ID: 1103763787

View in Genome Browser
Species Human (GRCh38)
Location 12:123268368-123268390
Sequence GGGTTCTCCAGTGCTCCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 192}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103763787_1103763802 30 Left 1103763787 12:123268368-123268390 CCGGGAGGAGCACTGGAGAACCC 0: 1
1: 0
2: 0
3: 16
4: 192
Right 1103763802 12:123268421-123268443 GACCTGAAGGGGTGGCCCCAGGG 0: 1
1: 0
2: 1
3: 15
4: 166
1103763787_1103763799 19 Left 1103763787 12:123268368-123268390 CCGGGAGGAGCACTGGAGAACCC 0: 1
1: 0
2: 0
3: 16
4: 192
Right 1103763799 12:123268410-123268432 TTAGAGAAATGGACCTGAAGGGG 0: 1
1: 0
2: 1
3: 18
4: 234
1103763787_1103763797 17 Left 1103763787 12:123268368-123268390 CCGGGAGGAGCACTGGAGAACCC 0: 1
1: 0
2: 0
3: 16
4: 192
Right 1103763797 12:123268408-123268430 ATTTAGAGAAATGGACCTGAAGG 0: 1
1: 0
2: 2
3: 17
4: 254
1103763787_1103763798 18 Left 1103763787 12:123268368-123268390 CCGGGAGGAGCACTGGAGAACCC 0: 1
1: 0
2: 0
3: 16
4: 192
Right 1103763798 12:123268409-123268431 TTTAGAGAAATGGACCTGAAGGG 0: 1
1: 0
2: 3
3: 27
4: 356
1103763787_1103763801 29 Left 1103763787 12:123268368-123268390 CCGGGAGGAGCACTGGAGAACCC 0: 1
1: 0
2: 0
3: 16
4: 192
Right 1103763801 12:123268420-123268442 GGACCTGAAGGGGTGGCCCCAGG 0: 1
1: 0
2: 1
3: 32
4: 251
1103763787_1103763793 8 Left 1103763787 12:123268368-123268390 CCGGGAGGAGCACTGGAGAACCC 0: 1
1: 0
2: 0
3: 16
4: 192
Right 1103763793 12:123268399-123268421 GGCCCCTCGATTTAGAGAAATGG 0: 1
1: 0
2: 0
3: 3
4: 74
1103763787_1103763800 22 Left 1103763787 12:123268368-123268390 CCGGGAGGAGCACTGGAGAACCC 0: 1
1: 0
2: 0
3: 16
4: 192
Right 1103763800 12:123268413-123268435 GAGAAATGGACCTGAAGGGGTGG 0: 1
1: 0
2: 1
3: 20
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103763787 Original CRISPR GGGTTCTCCAGTGCTCCTCC CGG (reversed) Intronic
900178944 1:1302975-1302997 GGGTTCCCATCTGCTCCTCCAGG - Exonic
900690674 1:3978473-3978495 GGGCTCCCCAGTTCTCCCCCGGG - Intergenic
901467433 1:9431477-9431499 AGGTTCTCCATTGCATCTCCAGG - Intergenic
902273902 1:15325740-15325762 AGGACCTCCAGGGCTCCTCCTGG - Intronic
902535846 1:17118979-17119001 GCCCTCTCCAGTTCTCCTCCCGG - Intronic
903238715 1:21968254-21968276 GGGTTCTGCAGAGGTTCTCCAGG - Intergenic
903242640 1:21993918-21993940 GGGTTCTGCAGAGGTTCTCCAGG - Intronic
906413137 1:45595552-45595574 GGGGTCTCCAGTACTCTTTCAGG + Intronic
907574019 1:55509619-55509641 GAATTCTCCAGTGCTTGTCCAGG - Intergenic
907874252 1:58470543-58470565 GGGTTTGACAGTGCTGCTCCTGG - Intronic
910112769 1:83700538-83700560 GGACTCTGCAGTCCTCCTCCAGG + Intergenic
915505717 1:156355046-156355068 GGGTTCTCCAGGCATGCTCCAGG + Intronic
918846364 1:189620073-189620095 GGGTTCTTTAGTGCTGCTTCTGG - Intergenic
