ID: 1103763840

View in Genome Browser
Species Human (GRCh38)
Location 12:123268584-123268606
Sequence TTTGCAGTTCCAGCCCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 226}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103763840_1103763844 1 Left 1103763840 12:123268584-123268606 CCAGCTTGGGCTGGAACTGCAAA 0: 1
1: 0
2: 2
3: 16
4: 226
Right 1103763844 12:123268608-123268630 GTGGACTTGGATCCTGAACTGGG 0: 1
1: 0
2: 1
3: 7
4: 127
1103763840_1103763843 0 Left 1103763840 12:123268584-123268606 CCAGCTTGGGCTGGAACTGCAAA 0: 1
1: 0
2: 2
3: 16
4: 226
Right 1103763843 12:123268607-123268629 CGTGGACTTGGATCCTGAACTGG 0: 1
1: 0
2: 0
3: 6
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103763840 Original CRISPR TTTGCAGTTCCAGCCCAAGC TGG (reversed) Intronic