ID: 1103763722

View in Genome Browser
Species Human (GRCh38)
Location 12:123268087-123268109
Sequence GGCCACTGGGACGCCATTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103763722_1103763732 27 Left 1103763722 12:123268087-123268109 CCCGCAATGGCGTCCCAGTGGCC 0: 1
1: 0
2: 0
3: 12
4: 136
Right 1103763732 12:123268137-123268159 ATGACAAACAGCGGTAACCATGG 0: 1
1: 0
2: 0
3: 6
4: 75
1103763722_1103763728 -8 Left 1103763722 12:123268087-123268109 CCCGCAATGGCGTCCCAGTGGCC 0: 1
1: 0
2: 0
3: 12
4: 136
Right 1103763728 12:123268102-123268124 CAGTGGCCATTAGCGGGTAAAGG 0: 1
1: 0
2: 0
3: 2
4: 49
1103763722_1103763730 18 Left 1103763722 12:123268087-123268109 CCCGCAATGGCGTCCCAGTGGCC 0: 1
1: 0
2: 0
3: 12
4: 136
Right 1103763730 12:123268128-123268150 TCCTGCAGAATGACAAACAGCGG 0: 1
1: 0
2: 0
3: 19
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103763722 Original CRISPR GGCCACTGGGACGCCATTGC GGG (reversed) Intronic
903302051 1:22386155-22386177 GGCCACAGGGAGGCGATGGCAGG - Intergenic
903767305 1:25743081-25743103 GGGCACTGGGGAGCCACTGCAGG - Intronic
904081930 1:27877692-27877714 GGCCACTGGGATTCAATTCCAGG - Intronic
904431624 1:30468212-30468234 GACCACTTGGACCCCATTACAGG + Intergenic
910163556 1:84299090-84299112 TGCCCCTGAGACGCCATTCCCGG + Intronic
912210970 1:107556628-107556650 GGGCACTGGGAAGCCTTGGCAGG + Intergenic
912571960 1:110631284-110631306 GGTGACTGGTAGGCCATTGCTGG - Intronic
912989453 1:114470577-114470599 GGACACTTTGAGGCCATTGCAGG - Intronic
913438056 1:118867720-118867742 GGACACTGGGACGCATTTGAGGG - Intergenic
915062265 1:153195906-153195928 GGCCACTGGGCCTCCATAGGTGG + Intergenic
915177291 1:154026592-154026614 GGCCTCTGGGAGGCCAATGCAGG - Intronic
915892025 1:159781492-159781514 GGAGACTGGGAAGCCAGTGCGGG + Intronic
918455719 1:184711344-184711366 GGACACTGGGAGGCCAAGGCAGG - Intronic
920695160 1:208176223-208176245 GGCCACTGGGACCCCTCTGCAGG - Intronic
923246520 1:232137625-232137647 GTCCACTGGGAGGTCATTGGAGG - Intergenic
1066194894 10:33089703-33089725 GGCCACTAAGACATCATTGCAGG - Intergenic
1069684205 10:70307281-70307303 GGCCACTTGGGTGTCATTGCTGG - Intronic
1069975399 10:72208915-72208937 GCCCACTGGGAGGCCAAGGCGGG + Intronic
1071350670 10:84739833-84739855 GGGCACTGGAAGGACATTGCAGG - Intergenic
1072620296 10:97075041-97075063 GCCCACTCGGGCGCCACTGCAGG + Intronic
1072682460 10:97517006-97517028 GGCACCTGGGAGGGCATTGCTGG + Intronic
1073367967 10:102959686-102959708 GCACACTGGGAAGCCACTGCAGG - Intronic
1076795063 10:132794313-132794335 GGCCACTGGGCACCCAGTGCCGG - Intergenic
1081809806 11:45908423-45908445 GGCCACTGGGAAGTGAGTGCGGG - Intergenic
1086452516 11:86931013-86931035 GGGCAATGGGAAGCCATTGAAGG + Intronic
1089207112 11:116773103-116773125 GGCCACCGGGACGCGCTCGCAGG + Intergenic
1092240019 12:6830533-6830555 GGCCTCTATGAGGCCATTGCAGG + Exonic