919929638 1:202213096-202213118 ACTTTCTCCAGTGCTCATCCAGG + Intronic
920147254 1:203872650-203872672 AGCTTCTCCAGGGTTCCTCCAGG - Intergenic
922722212 1:227904902-227904924 GGGAACCTCAGTGCTCCTCCTGG + Intergenic
924740492 1:246791809-246791831 GGGTTTCCCAGGGCTCCTGCGGG + Intergenic
924950022 1:248873704-248873726 GCTTTCTCCAGAGCTCCGCCGGG + Intergenic
1063345435 10:5307676-5307698 GGGTTCTCCAGTTGTCTTCCTGG - Intergenic
1065687652 10:28302611-28302633 GGGGTCTCCAGGGGTCCTCAGGG + Intronic
1068913829 10:62407035-62407057 GAGTGCTCCAGTGCTCTGCCTGG - Intronic
1069413152 10:68173706-68173728 GGGATCTCAAGTGATCTTCCTGG + Intronic
1071021392 10:81061176-81061198 GGTTTCTCCAGTGATGCTGCCGG + Intergenic
1071516032 10:86298568-86298590 GGCTTCTACTGTGCTTCTCCTGG + Intronic
1073076564 10:100828351-100828373 CGGCTCTTCACTGCTCCTCCTGG + Exonic
1075398225 10:122142940-122142962 GTGGTCTCCAGTGCTACCCCCGG + Intronic
1076658969 10:132042675-132042697 GGGCTCTCCAAAGCTGCTCCAGG - Intergenic
1076681150 10:132172017-132172039 GGTTTCTCCAGGTTTCCTCCTGG + Intronic
1076681261 10:132172677-132172699 GGAGCCTCCAGCGCTCCTCCAGG + Intronic
1076723729 10:132403999-132404021 GCATTCTCCAGGGCTCCTGCAGG + Intronic
1076723735 10:132404025-132404047 GCATTCTCCAGGGCTCCTGCAGG + Intronic
1076723741 10:132404051-132404073 GCATTCTCCAGGGCTCCTGCAGG + Intronic
1076743302 10:132498944-132498966 GTCTTCTCCTGTGCTCCTCATGG + Intergenic
1076897334 10:133319044-133319066 GGGGTCCCCAGAGATCCTCCCGG + Intronic
1077034565 11:488445-488467 CGGTTCCCCTGTGCTCTTCCGGG + Intronic
1077895805 11:6452426-6452448 GAGTTCTCCAAGGCTGCTCCTGG - Intronic
1079203423 11:18394426-18394448 GGCCTCTCCAGTGCCCCGCCTGG + Intronic
1079306932 11:19331549-19331571 GGGTTCTCCACTGGGCCTCCAGG + Intergenic
1079393777 11:20044242-20044264 GGGGTCTTCAGTGCGCCTGCCGG - Exonic
1079582584 11:22084586-22084608 GGGTTCTGCAGTTCAGCTCCAGG + Intergenic
1080074617 11:28134473-28134495 AGGTTCTCCAGGGATCCTTCTGG + Intronic
1085518909 11:77126954-77126976 GGGCTCTCCTGTGCTCCCCCGGG + Intergenic
1090465272 11:126928011-126928033 GAGTGCTCCTGTGCTTCTCCAGG + Intronic
1090466287 11:126937498-126937520 GCTTTCTCCAAAGCTCCTCCAGG - Intronic
1090824066 11:130371245-130371267 AGGTTCTCAGGCGCTCCTCCTGG + Intergenic
1091014710 11:132039585-132039607 GGTTTCTCCACTCCTCTTCCTGG - Intronic
1091250160 11:134137473-134137495 GGGTTGTCCAGTCATCATCCAGG + Intronic
1095606186 12:44070573-44070595 GGGTCCTGCAGTGATCCTCTGGG + Intronic
1095984618 12:47991165-47991187 GGGTGCTCCAGAGCTCCCCAAGG - Intronic
1096491871 12:52017123-52017145 CCCTGCTCCAGTGCTCCTCCCGG + Intergenic
1100015473 12:90005559-90005581 TGGTGATCCAGTGTTCCTCCAGG + Intergenic
1102269642 12:111522091-111522113 GGGTCCTCCTGTGCTACTCCAGG + Intronic
