ID: 1103763835

View in Genome Browser
Species Human (GRCh38)
Location 12:123268570-123268592
Sequence CCAAGCTGGAGCATAACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103763835_1103763841 -4 Left 1103763835 12:123268570-123268592 CCCAGGGTTATGCTCCAGCTTGG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1103763841 12:123268589-123268611 TTGGGCTGGAACTGCAAACGTGG 0: 1
1: 0
2: 0
3: 3
4: 78
1103763835_1103763843 14 Left 1103763835 12:123268570-123268592 CCCAGGGTTATGCTCCAGCTTGG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1103763843 12:123268607-123268629 CGTGGACTTGGATCCTGAACTGG 0: 1
1: 0
2: 0
3: 6
4: 51
1103763835_1103763844 15 Left 1103763835 12:123268570-123268592 CCCAGGGTTATGCTCCAGCTTGG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1103763844 12:123268608-123268630 GTGGACTTGGATCCTGAACTGGG 0: 1
1: 0
2: 1
3: 7
4: 127
1103763835_1103763842 2 Left 1103763835 12:123268570-123268592 CCCAGGGTTATGCTCCAGCTTGG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1103763842 12:123268595-123268617 TGGAACTGCAAACGTGGACTTGG 0: 1
1: 0
2: 0
3: 6
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103763835 Original CRISPR CCAAGCTGGAGCATAACCCT GGG (reversed) Intronic