1096311335 12:50523942-50523964 GGGCACTGGAAAGACATTGCAGG - Intronic
1098559615 12:71857194-71857216 GGACACTGGGAGGCCAAGGCAGG - Intronic
1099741144 12:86635926-86635948 GCACACTGGGAGGCCAATGCAGG - Intronic
1102977059 12:117214397-117214419 GGCCCCTTGGATGCTATTGCTGG + Exonic
1103763722 12:123268087-123268109 GGCCACTGGGACGCCATTGCGGG - Intronic
1104655573 12:130571828-130571850 GGCCACAGGGAGGCCAGTGTGGG - Intronic
1104727633 12:131087730-131087752 GGCCACTGGGAAGGCATGGGGGG - Intronic
1104966479 12:132510727-132510749 GGGCACTGTGACGCCAGTGGGGG - Intronic
1112386645 13:98946154-98946176 GGCCACTGTAAGGCCTTTGCTGG + Intronic
1113709112 13:112452503-112452525 GGCCACTGAGAGGCCATGCCTGG + Intergenic
1120927217 14:89809799-89809821 GGTCATTGGGACGCCATTGACGG - Intronic
1202941302 14_KI270725v1_random:149234-149256 GCCCACTGGGAGGCCAAGGCGGG - Intergenic
1124176091 15:27425356-27425378 GGCCACTGGGAGGCCGAGGCAGG + Intronic
1124426890 15:29570415-29570437 GGCCGCCGGGACGCCACCGCGGG - Intronic
1125089390 15:35772746-35772768 GGGCACTGGGAAGACACTGCAGG + Intergenic
1128314762 15:66653618-66653640 GGCCACAGGGAGGCCACTGATGG + Intronic
1128892352 15:71342596-71342618 GGCCACTGTGCAGCCACTGCAGG - Intronic
1133548798 16:6834000-6834022 GTACACTGGGAAGCCATTGGAGG + Intronic
1139533711 16:67558333-67558355 GGCCACTTGGACCCCATTCCTGG + Intergenic
1141007875 16:80370113-80370135 GGCGAGTGGGAAGCCATTGTTGG + Intergenic
1141769028 16:86077699-86077721 GGGCTCTGGGACGCCAGTCCGGG + Intergenic
1142746740 17:1963179-1963201 GGCCAATGGGAAGCCATCCCAGG - Intronic
1143345417 17:6245428-6245450 GTGCACAGGGACCCCATTGCTGG - Intergenic
1145928480 17:28665977-28665999 AGGCACTGGGAAGCCATTGCAGG - Intronic
1147249630 17:39145278-39145300 GGGGACTGGGACGCTACTGCTGG - Intronic
1151678474 17:75611885-75611907 GGCCATCGGGACGCCCTGGCTGG + Intergenic
1151942144 17:77299668-77299690 GCCCACTGGTAAGCCTTTGCAGG + Intronic
1152082536 17:78197271-78197293 TGTCACTGTGAGGCCATTGCCGG - Intronic
1152729299 17:81961749-81961771 GGCCACTGGGCCGCCCGCGCTGG - Intronic
1161157866 19:2742891-2742913 GCACATTGGGAAGCCATTGCAGG + Intergenic
1162371699 19:10283832-10283854 GGCCACAGGCACCGCATTGCAGG - Intronic
1165207967 19:34207471-34207493 AGCCACTGGGACTCCCTTGGAGG - Intronic
1166010295 19:39936266-39936288 GGCCTCTGGGAGGCCAGAGCGGG + Intergenic
1166092525 19:40519554-40519576 GGCCGCTAAGACGCCACTGCAGG - Exonic
1166804477 19:45477183-45477205 GGGCACTGGGGAGCTATTGCAGG + Intronic
1166844430 19:45718065-45718087 GGGCACTGGGGAGCCATGGCAGG - Intronic
1166863183 19:45821330-45821352 GGCCCCTGCGACGCCAGGGCAGG - Intronic
1166963756 19:46515363-46515385 GGGCACTGGGGAGCCATAGCAGG - Intronic
1167502915 19:49857506-49857528 GGCCACTGGGGAGCCATGGGGGG + Intronic
927150329 2:20191928-20191950 GGCCCCTGGGTCCCCAGTGCAGG - Intergenic