1103748408 12:123141893-123141915 GTTTTTTCCAGTGCTCCTTCTGG + Intronic
1103763787 12:123268368-123268390 GGGTTCTCCAGTGCTCCTCCCGG - Intronic
1106178358 13:27350333-27350355 GGGTGCTTCAGTACTCCTGCAGG - Intergenic
1112328224 13:98458128-98458150 GGAATCTCCAGTGTTCTTCCTGG + Intronic
1113963026 13:114135837-114135859 GGCTTCTCTGGTGCTCCTGCTGG + Intergenic
1115082571 14:29474666-29474688 GGGTTCTCCAGTGGACATACTGG + Intergenic
1117951219 14:61084001-61084023 GGGTACCCTAGTGCTACTCCAGG + Intergenic
1119665054 14:76479581-76479603 GGGCTCTCCAGGGATTCTCCTGG - Intronic
1119785913 14:77314113-77314135 TGGCTCTCTTGTGCTCCTCCAGG + Intronic
1120175449 14:81288902-81288924 GACTTACCCAGTGCTCCTCCAGG - Intronic
1124187738 15:27544646-27544668 AGCTTCTTCAGTGCACCTCCTGG - Intergenic
1125462452 15:39920118-39920140 GGCTTCTCCAGGACTCCGCCAGG - Exonic
1127286547 15:57538504-57538526 GGGCTCTCCAGGGGCCCTCCAGG + Intronic
1129300218 15:74621089-74621111 GGCCTCTCCACTGCTCCTCAGGG - Intronic
1130942392 15:88522319-88522341 GTGTTCTCCACTGCTTCTTCAGG + Intronic
1132029539 15:98428697-98428719 GTCTTCTCCAGGGCACCTCCTGG + Intergenic
1132745463 16:1434463-1434485 GGCTTCTCCAGGACCCCTCCTGG + Exonic
1132956816 16:2598630-2598652 GGCTTCTCCAAGGCACCTCCTGG - Exonic
1134005820 16:10818413-10818435 GGCTTCTCCAGCGCTCCCGCAGG + Intronic
1135170916 16:20182610-20182632 GGCTACTCCAGGGCTCTTCCTGG - Intergenic
1137733971 16:50710742-50710764 GGGTGCTGAAGAGCTCCTCCAGG - Exonic
1137744757 16:50812517-50812539 CGGCTCCCCAGTGCTCTTCCAGG + Intergenic
1138044186 16:53703866-53703888 TGTTTCTCCCGTGCTCCTCTCGG - Intronic
1139590814 16:67931802-67931824 TGGTTCTCCTCGGCTCCTCCTGG - Exonic
1140922731 16:79553731-79553753 CGGTTCTACAGTTCTCTTCCAGG + Intergenic
1142237086 16:88927473-88927495 GGGTCCACCTGTTCTCCTCCAGG + Intronic
1143057134 17:4170850-4170872 TTGTTTTCCAGTGCTGCTCCTGG - Exonic
1143376505 17:6470542-6470564 GCGTTCCCCAGGCCTCCTCCAGG - Intronic
1151397253 17:73831697-73831719 GGGTACAGCAGTGATCCTCCAGG - Intergenic
1152376104 17:79919810-79919832 GGGTTGTCCTGTCGTCCTCCTGG + Intergenic
1155105995 18:22667050-22667072 GGGGTCTCCAGTGCTGCTCAGGG - Intergenic
1157200263 18:45653687-45653709 GGGTCCTGCAGTGAGCCTCCAGG + Intronic
1157422920 18:47560968-47560990 GCTTTCTCCAGAGCTGCTCCCGG - Intergenic
1160007545 18:75079114-75079136 GGGTTCTCTAGAGCTGGTCCTGG - Intergenic
1160156185 18:76435746-76435768 GGGCTCTCCAGGGCTCTACCTGG - Intronic
1162126047 19:8499998-8500020 GGGATCTCCAGTGCTGCTAGAGG - Intronic
1162133394 19:8541261-8541283 GGGACCTCCAGTGATCCTTCTGG + Intronic
1166266992 19:41690591-41690613 GGGTTATCCTGTCCTCCTGCAGG + Intronic
1166698283 19:44866800-44866822 GGGTTCTCACCAGCTCCTCCTGG + Intronic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
