ID: 1103742274

View in Genome Browser
Species Human (GRCh38)
Location 12:123098891-123098913
Sequence CCTTCAGTACTCAAAGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 226}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103742274 Original CRISPR CCTTCAGTACTCAAAGTGCA TGG (reversed) Intronic
901546839 1:9964237-9964259 CCTACACTTCTCAAAGTGCTGGG - Intronic
905470603 1:38188861-38188883 CCTTCAGTCCTACAACTGCAGGG - Intergenic
905633757 1:39535030-39535052 CCTTCACTTCTCAAAGTGCTGGG - Intergenic
905817422 1:40962613-40962635 CCTTCACCTCTCAAAGTGCTGGG + Intergenic
906206353 1:43989094-43989116 CCTTGACTACCCAAAGTGCTGGG - Intronic
906337673 1:44948091-44948113 TCTATAGTCCTCAAAGTGCAAGG + Intronic
907562807 1:55406419-55406441 CCTCCAGGATTCAATGTGCAAGG - Intergenic
909921377 1:81384856-81384878 CCTTCTGTACTTAAAGTGAGTGG - Intronic
911658235 1:100469008-100469030 CCTTGACTTCCCAAAGTGCAGGG + Intronic
912739925 1:112184825-112184847 CATGCAGCACTCAAAGTGAAGGG - Intergenic
913555934 1:119967251-119967273 CCTTCCTTACTCAAAGAGTAAGG - Intronic
914430550 1:147617112-147617134 CCTTGAGTAGTCAAGATGCATGG - Intronic
915295712 1:154920100-154920122 CCTTGAGCTCTCAAAGTGCTGGG + Intergenic
915404985 1:155653218-155653240 CCTTCTGTAGTCAAAGTACCAGG - Intergenic
917878634 1:179311113-179311135 CCTCAGCTACTCAAAGTGCATGG - Intronic
920238411 1:204525679-204525701 CCTTGACTTCTCAAAGTGCTGGG - Intronic
923268312 1:232333334-232333356 CCTCCAGTGCCCACAGTGCATGG + Intergenic
923818297 1:237404911-237404933 CCTTCAGTCATAAAACTGCAAGG + Intronic
924352681 1:243133142-243133164 CATTCAGGACTTAAATTGCATGG + Intronic
924608439 1:245554706-245554728 CCTCCAGTATTCATACTGCATGG + Intronic
924773377 1:247096420-247096442 CCTTCAGTTTTCAGGGTGCAGGG - Intergenic
1063110216 10:3028990-3029012 TCTGCTTTACTCAAAGTGCAGGG + Intergenic
1065697549 10:28393720-28393742 CCTTCACTTCCCAAAGTGCTGGG + Intergenic
1066633835 10:37481753-37481775 CCTTAAGCTCCCAAAGTGCAGGG - Intergenic
1066652586 10:37671867-37671889 CCTTCACTTCCCAAAGTGCTAGG + Intergenic
1067227777 10:44386604-44386626 CCTTCAGTTCTTTAAGAGCAGGG - Intergenic
1067563189 10:47318418-47318440 CCTCCACTACACAAAGTGCTGGG - Intergenic
1068659797 10:59612225-59612247 GCCTCAGTCCCCAAAGTGCAAGG + Intergenic
1068660947 10:59622798-59622820 CCTTCAGTCCCCAAAGTTAATGG - Intergenic
1068815567 10:61306751-61306773 CCTTCTGTTCTCAATGTGCTAGG + Intergenic
1069169954 10:65214478-65214500 CCTCCTGTCCTGAAAGTGCAAGG + Intergenic
1069675947 10:70247846-70247868 CCTTCAGTGACCACAGTGCAGGG + Exonic
1070316193 10:75315107-75315129 CCTTGACTTCTCAAAGTGCTGGG - Intergenic
1072118188 10:92383517-92383539 CCTTGACCTCTCAAAGTGCAGGG + Intergenic
1075381257 10:122020500-122020522 GGTTCAGTACGCATAGTGCAGGG + Intronic
1078236838 11:9492746-9492768 CCTTCATAACTCACAGTGCTAGG - Intronic
1081494675 11:43596686-43596708 CCTTGACTTCTCAAAGTGCTGGG + Intronic
