ID: 1103763844

View in Genome Browser
Species Human (GRCh38)
Location 12:123268608-123268630
Sequence GTGGACTTGGATCCTGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103763837_1103763844 14 Left 1103763837 12:123268571-123268593 CCAGGGTTATGCTCCAGCTTGGG 0: 1
1: 0
2: 0
3: 14
4: 164
Right 1103763844 12:123268608-123268630 GTGGACTTGGATCCTGAACTGGG 0: 1
1: 0
2: 1
3: 7
4: 127
1103763834_1103763844 24 Left 1103763834 12:123268561-123268583 CCACTGCAGCCCAGGGTTATGCT 0: 1
1: 0
2: 0
3: 15
4: 291
Right 1103763844 12:123268608-123268630 GTGGACTTGGATCCTGAACTGGG 0: 1
1: 0
2: 1
3: 7
4: 127
1103763835_1103763844 15 Left 1103763835 12:123268570-123268592 CCCAGGGTTATGCTCCAGCTTGG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1103763844 12:123268608-123268630 GTGGACTTGGATCCTGAACTGGG 0: 1
1: 0
2: 1
3: 7
4: 127
1103763840_1103763844 1 Left 1103763840 12:123268584-123268606 CCAGCTTGGGCTGGAACTGCAAA 0: 1
1: 0
2: 2
3: 16
4: 226
Right 1103763844 12:123268608-123268630 GTGGACTTGGATCCTGAACTGGG 0: 1
1: 0
2: 1
3: 7
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103763844 Original CRISPR GTGGACTTGGATCCTGAACT GGG Intronic