17:81096404-81096426 CTGCTTTGGAGGGAGCTATTCGG - Intronic
1153225010 18:2893207-2893229 CAGAGTTGGGGTCAGATTTTTGG + Intronic
1155453416 18:25986514-25986536 CTGAGCTGGAGGCAGACATTTGG - Intergenic
1156899225 18:42281375-42281397 CTGTTTTGGAGGCAGCTTTTTGG + Intergenic
1158866097 18:61638960-61638982 CAGAGTGTGAGGCAGCTAGGAGG + Intergenic
1159544888 18:69827086-69827108 CAGAGTTGAAAGCAGCTACTTGG + Intronic
1161425091 19:4198673-4198695 CAGAGGTTGGGGCAGCTTTTGGG + Intronic
1165403799 19:35618129-35618151 CAGAGCGGGAGGCAGAGATTCGG + Exonic
1165476184 19:36032387-36032409 CAGAGTTGGGGGCAGCCTTCAGG + Exonic
1166202763 19:41249149-41249171 CAGAGTTAGAGGCTGCTCTGTGG + Intronic
1167797105 19:51716681-51716703 CAGAGTTGGAGCCAGGTTTGAGG - Intronic
1168009743 19:53520847-53520869 CAGAGTTGGAAGCGGCTGTCAGG - Intergenic
1168607369 19:57770562-57770584 CAGAGTTGAAGGCAGTGATGAGG + Intronic
926742730 2:16125917-16125939 CAGGGCTGGAGGCAGCCTTTAGG - Intergenic
931127619 2:59295362-59295384 CAGAGTGTGAGCCAGCTATAAGG + Intergenic
933283663 2:80360340-80360362 GAGAGATGGAGGTAGCTATTAGG + Intronic
940827411 2:158428435-158428457 CAGATTTGGAGGCAGGTGTCAGG + Intronic
943878893 2:193113052-193113074 CAGAGTGGGAGGAAGTTATTTGG - Intergenic
944685493 2:202113794-202113816 CAGAGGTGGAGACGGCTAATTGG + Intronic
946052339 2:216873930-216873952 GACAGGAGGAGGCAGCTATTGGG + Intergenic
948254397 2:236555554-236555576 CAGAGCTGAAGGCAGCTTTTAGG - Intergenic
1169008048 20:2225399-2225421 GAGATTTGGAGCCAGATATTCGG + Intergenic
1169957656 20:11123727-11123749 CAGAGTTGGTGGTAGCAATGAGG - Intergenic
1173552258 20:43940672-43940694 CAGAGGATGAGGCAGCTATCAGG + Intronic
1174515889 20:51092199-51092221 CAAACCTGGAGGCAGCTGTTTGG + Intergenic
1175603382 20:60293064-60293086 CAGAGTAGGGGGCAGCTGTAGGG + Intergenic
1182432132 22:30305588-30305610 CAGAGTCGGAGGCAGCTCAGAGG + Intronic
1184669901 22:46007077-46007099 CCGAGTTGGAGGCAGCCACTCGG - Intergenic
1184757200 22:46523756-46523778 CAGAGCTGGAGGCTCTTATTTGG - Intronic
1185367062 22:50441616-50441638 GAGAGTTGGAGGCAGCTTGCAGG + Intronic
949505733 3:4725538-4725560 CGGAGCTGGAGGAAGCTAATTGG - Exonic
965592239 3:170372634-170372656 AAGAGTTGTTGGCAGCTATCTGG + Intronic
966890677 3:184405508-184405530 CAGAGGTGCAGGCAGGGATTGGG - Intronic
966982543 3:185152245-185152267 CTGAGTTGGCGACAGCTGTTGGG - Intronic
967551158 3:190797082-190797104 CAGGGTTGGAGGTAGCTCTGTGG + Intergenic
967650936 3:191985802-191985824 CAGAGTTGAGGGCAGGTAGTAGG - Intergenic
967959435 3:194908677-194908699 CAGAGCTGGAGGGAGCTCTGGGG - Intergenic
968207876 3:196820678-196820700 CAGAGTTAGGGGCAGAGATTAGG - Intronic
968488946 4:879806-879828 CTGAGGTGGAGGCAGCTCTTGGG + Intronic
969423316 4:7109618-7109640 GGAAGTTGGAGGCAGCTATCAGG + Intergenic
970570042 4:17371089-17371111 CAGTGTTGGGGGCAGCTCGTGGG + Intergenic
971151969 4:24043053-24043075 CAATTTTGTAGGCAGCTATTTGG + Intergenic
971340296 4:25762598-25762620 CAGAATATGGGGCAGCTATTAGG + Intronic
971355642 4:25892957-25892979 CACAGCTGGAGGCAGCTGGTAGG - Intronic
976007447 4:80446703-80446725 TAGAGTTGGTGGCAGAAATTTGG - Intronic
978224292 4:106315919-106315941 CAGACTCAGAGGCAGGTATTTGG - Intronic
978284645 4:107061770-107061792 CAGAGTGGGAGGTAGCTCTGTGG - Intronic
981135329 4:141204632-141204654 CAGAGCTGGAAGCAGCATTTGGG + Intronic
982509151 4:156259210-156259232 CAGAGTTGGAAGAATTTATTAGG + Intergenic
986735248 5:10663253-10663275 CAGAGTTGGAGGCCACTAAAAGG + Intergenic
987065211 5:14283302-14283324 CAGATTTGAAGGCAGCCCTTCGG + Intronic