1082271338 11:50172471-50172493 CCTCCACTTCTCAAAGTGCTTGG + Intergenic
1086756675 11:90572637-90572659 GCTACAGTAACCAAAGTGCATGG - Intergenic
1090063324 11:123482346-123482368 GCTTCAGCCCTCAAAGTGCTGGG + Intergenic
1091072709 11:132583548-132583570 CCTTCGCTTCTCAAAGTGCTGGG + Intronic
1091635872 12:2196144-2196166 CCTTTTGTACTTAAAGTGGATGG + Intronic
1092882065 12:12894657-12894679 CCTTCACTTCCCAAAGTGCTGGG + Intronic
1095184288 12:39183762-39183784 CCTTCAGTACACATAATACATGG + Intergenic
1095622692 12:44277589-44277611 ACTTCAGTTCTATAAGTGCAAGG - Intronic
1097336355 12:58388130-58388152 CCCTCAGTCCTAAAACTGCAAGG - Intergenic
1097409260 12:59230256-59230278 CCTTCACTTCCCAAAGTGCTGGG - Intergenic
1097645141 12:62227137-62227159 CCACCAGAACACAAAGTGCAAGG - Intronic
1097809725 12:64005390-64005412 CCTTGGCTTCTCAAAGTGCAGGG - Intronic
1098385834 12:69917486-69917508 CCTACAGTACTTAAAGTTCTGGG - Intronic
1098551012 12:71761291-71761313 CCTGCACTTCTCAAAGTGCTGGG - Intronic
1100278202 12:93091857-93091879 CCTGCAGTTCTCAAAGAACAAGG + Intergenic
1101360852 12:104025457-104025479 CCTTGACTTCTCAAAGTGCTGGG + Intronic
1103742274 12:123098891-123098913 CCTTCAGTACTCAAAGTGCATGG - Intronic
1105325952 13:19370736-19370758 CCTTCAGTACTGAGACTGCTAGG - Intergenic
1105845154 13:24287411-24287433 CCTTGATTTCTCAAAGTGCTGGG + Intronic
1108207534 13:48106156-48106178 CCTTCACCTCTCAAAGTGCTGGG + Intergenic
1109560608 13:64044576-64044598 CCTTCAGCCCTCAAAGTGCTGGG - Intergenic
1110015413 13:70394173-70394195 CCTTTAGTACTGAGAGGGCATGG + Intergenic
1110708117 13:78618538-78618560 CCTTCAGTGATAAGAGTGCAGGG - Intronic
1111137999 13:84076242-84076264 CTATTATTACTCAAAGTGCAGGG + Intergenic
1111813824 13:93125439-93125461 CCTTGACTTCTCAAAGTGCTGGG + Intergenic
1113505780 13:110814791-110814813 TCTGCTTTACTCAAAGTGCACGG - Intergenic
1117429526 14:55641573-55641595 CTTTCAGTCCTCAAAGTGACAGG - Intronic
1118485876 14:66214161-66214183 CCTTCTGTTCCCAAAGTGGAAGG + Intergenic
1119121321 14:72080899-72080921 GCTACAGTAATCAAAATGCATGG - Intronic
1119155653 14:72407731-72407753 CCCCCAGTACTTGAAGTGCAAGG + Intronic
1119796823 14:77405993-77406015 CCCACAGTCTTCAAAGTGCACGG + Exonic
1122190627 14:100040028-100040050 CCTTGACTTCTCAAAGTGCTGGG + Intronic
1124138227 15:27054009-27054031 CCTGCCTTAGTCAAAGTGCAGGG - Intronic
1125369427 15:38955326-38955348 CCTTGGCTACTCAAAGTGCTGGG - Intergenic
1128508060 15:68292593-68292615 CCTTAGCTACTCATAGTGCATGG + Exonic
1130028791 15:80293741-80293763 CCTGCAACACTCAAGGTGCATGG - Intergenic
1131069337 15:89455605-89455627 CCTTCAGTCCTGTAAATGCAAGG - Intergenic
1132175291 15:99709309-99709331 CCTTAAGTACTCTTAGTACATGG - Intronic
1132975677 16:2710056-2710078 GCTTCAGGACCCAAACTGCAGGG - Intergenic
1133363973 16:5196518-5196540 CCTTCACCTCTCAAAGTGCTGGG - Intergenic
1133393473 16:5427798-5427820 CCTGCTGGACTCAAAGTCCACGG + Intergenic
