ID: 1103757935

View in Genome Browser
Species Human (GRCh38)
Location 12:123224574-123224596
Sequence TGCAGTGATCTCAATGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103757931_1103757935 1 Left 1103757931 12:123224550-123224572 CCTAAGTTTTAAATTTAAATATG 0: 1
1: 0
2: 10
3: 106
4: 988
Right 1103757935 12:123224574-123224596 TGCAGTGATCTCAATGGGGAAGG 0: 1
1: 0
2: 2
3: 11
4: 196
1103757929_1103757935 23 Left 1103757929 12:123224528-123224550 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1103757935 12:123224574-123224596 TGCAGTGATCTCAATGGGGAAGG 0: 1
1: 0
2: 2
3: 11
4: 196
1103757930_1103757935 22 Left 1103757930 12:123224529-123224551 CCAAAGTGCTGGGATTACAGGCC 0: 4832
1: 222861
2: 273207
3: 187102
4: 182881
Right 1103757935 12:123224574-123224596 TGCAGTGATCTCAATGGGGAAGG 0: 1
1: 0
2: 2
3: 11
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103757935 Original CRISPR TGCAGTGATCTCAATGGGGA AGG Intronic
901952714 1:12761392-12761414 TGCAGAGCTGGCAATGGGGAAGG + Exonic
905474704 1:38217822-38217844 GGCAGTGATCTCACTGGGGAGGG + Intergenic
905662813 1:39740401-39740423 GACAGTGATCTCGATGGAGAAGG + Intronic
906158270 1:43627150-43627172 TGCAGTCTTCTCAATGGTAAAGG - Intergenic
910959800 1:92749717-92749739 TTCTGTGCTCTAAATGGGGAGGG - Intronic
911355288 1:96810435-96810457 TGAAGTGATCTAAAGGGGAAGGG - Intronic
913532867 1:119745106-119745128 TGCAGTGAACTCAGAGGGGTTGG + Intergenic
915156610 1:153881908-153881930 TGCAGGGCTCTCAAGGGGGCTGG - Intronic
915214363 1:154329982-154330004 TGCAGTGGTCCCCAGGGGGAAGG + Intronic
915291897 1:154889912-154889934 TGAAGAGAACTCAATGAGGATGG + Intergenic
915638871 1:157205679-157205701 TGCAGTGACCACAATATGGATGG + Intergenic
916273466 1:162968611-162968633 TACAGTGAACTCAATGTGTATGG - Intergenic
919544138 1:198892317-198892339 TCCAGAGATTTCAATGGGGAGGG - Intergenic
921082387 1:211752662-211752684 TACAGTGATCTGATTGGGCAAGG - Intronic
921595241 1:217047507-217047529 TTGAGTGATGACAATGGGGATGG - Intronic
922212395 1:223496010-223496032 TGCTGTGATATCACTGTGGATGG + Intergenic
1063957513 10:11280671-11280693 TGCAGGGATGTCCATGGGGCAGG + Intronic
1065910829 10:30303905-30303927 TTCAGGTATCTCAATGTGGATGG + Intergenic
1066228121 10:33404474-33404496 GGCAGTGATCTCCAGGTGGAGGG - Intergenic
1066741495 10:38522618-38522640 TGGAATGGACTCAATGGGGATGG + Intergenic
1067702408 10:48583339-48583361 TGCAGTGATCCCCCTGGGGTAGG + Intronic
1068627856 10:59268693-59268715 TGCAGTGATTACAAGGAGGAAGG + Intronic
1071292429 10:84197325-84197347 TGGTGAGACCTCAATGGGGAAGG - Intronic
1075816054 10:125265521-125265543 TGGAGTCATCTGAATGCGGAGGG + Intergenic