987208646 5:15655366-15655388 CACACTTGTAGGCAGCTACTTGG + Intronic
987238629 5:15969496-15969518 CAGAATTGGAGCCAGCCACTTGG - Intergenic
988427691 5:31082700-31082722 CAGAGTTGGGGGCAGCTTTATGG - Intergenic
989554899 5:42782518-42782540 CTGTGGTGGAGGCAGCAATTGGG + Intronic
992411913 5:76513566-76513588 AAGAGTTAGTGGAAGCTATTGGG + Intronic
993930718 5:93935373-93935395 CAGAGTTGAAGGTAGATTTTGGG + Intronic
994108150 5:95969356-95969378 CACTGTTGTAGGCAGTTATTGGG + Intergenic
994108243 5:95970254-95970276 CACTGTTGTAGGCAGTTATTGGG + Intergenic
995288414 5:110419200-110419222 CAAAGATGGAGGAAGGTATTTGG + Intronic
997648011 5:135493977-135493999 CAGAGTTGCTGGCAGCTGTGAGG + Intergenic
1000004603 5:157171352-157171374 CATACTTTGAGGCAACTATTAGG + Intronic
1003586096 6:7390320-7390342 CAGAGTTGGGGATAGCGATTAGG + Intronic
1005214483 6:23509240-23509262 CAGGGATCCAGGCAGCTATTTGG + Intergenic
1005808032 6:29493486-29493508 CTGAGGTGGAGGCATCGATTGGG - Intergenic
1006743671 6:36326458-36326480 CAGAGCTGGAGGCAGCTGCAGGG + Intronic
1008802617 6:55388585-55388607 AAGTGTTGGAAGTAGCTATTAGG - Intronic
1008923152 6:56863671-56863693 TATTGTTGGAGGAAGCTATTAGG - Intronic
1010265289 6:73859089-73859111 CAGAGTGGGATGCAGCCCTTGGG + Intergenic
1014832864 6:126123285-126123307 TAGAGTTGGAGCCATCTTTTGGG + Intergenic
1015349696 6:132203294-132203316 CAGAGTTTGAAGCAGCAAATTGG + Intergenic
1024559398 7:50630556-50630578 CTGAGTTGGAAGCAGCTTTCAGG - Intronic
1026527641 7:71169222-71169244 AGGAGATCGAGGCAGCTATTAGG - Intronic
1027438148 7:78188753-78188775 CATAGCTACAGGCAGCTATTAGG - Intronic
1030607883 7:111657613-111657635 AAGAGTTGGTGGCAGCTATTTGG + Intergenic
1030908311 7:115213742-115213764 CAATGTTGGAGGCAGGTAGTTGG + Intergenic
1034746011 7:153524486-153524508 CAGGGTGGGAGGGAGCTTTTTGG + Intergenic
1035161254 7:156951485-156951507 CATGGTTGGAGGCAGCTGTGTGG + Intronic
1037882775 8:22580951-22580973 CACACTTGCAGGCAGCCATTTGG + Intronic
1041207717 8:55515072-55515094 AAGAGTTGGAGGAAGTTGTTGGG - Intronic
1042132932 8:65606912-65606934 CAGAGGTGGAGGGAGCTATGAGG - Intronic
1042612570 8:70614770-70614792 CTGAATTGGAGGCACCTATGGGG + Intronic
1048852660 8:138659580-138659602 GAGAGTGGGAGGCAGCTGTGCGG - Intronic
1049822466 8:144644381-144644403 CAGAGATGGAGGCGGCTATGAGG + Intergenic
1049833983 8:144721238-144721260 CACACTTGGAGGCAGGTATATGG + Exonic
1050518240 9:6468600-6468622 CAGAGTTTTTGGCAGATATTTGG + Intronic
1052794572 9:32911557-32911579 CAGAGTTGGAGGTATGGATTTGG - Intergenic
1060600683 9:124875506-124875528 CAGTGGTGGAGGCAGCTGTTGGG + Intronic
1062109458 9:134773989-134774011 CAGAGGTGGAGGCAGCACCTGGG + Intronic
1187806526 X:23127252-23127274 CAGGGTTGAAGGCAGATGTTCGG - Intergenic
1188091146 X:25967271-25967293 CAGAGTCTGATGCAGCCATTGGG - Intergenic
1188837276 X:34974124-34974146 CAGAGTTGGAGGATGCGAATGGG - Intergenic
1190406007 X:50088414-50088436 CAGAACTGGAGGCAGAAATTGGG - Intronic
1194026959 X:88764444-88764466 CACAGTTGGAGTAAGCTATAAGG - Intergenic
1195709691 X:107764262-107764284 CAGACTTGGTGGCAGGTACTGGG - Intronic
1196033941 X:111122485-111122507 CAGAGTTGGAGTGTGCTGTTAGG - Intronic
1198937772 X:141916811-141916833 CAGACTGGGAGGCAGCTGGTGGG - Intergenic
1198958792 X:142161647-142161669 CAGACTGGGAGGCAGCTGGTAGG + Intergenic
1198961279 X:142186053-142186075 CAGATTGGGAGGCAGCTGGTGGG + Intergenic
1199812199 X:151360677-151360699 GAGGTTTGGAGGCAGCTCTTGGG - Intergenic
1200276401 X:154737165-154737187 CTGAATTGGAGACAGCTACTTGG - Intronic