1133965344 16:10527018-10527040 CCTTCACTTCCCAAAGTGCTGGG + Intergenic
1136522133 16:30803908-30803930 CCTTCGCTTCTCAAAGTGCTGGG + Intergenic
1137445360 16:48528287-48528309 CCCTCAGTACTCCAGCTGCAAGG - Intergenic
1138158241 16:54726339-54726361 CCTTCATTCCCCAAAGTGCTGGG - Intergenic
1139401730 16:66687413-66687435 CCTTCAGCTCCCAAAGTCCAAGG - Intronic
1140301183 16:73758811-73758833 CCTATAGAACTCAAAGTGCGAGG - Intergenic
1142713417 17:1735680-1735702 CCTGCAGTCCACAAAGCGCAGGG - Exonic
1143245230 17:5479068-5479090 CCTTCACCTCTCAAAGTGCTGGG + Intronic
1144507016 17:15840576-15840598 CCTTCAGTACTCACCCTGCAAGG + Intergenic
1145171141 17:20658177-20658199 CCTTCAGTACTCACCCTGCAAGG + Intergenic
1145757214 17:27401427-27401449 CCTTGACTTCTCAAAGTGCTGGG - Intergenic
1145901813 17:28494717-28494739 TGTTCAGTTCTCAAAGTCCAAGG + Intronic
1145943059 17:28753757-28753779 CCTTCACTTCCCAAAGTGCTGGG + Intergenic
1146140479 17:30363596-30363618 CCTTCACCTCTCAAAGTGCTGGG - Intergenic
1146994747 17:37309799-37309821 CCTTCACCTCTCAAAGTGCTGGG - Intronic
1147547796 17:41416481-41416503 CAATCAGTACTCCCAGTGCAGGG + Intergenic
1148256245 17:46134924-46134946 CTTTTAGTATTCAAAGTGTAGGG + Intronic
1151190317 17:72393470-72393492 CCTTCAGTCCTCAAAAGACAGGG + Intergenic
1153279979 18:3405756-3405778 CCTGCAGGACCCAATGTGCACGG + Intergenic
1154986471 18:21556002-21556024 CCTTGAGTTCCCAAAGTGCTGGG - Intronic
1155226562 18:23734411-23734433 CCTTCAGTACACATGGGGCATGG + Intronic
1155473900 18:26218862-26218884 CCTTAGCTACTCAAAGTGCTGGG + Intergenic
1156136404 18:34044842-34044864 CCTTCAAGACTGAAAGTGCATGG - Intronic
1156616134 18:38786440-38786462 ACTCCAGAAATCAAAGTGCAGGG - Intergenic
1156906126 18:42354050-42354072 CCTTGACTTCTCAAAGTGCTGGG + Intergenic
1157283529 18:46361685-46361707 CCTACCCTACTCAAGGTGCAGGG + Intronic
1157368830 18:47091436-47091458 GGTTCAAAACTCAAAGTGCAGGG + Intronic
1157877153 18:51284538-51284560 CCTTCACTTTTCAAAGTGCTGGG + Intergenic
1158724354 18:59955744-59955766 CCTTCACCTCTCAAAGTGCTAGG + Intergenic
1160016358 18:75143764-75143786 TCTTCAGTACATAAAGTGGAGGG + Intergenic
1162264147 19:9556798-9556820 CCTTCACCTCTCAAAGTGCTGGG - Intergenic
1164973557 19:32552940-32552962 CCTTCACCTCTCAAAGTGCTGGG - Intergenic
1166635475 19:44447758-44447780 CCTACAGGACTCAGAGTACAAGG + Intronic
1167056794 19:47116242-47116264 CCTAGAGTTCTCAAAGTGCTGGG - Intronic
1167452264 19:49578372-49578394 CCTTCACCTCCCAAAGTGCAAGG + Intronic
1167489943 19:49786790-49786812 CTCTCAGTCCTCAAAGTGCCCGG - Intronic
925503345 2:4531867-4531889 CCTTAAGTACTCAGAGATCACGG - Intergenic
927172622 2:20382811-20382833 CTTCCAGTCCTCAAAGTGCTGGG - Intergenic
927934129 2:27066007-27066029 GCTTCAGTTCCCAAAGTGCTGGG - Intronic
928648978 2:33385077-33385099 TCATCAGAACTCAAAGTACAGGG - Intronic
929853193 2:45611649-45611671 TCTTCAGTACTCAGAGTCCCTGG - Intronic