927687050 2:25178381-25178403 GGCCACTTGGACCCCATGGGTGG - Intergenic
929822505 2:45284578-45284600 GGCCACTGGGAAGTCATTGAAGG - Intergenic
934078587 2:88448717-88448739 AGCCACTGTGGAGCCATTGCTGG + Exonic
936162396 2:110094510-110094532 GGGCACCGGGACCCCACTGCAGG - Intronic
936182264 2:110276856-110276878 GGGCACCGGGACCCCACTGCAGG + Intergenic
937029440 2:118725909-118725931 GGCCACAGGGAAACCATTGTGGG - Intergenic
937158139 2:119735816-119735838 GGCCGCTGGGAGGCCTTGGCGGG - Intergenic
938660563 2:133482462-133482484 GGACACTGGGAGGCCAAGGCAGG - Intronic
946153915 2:217794498-217794520 GGCCACAGGGAGGCCAGAGCGGG - Intergenic
946857417 2:223965981-223966003 AGCCACTGGGAGGCCAAGGCGGG + Intronic
948628169 2:239283479-239283501 GGGGCCTGGGACGCCACTGCCGG + Intronic
1171959617 20:31484478-31484500 GGCTCCAGGGACGCCACTGCGGG + Exonic
1176581862 21:8537701-8537723 GCCCACTGGGAGGCCAAGGCGGG + Intergenic
1178623373 21:34195693-34195715 GGCCACTGGGACTCCAGAGCAGG - Intergenic
1179676793 21:42988724-42988746 GGCCACTGGGACAGCAGGGCAGG + Intronic
1180264697 22:10514773-10514795 GCCCACTGGGAGGCCAAGGCGGG + Intergenic
1180613831 22:17114642-17114664 GGCCAGTGGGACACCCGTGCAGG - Exonic
1180712080 22:17846251-17846273 GCACACTGGCAGGCCATTGCCGG + Intronic
1182081105 22:27529378-27529400 GGGCACTGGGAAGCCATGGATGG + Intergenic
1183014385 22:34973889-34973911 GACCACTGGGAAGCTACTGCTGG - Intergenic
1184160119 22:42692829-42692851 GGGCACTGGGCCGCCCTTCCCGG - Exonic
949313482 3:2726238-2726260 GGCTAATGAGACTCCATTGCAGG - Intronic
953605428 3:44410380-44410402 GGCCACTGGGACTCCATATCGGG - Intergenic
953614680 3:44478905-44478927 GGCCAATGGGAAGCCCTGGCAGG - Intergenic
955216125 3:56986252-56986274 GGGCACTGGGAAGCCTTTGCAGG - Intronic
961012738 3:123447375-123447397 GGCCACCGGGACTGGATTGCGGG - Intronic
962066781 3:131989930-131989952 GGGCTCTGGGAAGCCATTGAAGG + Intronic
964325469 3:155541436-155541458 GGACACTTGGAGGCCATTGTAGG + Intronic
965903168 3:173669090-173669112 AGACACTGGGAAGTCATTGCCGG + Intronic
969856681 4:10005430-10005452 GGGCACTGGGGAGCCATTGGAGG + Intronic
970145902 4:13035459-13035481 GGCCAATGGGAGGCCCTTTCAGG - Intergenic
971454988 4:26835787-26835809 GGACAATGGGAAGCCATTGAAGG - Intergenic
972222028 4:36966758-36966780 GGCCACTGGGAAGCTCTAGCTGG - Intergenic
972335958 4:38107213-38107235 GGCACCTGGGACTCCACTGCCGG - Intronic
973894165 4:55395882-55395904 GGCCAATGGGAGGCCGTCGCGGG + Intergenic
977716687 4:100190687-100190709 GGCCACTGGGACCGCAATTCCGG + Intronic
978108839 4:104936642-104936664 GTCCAATGGGACTGCATTGCAGG - Intergenic
979668917 4:123342038-123342060 GTCCACTGGGAGGCCAAGGCAGG - Intergenic
980761483 4:137239231-137239253 AGGAACTGGGACACCATTGCAGG - Intergenic
980952865 4:139398930-139398952 GAACACTGGGAGGCCATTGCAGG + Intronic
984975660 4:185228067-185228089 GGCAACTGGGAGGCCTTTGGAGG + Intronic