925818248 2:7774262-7774284 AGGTTGTCCCCTGCTCCTCCTGG - Intergenic
926702568 2:15813592-15813614 TGGTTCCCAAGTGCTCCCCCGGG + Intergenic
928348219 2:30520071-30520093 GGGTTCCACAGTTCTCTTCCGGG + Intronic
930853255 2:55984714-55984736 GGCTTCTCAGGTGCTCCTCCTGG - Intergenic
934305483 2:91818302-91818324 GGCTGCCCCAGTGCTCCTTCTGG + Intergenic
934327773 2:92034446-92034468 GGCTGCCCCAGTGCTCCTTCTGG - Intergenic
934466160 2:94264976-94264998 GGCTGCCCCAGTGCTCCTTCTGG - Intergenic
934588985 2:95529432-95529454 GGCTTGTCCAGTGATGCTCCTGG + Intergenic
946758747 2:222972587-222972609 GGGTCCTCCATGCCTCCTCCAGG - Intergenic
948695456 2:239731085-239731107 GGATTCCCCATTGCTCCCCCTGG + Intergenic
948900142 2:240952500-240952522 GGGTTGTGCAGTGCACCTGCTGG + Intronic
1168933743 20:1645501-1645523 AGGTGGGCCAGTGCTCCTCCAGG - Intronic
1169268740 20:4183191-4183213 GGGTTCTCGTGAGGTCCTCCTGG - Intronic
1170775762 20:19373395-19373417 GGGTTCTCGAATGTTCCACCAGG - Intronic
1173010190 20:39175304-39175326 GGCATCTCCAGTGCTCCTGAGGG + Intergenic
1173572440 20:44086163-44086185 GGGCTCTCCTGTGCTGCTCCAGG - Intergenic
1173791952 20:45833835-45833857 GGGTTCTGCAGGGCTCCGCCGGG - Exonic
1174388084 20:50198565-50198587 GGCTCCTCCAGCGCCCCTCCTGG - Intergenic
1174775258 20:53337928-53337950 TGGTTCTTCAGTGCTTCCCCTGG + Intronic
1175342562 20:58243075-58243097 GGATGCTCCAGTGCTGGTCCTGG - Intergenic
1175402869 20:58710568-58710590 AGGGTCTCCAGTGCTACGCCAGG - Intronic
1175875352 20:62226916-62226938 GGGTTCTCAAGACCGCCTCCAGG - Intergenic
1176040179 20:63061006-63061028 AGGTCCTCCAGTTCCCCTCCCGG - Intergenic
1176722848 21:10405669-10405691 GGGTTCTCCTGAGCTGGTCCGGG + Intergenic
1178899496 21:36587884-36587906 GGCTTCTCCATTGGTCCTCACGG + Intergenic
1180304011 22:11058411-11058433 GGGTTCTCCTGAGCTGGTCCGGG + Intergenic
1183425494 22:37736968-37736990 GGGTTCTCCAGTCCTCCCATGGG - Intronic
1185082410 22:48717351-48717373 GGGATGTGCAGGGCTCCTCCTGG - Intronic
1185111976 22:48905266-48905288 GGCTTCTCCTGTGCCCCACCAGG - Intergenic
950501019 3:13363897-13363919 GGGTTCTTCAGGGCCCCTCCTGG - Intronic
953563910 3:44014817-44014839 GGGCTCTCCATTCCTCCTACTGG + Intergenic
954375030 3:50189572-50189594 GGGCTCTCAAAGGCTCCTCCAGG - Intergenic
954424799 3:50437712-50437734 GGGCTCTCCTGGGCTCCTGCTGG - Intronic
963299725 3:143584959-143584981 GGGCTCCCCAGCCCTCCTCCAGG - Intronic
963925045 3:150942959-150942981 TGGTGCCTCAGTGCTCCTCCAGG - Intronic
966319028 3:178680075-178680097 GGGTGCTCCAGAGCTCCTTGGGG - Intronic
968353350 3:198080802-198080824 GGGTTCTCCTGGGCTCGCCCGGG + Intergenic
968716990 4:2167520-2167542 GGGTTCTCAGATGCTCCTCGTGG - Intronic
