ID: 1103761347

View in Genome Browser
Species Human (GRCh38)
Location 12:123252477-123252499
Sequence TACCAGTTGGACCACGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 34}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103761347 Original CRISPR TACCAGTTGGACCACGTTGT TGG Intronic
911770990 1:101742174-101742196 TACCAGTTTGCCCAGGTTGAGGG + Intergenic
921946773 1:220891405-220891427 TACCATTTGGGCATCGTTGTAGG + Intergenic
1063579964 10:7297397-7297419 TACTAGCTGGACCACCTGGTAGG + Intronic
1070115558 10:73525447-73525469 TACCAGTTGAAGAACGCTGTTGG + Intronic
1070692377 10:78536711-78536733 TAAAAGTGGGACCACGCTGTGGG + Intergenic
1078638029 11:13069844-13069866 ATCCAGATGGACCACGTTGGGGG - Intergenic
1097032536 12:56099998-56100020 TACCAGTTGGAACACTTAATCGG + Exonic
1100100750 12:91101542-91101564 TACCAGTTGGACAACTCTGAAGG + Intergenic
1103208290 12:119147501-119147523 TAGCAAATGGACCACGTTGGTGG + Intronic
1103761347 12:123252477-123252499 TACCAGTTGGACCACGTTGTTGG + Intronic
1115514977 14:34176041-34176063 TACTAGTTGGTTCACCTTGTAGG - Intronic
1116824731 14:49661350-49661372 TGCCAGTTGGTCCACTTGGTGGG - Intronic
1123208572 14:106737391-106737413 TACCAGCTGGACCTCGGCGTGGG + Intergenic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1165774732 19:38397756-38397778 TACCATTTGGAACTCATTGTAGG + Intergenic
1168104295 19:54157132-54157154 AACCAGTTGGACCAGGTGCTGGG + Intronic
928444542 2:31321229-31321251 GACCAGGTGGACCACGGTGGTGG - Intergenic
939248983 2:139662189-139662211 TACCAGTTTGACCCAGATGTGGG - Intergenic
946199064 2:218060603-218060625 TGCCAGCAGGACCAGGTTGTAGG + Intronic
946209431 2:218135598-218135620 TGCCAGCAGGACCAGGTTGTAGG - Exonic
946213300 2:218164420-218164442 TGCCAGCAGGACCAGGTTGTAGG + Exonic
1173918900 20:46729282-46729304 TACCAGTTGGCCCAGGCTGCGGG + Intronic
1176165401 20:63670531-63670553 TGCCAGTGGGACCACAGTGTCGG - Intronic
1179426538 21:41283982-41284004 TACCACGTGCACCTCGTTGTGGG - Intergenic
966968704 3:185021763-185021785 TTCAAGTAGGACCACGTTGCAGG - Intronic
971111488 4:23591105-23591127 TACCAGTTGGAACAATTTGGAGG + Intergenic
980392561 4:132165776-132165798 TACCAGTTGAACAAGGTTTTGGG + Intergenic
985969748 5:3365717-3365739 AACCAGTTGGATCACGCTGCTGG - Intergenic
986486089 5:8239222-8239244 TACCAGTTGTAACCCCTTGTGGG + Intergenic
988237343 5:28562080-28562102 TACCAGTTGGGCCCCTTTGGTGG - Intergenic
993297198 5:86155902-86155924 TACCAGAATGTCCACGTTGTGGG + Intergenic
1014635883 6:123845848-123845870 TGCCAGTTGGACAAACTTGTAGG + Intronic
1043378529 8:79677731-79677753 CACCAGTTGGATCAAGATGTAGG + Intergenic
1043763786 8:84103805-84103827 TACCAGTTTTACCACCTTGTCGG + Intergenic
1056626650 9:88259140-88259162 TAACAGATGGACCACTCTGTGGG - Intergenic
1199765232 X:150936535-150936557 CACCAGCTGGACCCAGTTGTTGG + Intergenic
1201385187 Y:13432655-13432677 TTCCAGGTGGACCACGTGGTGGG - Intronic