1075990486 10:126834234-126834256 AGAAGTGCTCTCAGTGGGGAAGG - Intergenic
1077994661 11:7442787-7442809 TGCAGTGATGTCAATGGCCAGGG - Intronic
1080346268 11:31329199-31329221 TGGCTTCATCTCAATGGGGAAGG - Intronic
1081267835 11:41048818-41048840 TGCAGTGAAGCCAATGGGCATGG + Intronic
1081293909 11:41362139-41362161 AGGACAGATCTCAATGGGGAAGG + Intronic
1083873598 11:65507708-65507730 TGAAGTGATCTAATGGGGGATGG + Intergenic
1085865439 11:80285617-80285639 TGCATTGGTCTTAATGGGGCTGG + Intergenic
1086881004 11:92153131-92153153 TCCAGTAATGTCTATGGGGAAGG - Intergenic
1088078399 11:105879290-105879312 TGCATTGATCTCGATGGGAGTGG + Intronic
1090430507 11:126642233-126642255 TGCACTGGTCTCATTGGGGTTGG + Intronic
1091618222 12:2066181-2066203 TGCTGTGATCTGGATGGGAAGGG + Intronic
1091715589 12:2774123-2774145 TGCAGTCATCTCAGTGGGTTGGG - Intergenic
1093183607 12:15994905-15994927 TGCAGTAATCCCAAGAGGGAGGG + Intronic
1093344140 12:18019563-18019585 TGAAGTAATCTCAATGGGACTGG - Intergenic
1094304772 12:29006468-29006490 TGCAGTGATCTCCAAGAGAATGG + Intergenic
1094810557 12:34133712-34133734 TGCTGTGCTATCAATGAGGAAGG - Intergenic
1100121050 12:91369941-91369963 TCCATTCATCTCAATGGGAAAGG + Intergenic
1100180306 12:92078167-92078189 TGAAATGATCTTTATGGGGAAGG + Intronic
1100395254 12:94180510-94180532 GGCAGTGAACAAAATGGGGAAGG - Intronic
1100396439 12:94189953-94189975 TGTAATGATCACAATGAGGAGGG + Intronic
1101232797 12:102758249-102758271 TGCAGTGTCTTCAAGGGGGAAGG + Intergenic
1103757935 12:123224574-123224596 TGCAGTGATCTCAATGGGGAAGG + Intronic
1103830807 12:123777512-123777534 TGCAGGCAGCTCAGTGGGGAGGG - Intronic
1104383304 12:128327111-128327133 TGGAGTGATTTTAATGGGGCAGG + Intronic
1105531618 13:21225992-21226014 TGGAATGATCACAATGGCGACGG + Intergenic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1106736997 13:32597938-32597960 TGTTGTGATCTTAAGGGGGAAGG + Intronic
1108303682 13:49108334-49108356 TGCCGTGATCTCAAGGAAGAAGG + Intronic
1108356241 13:49630907-49630929 TGCAGTGCCCTCACTGGGGAGGG + Exonic
1109793096 13:67275460-67275482 TGCAGAGACCTCAGTGTGGAGGG + Intergenic
1110172152 13:72514225-72514247 TGCAGTGTTTTCTCTGGGGATGG - Intergenic
1112283204 13:98080765-98080787 TGCAGTGATGGGAATGGAGAGGG + Intergenic
1114380191 14:22194852-22194874 TACAGTGAAGGCAATGGGGACGG + Intergenic
1115569341 14:34652253-34652275 AACAGTGAACCCAATGGGGAGGG - Intergenic
1122693490 14:103542238-103542260 TCCAGTGCCCTCCATGGGGAGGG + Intergenic
1123129842 14:105976073-105976095 TGCTGTGATGTCCATGTGGAAGG - Intergenic
1202848894 14_GL000225v1_random:3340-3362 TGCACTGATCACCCTGGGGAGGG - Intergenic