985116783 4:186599652-186599674 GGGCACTGGGAGGGCACTGCAGG + Intronic
988974082 5:36498076-36498098 GGCCAGTGGAATGCGATTGCAGG + Intergenic
991042264 5:62188254-62188276 GGCCAATGGGAGGCCAAGGCAGG - Intergenic
998237598 5:140412402-140412424 GCCCTCTGGGAGGCCACTGCAGG - Intronic
999467660 5:151822745-151822767 GGCCATGGGGAAGCCAATGCGGG + Exonic
1000916033 5:167082954-167082976 GGCCATTGGGAAGGCAATGCTGG + Intergenic
1002388068 5:178885681-178885703 GGTCTCTGGGACACTATTGCTGG - Intronic
1011182238 6:84633986-84634008 GTCCACTGGGACCACAGTGCAGG - Intergenic
1014747212 6:125214175-125214197 GGCCAATGGGAAGCCCCTGCAGG - Intronic
1017509959 6:155105395-155105417 AGCCTCTGGGAGGCCAATGCGGG - Intronic
1018936074 6:168274759-168274781 GGCCACGCAGAGGCCATTGCAGG - Intergenic
1019416045 7:926873-926895 GGCCCCTGGGCCCCCTTTGCCGG - Intronic
1021975955 7:26011203-26011225 CGCCACCGGGACCACATTGCAGG + Intergenic
1025288655 7:57691224-57691246 GCCCACTGGGAGGCCAAGGCGGG - Intergenic
1029465695 7:100723268-100723290 GGCCCCTGAGATGTCATTGCTGG - Exonic
1029973269 7:104810257-104810279 GGGCAATGAGAAGCCATTGCAGG + Intronic
1031513256 7:122673888-122673910 GGCCACTGGGAGCCCACGGCGGG + Intronic
1035077504 7:156190614-156190636 GCCCACTGGGAGGACATTCCTGG + Intergenic
1035373667 7:158394353-158394375 GGCCACAGGGAGGGCATTGGAGG + Intronic
1035559917 8:596513-596535 GGCCTCAGGGACGCCATGGCTGG + Intergenic
1037210334 8:16378308-16378330 GGCCAATGCGAAGCCCTTGCAGG - Intronic
1039128114 8:34227898-34227920 GGGCACAGGGAAGCCATTGGAGG + Intergenic
1043035825 8:75197471-75197493 GGCCCCTGGGTGGCCCTTGCTGG - Intergenic
1043061292 8:75507503-75507525 GCCCACTGGGAGGCCAAGGCAGG - Intronic
1043415078 8:80039637-80039659 GGGCAATGGGAAGCCATTGAAGG - Intronic
1047711792 8:127559762-127559784 GGCCACTTGGATGCCATTTTAGG + Intergenic
1048344757 8:133568300-133568322 TGCCACTGGGACTCAAATGCAGG + Intronic
1048440076 8:134453225-134453247 GGCCACTGGGGAGCAATAGCAGG - Intergenic
1049095939 8:140548067-140548089 GGACTCTGGGAGGCCATGGCGGG + Intronic
1051735129 9:20190026-20190048 CCCCACTGGGAAGCCATGGCAGG + Intergenic
1053710169 9:40799207-40799229 GGCCACAGGGACACAAATGCAGG - Intergenic
1054420073 9:64920002-64920024 GGCCACAGGGACACAAATGCAGG - Intergenic
1059989767 9:119854015-119854037 GGGCAATGGGAAGCCATTGCAGG + Intergenic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1060826920 9:126693008-126693030 GGCCACTGGGGAGCCACGGCAGG + Intronic
1062318824 9:135980666-135980688 GGCCACTGGGACCCCACCTCTGG + Intergenic
1203611879 Un_KI270749v1:15737-15759 GCCCACTGGGAGGCCAAGGCGGG + Intergenic
1191103669 X:56759275-56759297 GGCCACTGGGACACCACAGGTGG - Intergenic
1192435047 X:71137869-71137891 AGCCACTGGGCCGCTGTTGCAGG - Exonic
1194534949 X:95094782-95094804 GGCCGCTGGGAAGTCAGTGCTGG - Intergenic
1195538877 X:106039737-106039759 GGGCACTGGGAAGCCACTGGGGG + Intergenic