968860028 4:3160477-3160499 TGGTTCTCCAGGGTGCCTCCGGG + Intronic
969649508 4:8456355-8456377 GGGTCCTGCAGTGCTACTCGAGG - Intronic
969689202 4:8694939-8694961 CGGTCCTCCAGGGCCCCTCCTGG + Intergenic
972692059 4:41408570-41408592 AGGTTTTCCAATGTTCCTCCTGG + Intronic
973707635 4:53595780-53595802 GCGTTCTCAAGGACTCCTCCTGG + Intronic
974276671 4:59729312-59729334 GAGTTTTCCAGAGCTCCTCAAGG + Intergenic
974778559 4:66521368-66521390 GGCTTCTGCAGTGCCCTTCCTGG - Intergenic
976224024 4:82781045-82781067 GGCTTCTCCAGCCCTCCTCTGGG - Intronic
984901085 4:184586951-184586973 GGAGTCTCCAGCGATCCTCCAGG + Intergenic
986733652 5:10652805-10652827 GGATTGTCCAGTGATGCTCCTGG + Intergenic
986882647 5:12194251-12194273 GGGATGTCCTGTGCTGCTCCAGG - Intergenic
988496300 5:31748965-31748987 GGTTATTCCAGTGCTACTCCAGG - Intronic
1001742386 5:174064769-174064791 ATATTCTCCAGTGCTCCTCGCGG - Intronic
1002597518 5:180334075-180334097 GGGGTCTGCTGTCCTCCTCCTGG + Intronic
1002722788 5:181273586-181273608 GGGTTCTCCTGCGCTGGTCCGGG + Intergenic
1003406337 6:5829871-5829893 GGGCTCTCCAGTGGTCCAGCGGG + Intergenic
1004204952 6:13583851-13583873 GTGTTCTCAAGTGCTCCTAGAGG - Intronic
1004956988 6:20738590-20738612 TGGGGCTTCAGTGCTCCTCCTGG + Intronic
1005454242 6:26003870-26003892 GTGGTCTCAAGTGGTCCTCCTGG + Intergenic
1007476670 6:42123982-42124004 GGCTTCTCCGGTGGCCCTCCAGG + Intronic
1009704914 6:67238085-67238107 TGTTTGTCCAGTGCTCCTGCTGG - Intergenic
1012180664 6:96148595-96148617 GGCTTCTCCAGGGCCACTCCAGG - Intronic
1013046568 6:106491545-106491567 GAGCTCTCCAGTGCTCTTCCAGG + Intergenic
1013817741 6:114118941-114118963 GGGTACTCCTGTGTTCCTCTTGG - Intronic
1016939744 6:149474291-149474313 GGGTTCTGAAGTCCTCTTCCAGG + Exonic
1017829922 6:158117054-158117076 AGGTTCTCCAGAGCTCCTCTGGG + Intronic
1018933833 6:168260561-168260583 GGGTCCTCCAGTTCTCCCTCTGG + Intergenic
1019709634 7:2512283-2512305 GGGTTATCCAGTGCTCGTCTTGG - Intergenic
1019849225 7:3537937-3537959 TGAACCTCCAGTGCTCCTCCAGG + Intronic
1020016656 7:4835449-4835471 GGTCTCTCGTGTGCTCCTCCGGG - Intronic
1021707131 7:23378895-23378917 TGTTTCTCCAGTACTCTTCCGGG - Intronic
1022331600 7:29384496-29384518 GGCTCCTCCTCTGCTCCTCCTGG + Intronic
1023194588 7:37621210-37621232 GGGATCTGCTGGGCTCCTCCGGG + Intergenic
1023336218 7:39173727-39173749 GGCTTCTCCAGGGCTCCTTTTGG + Intronic
1023640613 7:42253380-42253402 GGGCTCCCCATTCCTCCTCCTGG + Intergenic
1024896952 7:54271238-54271260 GGTTTCTCCTGTGCTTCTCATGG - Intergenic
1028949668 7:96620310-96620332 GGGTACTCCCGTGCACCCCCTGG - Intronic
1029294875 7:99532386-99532408 GGGTTCTCCGGTGTTCCTAAAGG - Exonic
1029456293 7:100674080-100674102 GGGTTCCCCAGTTCCCCTTCCGG - Intronic
1032002750 7:128275921-128275943 GGATTCCCCAGGGCTCTTCCTGG - Intergenic