1202850118 14_GL000225v1_random:11134-11156 TGCACTGATCACCCTGGGGAGGG - Intergenic
1202850622 14_GL000225v1_random:15778-15800 TGCACTGATCACCCTGGGGAGGG - Intergenic
1202853004 14_GL000225v1_random:32807-32829 TGCACTGATCACCCTGGGGAGGG - Intergenic
1202857770 14_GL000225v1_random:62170-62192 TGCACTGATCACCCTGGGGAGGG + Intergenic
1202859078 14_GL000225v1_random:70459-70481 TGCACTGATCACCCTGGGGAGGG + Intergenic
1202863367 14_GL000225v1_random:99307-99329 TGCACTGATCACCCTGGGGAGGG + Intergenic
1202864488 14_GL000225v1_random:106268-106290 TGCACTGATCACCCTGGGGATGG - Intergenic
1202866517 14_GL000225v1_random:122697-122719 TGCACTGATCACCCTGGGGAGGG + Intergenic
1202866969 14_GL000225v1_random:127028-127050 TGCACTGATCACCCTGGGGAGGG + Intergenic
1124044938 15:26140079-26140101 TCCAGTGGTTTCAATGGGAAGGG - Intergenic
1127453335 15:59137229-59137251 TTCAGTGTCCTCCATGGGGAAGG + Exonic
1130030809 15:80311832-80311854 TTCAGTGATCAAAATGAGGATGG - Intergenic
1132328209 15:100989562-100989584 TGCAGTGATATGAAGGTGGAGGG + Intronic
1133258660 16:4534410-4534432 TGCAGTGATCACAATGGGGCTGG + Intronic
1137350580 16:47710771-47710793 TACAGTGAACTAAATGGGGCAGG + Intergenic
1138658387 16:58503570-58503592 TGAACTGATCTGCATGGGGAAGG - Intronic
1140093702 16:71857442-71857464 TGCGGTGAGCTCAAGGGAGATGG + Intronic
1140289784 16:73642414-73642436 CTCAGTGACCTCCATGGGGAAGG + Intergenic
1141560965 16:84867539-84867561 TGCAATGATCTCAATGTACAGGG - Intronic
1143324611 17:6090625-6090647 TCCAGTGATGGCAATAGGGAAGG - Intronic
1143846419 17:9775615-9775637 TGTAGTAACCTCAATGGGAATGG - Intronic
1146061829 17:29611904-29611926 TGCAGTGATGGCAGTGGGGTTGG - Exonic
1146183807 17:30712274-30712296 TGCAGGCATCTCGGTGGGGAGGG + Intergenic
1150460867 17:65349604-65349626 TTCAGTAATCTCAATGGAAATGG + Intergenic
1152213600 17:79018809-79018831 TGCACGTATATCAATGGGGATGG - Intergenic
1152965493 18:110737-110759 TGCACTGATCACCCTGGGGAGGG + Intergenic
1152965504 18:110805-110827 TGCACTGATCACCCTGGGGAGGG + Intergenic
1153942828 18:9992088-9992110 TGTGGGGATCTCAGTGGGGAAGG - Intergenic
1154127156 18:11701797-11701819 TGCAGTGTTATCAAACGGGAAGG + Intronic
1156830844 18:41489127-41489149 TCCACTGATCTCAAAGGTGATGG - Intergenic
1157126302 18:44959686-44959708 TGCTGTGTTCTCAGTGGGGGAGG + Intronic
1158951443 18:62499157-62499179 GGCAGTGATCCCGTTGGGGAAGG - Intergenic
1159601075 18:70429393-70429415 TGGAGTGGTCAAAATGGGGATGG + Intergenic
1160347018 18:78140343-78140365 TGCAGGGAGGTGAATGGGGAAGG - Intergenic
1160384760 18:78488403-78488425 TGCAGTGATGTCAACTAGGAAGG - Intergenic
1164894867 19:31865603-31865625 TGCAATGAACACAATGGGCATGG - Intergenic
