ID: 1103763834

View in Genome Browser
Species Human (GRCh38)
Location 12:123268561-123268583
Sequence AGCATAACCCTGGGCTGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 291}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103763834_1103763842 11 Left 1103763834 12:123268561-123268583 CCACTGCAGCCCAGGGTTATGCT 0: 1
1: 0
2: 0
3: 15
4: 291
Right 1103763842 12:123268595-123268617 TGGAACTGCAAACGTGGACTTGG 0: 1
1: 0
2: 0
3: 6
4: 60
1103763834_1103763844 24 Left 1103763834 12:123268561-123268583 CCACTGCAGCCCAGGGTTATGCT 0: 1
1: 0
2: 0
3: 15
4: 291
Right 1103763844 12:123268608-123268630 GTGGACTTGGATCCTGAACTGGG 0: 1
1: 0
2: 1
3: 7
4: 127
1103763834_1103763841 5 Left 1103763834 12:123268561-123268583 CCACTGCAGCCCAGGGTTATGCT 0: 1
1: 0
2: 0
3: 15
4: 291
Right 1103763841 12:123268589-123268611 TTGGGCTGGAACTGCAAACGTGG 0: 1
1: 0
2: 0
3: 3
4: 78
1103763834_1103763839 -9 Left 1103763834 12:123268561-123268583 CCACTGCAGCCCAGGGTTATGCT 0: 1
1: 0
2: 0
3: 15
4: 291
Right 1103763839 12:123268575-123268597 GGTTATGCTCCAGCTTGGGCTGG 0: 1
1: 0
2: 1
3: 7
4: 90
1103763834_1103763843 23 Left 1103763834 12:123268561-123268583 CCACTGCAGCCCAGGGTTATGCT 0: 1
1: 0
2: 0
3: 15
4: 291
Right 1103763843 12:123268607-123268629 CGTGGACTTGGATCCTGAACTGG 0: 1
1: 0
2: 0
3: 6
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103763834 Original CRISPR AGCATAACCCTGGGCTGCAG TGG (reversed) Intronic