1034271529 7:149805550-149805572 GGGGGCTGCAGGGCTCCTCCTGG - Intergenic
1034530974 7:151696351-151696373 GGGTTCCCCAGTGGGGCTCCGGG + Intronic
1034957660 7:155344751-155344773 GGGCTCTCCCGTGGCCCTCCCGG + Intergenic
1037611957 8:20483320-20483342 GGGTCCTGGGGTGCTCCTCCTGG + Intergenic
1037678970 8:21077256-21077278 CTGTTCTCCAAGGCTCCTCCAGG - Intergenic
1038425434 8:27461326-27461348 AGGGTCTGCACTGCTCCTCCAGG + Exonic
1038463090 8:27733098-27733120 GGGTTCTTCAATCCTCCTCCTGG + Intergenic
1038623080 8:29163390-29163412 GGGTTCTCCATGGGTCCTCTGGG - Intronic
1040497835 8:47982328-47982350 GGCTTCACCAGTGCCCCTACAGG - Intergenic
1040638356 8:49302119-49302141 GGCTGCTCCATTGCTCCTCTTGG - Intergenic
1040818152 8:51530373-51530395 CAGTTCTCCGCTGCTCCTCCAGG + Intronic
1041304957 8:56448269-56448291 GGGTTCTCCAGCCCCACTCCAGG - Intergenic
1049378161 8:142298860-142298882 GGGTGCTCGTGAGCTCCTCCAGG - Intronic
1049996972 9:1043370-1043392 GGATTCTCCTGTTCTACTCCTGG - Intergenic
1052824064 9:33162635-33162657 GGATTGTCTAGTGCTCTTCCTGG - Intronic
1052857120 9:33414412-33414434 GGTTTTTCCACTGCTCCTTCCGG - Intergenic
1053503356 9:38620725-38620747 GGGTTCTCCTGGGCTCCCGCGGG + Intergenic
1053885018 9:42637200-42637222 GGGTTCTCCTGAGCTGGTCCGGG + Intergenic
1054224039 9:62444651-62444673 GGGTTCTCCTGAGCTGGTCCGGG + Intergenic
1056831805 9:89923330-89923352 GGCTGCTCCTTTGCTCCTCCTGG - Intergenic
1056900223 9:90592294-90592316 GGCTTCACCAGTGCTCATGCGGG + Intergenic
1058022899 9:100108817-100108839 GGCCTCTCCAGTCCTCCTCCAGG - Intronic
1060281836 9:122220283-122220305 GGATCCTCCTGTGCTCCTCGTGG + Intronic
1060757387 9:126223422-126223444 TGGGTCTCCAGTGCCCCTCCTGG - Intergenic
1060937540 9:127524416-127524438 GGGTTGGCCTGTGCCCCTCCAGG + Intronic
1061117978 9:128626648-128626670 GGTTCCTCCAGGTCTCCTCCAGG - Exonic
1061261244 9:129482225-129482247 AGGTTCCCCCGCGCTCCTCCCGG + Intergenic
1061648347 9:132025274-132025296 GGGTTCTCAAGTGATTCTCCTGG + Intronic
1202778660 9_KI270717v1_random:15409-15431 GGCTGCCCCAGTGCTCCTTCTGG - Intergenic
1203585735 Un_KI270747v1:1818-1840 GGCTGCCCCAGTGCTCCTTCTGG - Intergenic
1186457389 X:9720686-9720708 GGGTTCTGCAGTACCCCTCAGGG - Intergenic
1188185238 X:27105913-27105935 CTGTTCTCCAGTGATTCTCCTGG + Intergenic
1189318585 X:40073576-40073598 GGTTTCTACAGAGCTCCTGCTGG + Exonic
1190118416 X:47640612-47640634 GGGTAGACCAGTGCTCCTCTGGG + Intronic
1190597542 X:52063497-52063519 GGCCTCTCCAGGGCTCCGCCGGG - Intronic
1190611282 X:52190576-52190598 GGCCTCTCCAGGGCTCCGCCGGG + Intronic
1196683925 X:118495342-118495364 GAGTTCTCCAGCCCTCCTGCGGG + Intergenic
1196819870 X:119693586-119693608 GAGCTCTGCAGTTCTCCTCCCGG + Intergenic
1201673520 Y:16552389-16552411 GGTTTCTCGAGTGTTCCTCATGG + Intergenic