926706740 2:15842788-15842810 TGAAGTCATCTCCGTGGGGAGGG - Intergenic
927149236 2:20186239-20186261 TGCTGTGATCTCCAAGGGCAGGG + Intergenic
928097090 2:28411401-28411423 TGCAGAGATCTGCATGGAGAAGG - Intronic
929792187 2:45031490-45031512 CGCAGTGAGTTCAATGGGGTAGG - Intergenic
930212870 2:48661216-48661238 TGCAGTGAAAACAATGGGGAGGG - Intronic
932306866 2:70710141-70710163 TCCAGTGTACTCACTGGGGAAGG - Intronic
933232299 2:79822911-79822933 ATCATTGATCTGAATGGGGATGG - Intronic
933876089 2:86623278-86623300 TGCCGCGATCTCAAGGGGGAGGG + Exonic
937088204 2:119186100-119186122 TGCAGAGATCATCATGGGGAGGG - Intergenic
939235323 2:139485009-139485031 TGCATTGATCTCAGTGAGCAAGG - Intergenic
942128322 2:172849855-172849877 TGCTGTGCTTTCAATGGTGATGG + Intronic
942987564 2:182161362-182161384 TGGAATTATCTAAATGGGGATGG + Intronic
946464344 2:219898029-219898051 TGCAGTGGTATAAACGGGGATGG + Intergenic
946881487 2:224181324-224181346 TGAAGGGAGATCAATGGGGATGG + Intergenic
946981656 2:225223680-225223702 AGAAGAGATCTAAATGGGGATGG + Intergenic
947126417 2:226873579-226873601 TGCAGTGATGACTCTGGGGAAGG + Intronic
947439870 2:230109798-230109820 TGCACAGATCGCTATGGGGATGG + Intergenic
948659980 2:239501116-239501138 TCCAGTCAGCTTAATGGGGACGG - Intergenic
1169503886 20:6187494-6187516 TGCACTGATCTCAACAGGAACGG + Intergenic
1172628187 20:36360710-36360732 TGCAGTGCCCTCAGTGGGGCGGG + Intronic
1172780772 20:37435983-37436005 TGAAGTGATCGGAGTGGGGAGGG - Intergenic
1174539002 20:51274762-51274784 TGCTGTGTTCTCACTGGGGGTGG + Intergenic
1174906180 20:54554128-54554150 TGCAGTGATGTTGATGGTGATGG + Intronic
1175586869 20:60148087-60148109 TGCAGTGCTTTCCATGGGGTGGG - Intergenic
1176108180 20:63399247-63399269 TGCAGGGGTCTCACTGGGGATGG - Intergenic
1176429412 21:6566872-6566894 TGAAGTGATGTCACTGGGGTGGG + Intergenic
1178589356 21:33896284-33896306 AGCAGTGAGCTCAATGGTAAAGG - Exonic
1179655433 21:42841814-42841836 TGCAGCGAGCTGAATGGGGTGGG - Intergenic
1179704806 21:43174334-43174356 TGAAGTGATGTCACTGGGGTGGG + Intergenic
1179985710 21:44919380-44919402 TGCTGTGAGCTGGATGGGGAAGG + Intronic
1181347312 22:22229339-22229361 TGCAGTGTTCAGAGTGGGGATGG + Intergenic
1182040604 22:27236329-27236351 TGCAGTGAGGTGAATAGGGATGG + Intergenic
1182495690 22:30705773-30705795 TGCAGTGACCACAATGTGCAAGG + Intronic
1183121652 22:35734674-35734696 GGCAGTGAGCTCTGTGGGGAGGG - Intergenic
951762296 3:26160397-26160419 AGCGGTGAACCCAATGGGGAGGG + Intergenic
952297402 3:32073430-32073452 AACAGTGAACCCAATGGGGAGGG - Intronic
954948387 3:54446818-54446840 TGCAGAGAATTCAGTGGGGAGGG - Intronic
955094749 3:55786351-55786373 TGTAATGAGCTCAATGGGCATGG - Intronic