931242965 2:60468643-60468665 CCTTCAGTACTTAAAAAGTAAGG + Intronic
932376358 2:71239430-71239452 CCTTAAGAACTCAATGAGCAAGG + Intergenic
932450867 2:71809999-71810021 CCTGCAGTATACAAAGTGCTGGG - Intergenic
934740382 2:96717287-96717309 CCTTCATTTCCCAAAGTGCTGGG - Intronic
934967391 2:98734364-98734386 CCTCCACTACCCAGAGTGCAGGG - Intergenic
936280331 2:111134499-111134521 CATTCAGTGCTCAATGTACATGG - Intronic
939861856 2:147430189-147430211 ACTGTAGTACTCAAAGTCCATGG + Intergenic
940767097 2:157801289-157801311 CCTTCAGAACTACAAGTACATGG - Intronic
941328411 2:164145346-164145368 CCTTCAGTATTGAAAGTGGAGGG - Intergenic
943797441 2:192014254-192014276 TCTTCAGTAATCAATGTGAACGG + Intronic
944353086 2:198753482-198753504 CCTTCTGTAGTCAAAGCCCATGG + Intergenic
944942544 2:204644288-204644310 ATTTTACTACTCAAAGTGCATGG + Intronic
947208211 2:227681928-227681950 CCTTCACCTCTCAAAGTGCTGGG + Intergenic
947450411 2:230203147-230203169 CCTTCAGTGGGCAAAGTGCAAGG + Intronic
1168834827 20:871197-871219 CCTTCAAGACTCAAAGGACATGG - Exonic
1169141904 20:3231227-3231249 CCTCCAGCCCCCAAAGTGCAAGG - Exonic
1170846295 20:19964650-19964672 ACTTCAGAACACAAAGGGCAGGG - Intronic
1172564586 20:35918974-35918996 CCTACAGTACTGAAAGGGCAAGG - Intronic
1173552143 20:43939936-43939958 CCTTCTGTAGTTAAAGGGCAGGG + Intronic
1176072530 20:63234614-63234636 CCTGCAGAAATCAAAGTGAAGGG - Intergenic
1178058482 21:28825798-28825820 ACTTCAGCACTGAAAGTGCAGGG + Intergenic
1179200506 21:39215118-39215140 CCTTCACTTCCCAAAGTGCTGGG + Intronic
1179399050 21:41067539-41067561 CATTCAGAACCCTAAGTGCATGG + Intergenic
1184346513 22:43916968-43916990 CCTTGACTTCTCAAAGTGCTGGG + Intergenic
1184517018 22:44968800-44968822 CCATCACTACTCAAAGTGTCAGG + Intronic
1184946583 22:47808332-47808354 CCTGGAGCAGTCAAAGTGCAGGG + Intergenic
954245995 3:49331880-49331902 CCTTGACTTCTCAAAGTGCTGGG - Intronic
957133620 3:76256046-76256068 CCTTCATCCCTCAAAGTGCTGGG - Intronic
958116865 3:89231972-89231994 CCTTCTTTCCTCCAAGTGCAGGG + Intronic
958978338 3:100691879-100691901 ACATCAGTACTCTGAGTGCAAGG + Intronic
961822345 3:129581527-129581549 CCATCAGTTCCCAAGGTGCATGG + Intronic
964851092 3:161097009-161097031 CCCTCACCACTCAAAGTGCATGG + Intronic
965578643 3:170244371-170244393 CCTTAAGAACTCAAAATGTAGGG + Intronic
965628229 3:170703791-170703813 CCTTCAGAGCTCAAAGAGAATGG + Intronic
967590920 3:191272912-191272934 CCTTGAGCTCTCAAAGTGCTGGG - Intronic
967775245 3:193379714-193379736 TCTTCCATAGTCAAAGTGCAAGG - Intergenic
968396113 4:240252-240274 CCTTGAGTTCCCAAAGTGCTGGG - Intergenic
968785865 4:2622002-2622024 CCTTCATTTCCCAAAGTGCTGGG - Intronic
969282955 4:6183538-6183560 ACTTCAGTACTCAGGGTGCTGGG + Intronic
970790236 4:19849580-19849602 CCTTCAGGACTCAAATACCAAGG + Intergenic
970838897 4:20443371-20443393 CCTTGAGGACTAAAAGTTCAAGG + Intronic
971170116 4:24225317-24225339 CCTTGGCTTCTCAAAGTGCAGGG - Intergenic