956616456 3:71177433-71177455 TTCAGGAAACTCAATGGGGAAGG + Intronic
959439141 3:106355223-106355245 TGGAGTAATTTCAATGGGAATGG + Intergenic
962271783 3:133982726-133982748 TGCAGTGATCTGAGGAGGGATGG - Intronic
963035283 3:141020350-141020372 TGATGTGACCTCAGTGGGGAAGG + Intergenic
963423525 3:145093552-145093574 TTCTGTGAACTCCATGGGGATGG - Intergenic
963496315 3:146066620-146066642 AGCAGTGGTCCCAATGTGGAGGG + Intergenic
963552241 3:146739175-146739197 TGTAGTGCTATCACTGGGGAAGG - Intergenic
966430284 3:179824997-179825019 TGCAGTGTTCTCATGGAGGATGG + Intronic
967868825 3:194212815-194212837 TCAAGTGGTCACAATGGGGAAGG - Intergenic
967933534 3:194708134-194708156 TGCAGTCATCTGCATGGGGCTGG + Intergenic
970307705 4:14750419-14750441 TGACATGATCTAAATGGGGAAGG + Intergenic
970819503 4:20196416-20196438 AACAGTGAACCCAATGGGGAGGG - Intergenic
971388551 4:26163749-26163771 TGCAGAGATTTCAATGGTAAAGG - Intronic
972731403 4:41798704-41798726 TTCAGTGATTTCAAGGGGGAAGG - Intergenic
975936292 4:79585287-79585309 GGCAGAAATCTCAAGGGGGACGG - Intergenic
980737075 4:136903638-136903660 TGCAGTGAGAGCTATGGGGAAGG + Intergenic
985788933 5:1915139-1915161 CGCATTGCTCTCACTGGGGAGGG + Intergenic
985926723 5:3024951-3024973 AGCAGTGTTCTCGCTGGGGAGGG + Intergenic
986082574 5:4409803-4409825 TGCTGTGACCTCAATGGATATGG + Intergenic
988701422 5:33678903-33678925 TGAAGTGATATAAATGGAGATGG + Intronic
991593157 5:68275609-68275631 TGTTTTGATCTCACTGGGGAAGG - Intronic
995613667 5:113937623-113937645 TTCAGTGCTCCCAATAGGGAAGG + Intergenic
997720916 5:136077871-136077893 TGTGGTGATCTTATTGGGGAGGG + Intergenic
997851429 5:137336339-137336361 AGCTGTGATCTGAAAGGGGATGG - Intronic
998917601 5:147032651-147032673 TGCAGTGATCTGGATGAGAATGG - Intronic
1002170944 5:177373893-177373915 TGCAAAGATTCCAATGGGGAAGG - Intergenic
1002904483 6:1437832-1437854 GGCAGTGATCTCAGTTGGGCAGG + Intergenic
1003860753 6:10319679-10319701 TGGAGTGTTTTCCATGGGGATGG + Intergenic
1004733303 6:18380212-18380234 TGCAGGTACCTCAAGGGGGAGGG - Intergenic
1006419645 6:33925102-33925124 TGCACTGAGTTCGATGGGGATGG - Intergenic
1007082913 6:39121352-39121374 AACAGTGAACCCAATGGGGAGGG - Intergenic
1008050965 6:46899795-46899817 AGCAGTGATGGCAATGGGGAGGG + Intronic
1008309189 6:49944230-49944252 TGCAGTGACATGAATGGAGATGG - Intergenic
1008522358 6:52374334-52374356 TGCAGTGATCCCAATGACAAAGG - Intronic
1010369639 6:75092593-75092615 TGCAGTGGTTTCCATGGGGATGG - Intronic
1012213565 6:96555213-96555235 TACTGTGATCTTAATGGGCAGGG + Exonic
1015021327 6:128479344-128479366 CGCAGTGATCTACATGAGGATGG - Intronic
1023081610 7:36532067-36532089 TGCAGAGTTTTCACTGGGGATGG - Intronic