975114943 4:70670064-70670086 CATTCAGAACTCAATGGGCAAGG - Intronic
976551656 4:86403262-86403284 CCTTGACTTCTCAAAGTGCTAGG - Intronic
977675840 4:99745898-99745920 CCTTCACCTCTCAAAGTGCTGGG + Intergenic
979249268 4:118547379-118547401 CATTCAGGACTTAAATTGCATGG - Intergenic
979903476 4:126253879-126253901 CCATGAGTACCCAAAGTCCACGG - Intergenic
980286528 4:130785226-130785248 CCTTCAGTCCTACAACTGCAAGG - Intergenic
981369957 4:143948666-143948688 CCTTCAGCTCCCAAAGTGCTAGG + Intergenic
984387100 4:179074722-179074744 CTTTCATTTGTCAAAGTGCAGGG + Intergenic
984974909 4:185221737-185221759 CCCTCAGTCCTCATAGTGCCGGG + Intronic
985222119 4:187718077-187718099 CCTTCTGAACTCTAAATGCACGG - Intergenic
987405085 5:17517031-17517053 CCTTGATTTCTCAAAGTGAAGGG - Intergenic
987651371 5:20744610-20744632 CCTTCACTTCCCAAAGTGCTGGG - Intergenic
987841198 5:23224709-23224731 CCTACATTACACAAAATGCAGGG + Intergenic
987901650 5:24019958-24019980 TCTTCTTTACTCAAAGTCCATGG + Intronic
990245796 5:53862286-53862308 CCTTCAGTCCTCAGAGTATAGGG - Intergenic
991381795 5:66035841-66035863 CCTTGACTTCTCAAAGTGCTAGG - Intronic
991615688 5:68494840-68494862 CCTTCAGTCCTACAACTGCAAGG + Intergenic
991945534 5:71895176-71895198 CCTTCAGTTCTAAAACTCCAGGG - Intergenic
993159475 5:84270962-84270984 CCTACTGGATTCAAAGTGCAGGG + Intronic
993724861 5:91355688-91355710 CCTTCAGCTCTCACAATGCATGG - Intergenic
996144928 5:119962788-119962810 ACTACAGTACTCAAAGGGAAGGG - Intergenic
997071254 5:130625103-130625125 CCTTCTGTATTCAAGGTTCAAGG - Intergenic
998038063 5:138933227-138933249 CCTTCACTCCTCAGAGTGCTTGG + Intronic
998789835 5:145754134-145754156 TCTGCAGTACACAAATTGCAAGG - Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999874007 5:155782273-155782295 CCTTGACTTCTCAAAGTGCTGGG + Intergenic
1000156061 5:158552901-158552923 ACTGCTGTACTCAAAGGGCATGG - Intergenic
1002288456 5:178181481-178181503 CCTTCACTTCCCAAAGTGCTGGG - Intergenic
1002382362 5:178839929-178839951 CCTTGAGTTCCCAAAGTGCTGGG + Intergenic
1002648214 5:180672746-180672768 CCTTGAGTTCCCAAAGTGCTGGG - Intergenic
1004351982 6:14898129-14898151 CCTTCAGTCCCTAAAATGCAGGG - Intergenic
1006640016 6:35485040-35485062 GCTCCAGTACTCTTAGTGCATGG + Intronic
1008812090 6:55515002-55515024 CCTTGAGTTCCCAAAGTGCTGGG - Intronic
1008936926 6:57001411-57001433 CCTTGGGTTCTCAAAGTGCTGGG + Intronic
1012440438 6:99257283-99257305 CCTTCAGTACTACAAGGGCAAGG + Intergenic
1012508857 6:99979292-99979314 CCCTCAGTGAGCAAAGTGCAGGG - Intronic
1013750130 6:113396173-113396195 CCTTCAGTCACCAAATTGCAGGG - Intergenic
1013786006 6:113781802-113781824 CCTTCGCTTCTCAAAGTGCTGGG + Intergenic
1014513841 6:122357726-122357748 CCTTCACTTCCCAAAGTGCTAGG - Intergenic
1015038001 6:128680858-128680880 CCCTGAGTCCTCAAAGTCCATGG + Intergenic
1015357689 6:132298269-132298291 CCTCCACCACTCAAAGTGCTGGG + Intronic