1023748445 7:43345727-43345749 TGCAGTGATCTGGATGAGGCTGG - Intronic
1025030108 7:55549919-55549941 TGCAGTGACCATGATGGGGATGG - Intronic
1025785213 7:64637664-64637686 TGCAGTGCTCTCTGTGGGCAGGG + Intergenic
1026493302 7:70881649-70881671 GGCAGTGATCTGAACGGGGGAGG + Intergenic
1026878828 7:73895142-73895164 TGCACTGATGTCAGTGGGAATGG + Intergenic
1028704608 7:93825083-93825105 TGAAGTGACATCAATGGGAAAGG + Intronic
1030449797 7:109693480-109693502 TGTAGTGATCTTACTGGAGATGG - Intergenic
1036213533 8:6861673-6861695 TGCATTCATCTCAATGAGCAGGG - Intergenic
1042814739 8:72866001-72866023 TGGAGTGACCACAATGGGGCAGG - Intronic
1045370186 8:101515084-101515106 TGCAGTGATCCCTATAAGGAGGG - Intronic
1049027515 8:140005339-140005361 TGCTGAAATCTCTATGGGGAAGG + Intronic
1049642668 8:143722480-143722502 TGCTGTGACCTCAGAGGGGAGGG - Intergenic
1051677983 9:19577933-19577955 TGCAGTGATCTGAATGAGATTGG + Intronic
1052168533 9:25364286-25364308 TTCAGTGAACTGAATGGGGAAGG + Intergenic
1054707404 9:68477019-68477041 TGAAGTGATCCCACTGGGCAGGG + Intronic
1055160192 9:73117343-73117365 TGCAGTGATCACCATGGCAAGGG + Intergenic
1055197125 9:73609773-73609795 TACAGAGACCCCAATGGGGATGG + Intergenic
1056300209 9:85232431-85232453 TGCATTGATCACAATAGAGATGG - Intergenic
1057555161 9:96082339-96082361 TGCAGTGATGTGAATGTGGCTGG - Intergenic
1058998513 9:110323847-110323869 TCCAGTGATATCAAAGGAGAAGG + Intronic
1060050349 9:120374300-120374322 TGCTGTGCTGTCATTGGGGAAGG - Intergenic
1060583951 9:124774349-124774371 TTGACTGATCTCAATCGGGAGGG + Intergenic
1203737602 Un_GL000216v2:151547-151569 TGCACTGATCACCCTGGGGAGGG - Intergenic
1203737825 Un_GL000216v2:153597-153619 TGCACTGATCACCCTGGGGAGGG - Intergenic
1203738114 Un_GL000216v2:156332-156354 TGCACTGATCACCCTGGGGAGGG - Intergenic
1203740639 Un_GL000216v2:174564-174586 TGCACTGATCACCAAGGGGATGG - Intergenic
1186344767 X:8680643-8680665 AGCAGTGTTCTCAGTGTGGAAGG - Intronic
1186469968 X:9813501-9813523 TCCAGAGGTCTCATTGGGGAAGG + Intronic
1188200427 X:27289001-27289023 AACAGTGAACCCAATGGGGAGGG + Intergenic
1190093260 X:47458538-47458560 TGTTGTGATTTCAATTGGGATGG - Intronic
1195668678 X:107451489-107451511 TGCAGTGAGCTTCATGGGCAAGG - Intergenic
1198009240 X:132533865-132533887 TGCAGTGACATCCATGAGGAAGG + Intergenic
1198212503 X:134529333-134529355 TCCAGGGAGCTCAATGGGGAAGG + Intergenic
1201176179 Y:11309591-11309613 TGCACTGATCACCCTGGGGAGGG - Intergenic
1201177433 Y:11317669-11317691 TGCACTGATCACCCTGGGGAGGG - Intergenic
1201178521 Y:11324030-11324052 TGCACTGATCACCCTGGGGAGGG - Intergenic
1201422572 Y:13815822-13815844 GGCAGTGTTCTCAGTGTGGAAGG + Intergenic