1016044333 6:139465843-139465865 CCTTGAGTACTCAAACTTTAAGG + Intergenic
1017453245 6:154574371-154574393 CCTTGAGTTCCCAAAGTGCTGGG - Intergenic
1017489195 6:154929779-154929801 CCTTGACTTCTCAAAGTGCAGGG - Intronic
1024792144 7:52978591-52978613 CCTTCGGTTCCCAAAGTGCTAGG - Intergenic
1028462186 7:91106720-91106742 CCCTCAGTTCTCCAAGTGGATGG - Intronic
1029159059 7:98538821-98538843 CCTTGAGAAGTCAAACTGCAGGG + Intergenic
1030360677 7:108592258-108592280 CCATCACTACTCAAAGTAAATGG - Intergenic
1033311637 7:140265999-140266021 CCTTCACCTCTCAAAGTGCTGGG + Intergenic
1035631656 8:1111292-1111314 CCTTCAGCACACACAGTGCTGGG - Intergenic
1039346219 8:36708487-36708509 CCTTCACTACACAAATTGCAAGG + Intergenic
1039899000 8:41737047-41737069 GCTTCAGTTCCCAAAGTGCTGGG - Intronic
1041250992 8:55934800-55934822 CCCTCAATAGTCAAAGTGAATGG + Intronic
1041373678 8:57191175-57191197 CCCACAGCACTCACAGTGCATGG - Intergenic
1043376359 8:79654182-79654204 ATTACAGTGCTCAAAGTGCAGGG + Intronic
1044936867 8:97301821-97301843 CCTTCAGTTCTGAAAGGACAAGG - Intergenic
1045626072 8:104052440-104052462 GCTTCAGAACTCAAAGTGAAAGG + Intronic
1045780482 8:105857184-105857206 CCTTCACCTCTCAAAGTGCTGGG - Intergenic
1046490146 8:114941244-114941266 CCTTCATGACTCAATGTGCTTGG - Intergenic
1046538469 8:115547978-115548000 GCTTCAGCTCTCAAAGTGCTGGG - Intronic
1046822493 8:118649373-118649395 ACTTCAGTAATACAAGTGCAAGG + Intergenic
1050217807 9:3347571-3347593 CCTTCACTTCCCAAAGTGCTGGG - Intronic
1051144851 9:14016099-14016121 CCTTAGCTTCTCAAAGTGCAGGG - Intergenic
1051792297 9:20819462-20819484 CCTTGCGTTCTCAAAGTGCTGGG + Intronic
1053127078 9:35590757-35590779 CCTTGAGTCCCCAAAGTCCAAGG - Intergenic
1056454293 9:86745318-86745340 CCTTCAGTCATCAAAGCGGAGGG + Intergenic
1056506898 9:87266053-87266075 CCTTCAAGATTCAAAGTGCTGGG - Intergenic
1058436376 9:104967735-104967757 CCTTGAGCTCCCAAAGTGCAGGG - Intergenic
1061581587 9:131540422-131540444 CCTTGGCTACTCAAAGTGCTGGG - Intergenic
1186211252 X:7252814-7252836 CTTTCAAAACTCAAAGTGTATGG - Intronic
1186228819 X:7430383-7430405 CCTTCACTTCTCAAAGTGTTGGG + Intergenic
1187462318 X:19498683-19498705 CCTTCTGGACTCAAAGTGCCTGG + Intronic
1187732773 X:22272588-22272610 TCTTCAGTACTCAAAGAGAAAGG - Intergenic
1188677400 X:32959260-32959282 CATTCAGTGCGCAAAGTACAAGG + Intronic
1190479222 X:50859266-50859288 CCTCCACTTCTCAAAGTGCTAGG + Intergenic
1191819290 X:65285283-65285305 CCTTGAGTGCCCAAAGTCCATGG + Intergenic
1192788890 X:74360635-74360657 CCTCCACTACCCAAAGTGCTGGG - Intergenic
1193088008 X:77464881-77464903 CCCTCAGTCCCCAAAGTCCATGG - Intergenic
1195426058 X:104731728-104731750 CTTTCAGTAATCAATATGCAAGG + Intronic
1195454151 X:105049807-105049829 GATTCATTATTCAAAGTGCAAGG - Intronic
1195654644 X:107323466-107323488 CCTACAGTTGTCAAAGAGCACGG - Intergenic
1197984263 X:132250651-132250673 ACTTCAGTACTAAAACTTCAAGG + Intergenic