ID: 1103764165

View in Genome Browser
Species Human (GRCh38)
Location 12:123269985-123270007
Sequence CCTGAAGTCCTGTTCTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 1, 2: 3, 3: 24, 4: 250}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103764165_1103764176 21 Left 1103764165 12:123269985-123270007 CCAGCCCAGAACAGGACTTCAGG 0: 1
1: 1
2: 3
3: 24
4: 250
Right 1103764176 12:123270029-123270051 CCCTGTGACCCCAAACCCCGAGG 0: 1
1: 0
2: 0
3: 22
4: 269
1103764165_1103764178 22 Left 1103764165 12:123269985-123270007 CCAGCCCAGAACAGGACTTCAGG 0: 1
1: 1
2: 3
3: 24
4: 250
Right 1103764178 12:123270030-123270052 CCTGTGACCCCAAACCCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103764165 Original CRISPR CCTGAAGTCCTGTTCTGGGC TGG (reversed) Intronic
900180058 1:1307441-1307463 CCTGCAGTCCAGCTCTGGCCAGG - Intronic
901390954 1:8945726-8945748 CCAGAAGTGCTGTTATGGGGAGG + Intergenic
901829923 1:11886138-11886160 CCTAATGTCCTGGCCTGGGCAGG + Intergenic
902238870 1:15075074-15075096 CCTCTGGTCCTATTCTGGGCTGG - Intronic
902609057 1:17586628-17586650 GCTGAGCTCCTGGTCTGGGCCGG + Intronic
903516541 1:23914838-23914860 CCTAATGTCCAGTCCTGGGCTGG + Intergenic
903948216 1:26977703-26977725 CCTGAAGTCCTGTCCTGGGCAGG - Intergenic
904209016 1:28873562-28873584 GCTGAAGTCCAGCTCAGGGCAGG + Intergenic
904608205 1:31710290-31710312 AGAGAAATCCTGTTCTGGGCCGG + Intergenic
904744745 1:32703540-32703562 CCTGAAGCCCAGGTCTGGGAAGG - Intronic
905025549 1:34847048-34847070 CCTAAAGCCCTGTCCTTGGCTGG - Intronic
905236996 1:36557154-36557176 CCTGCAGCTCTGTCCTGGGCTGG + Intergenic
906378838 1:45318544-45318566 CCTCAAATCCTGTTGTGGGATGG - Intergenic
906480786 1:46197846-46197868 CCTGAAGTCATGGGCTGGCCAGG - Exonic
907245326 1:53104766-53104788 CCTGAACCCCTTTCCTGGGCTGG - Intronic
907283395 1:53365291-53365313 CCGAACGTCCTTTTCTGGGCCGG - Intergenic
907557713 1:55359168-55359190 CCTGAAGGCCTGTCCTATGCAGG + Intergenic
908350478 1:63282109-63282131 GCTGAACTCCTGTTCTGTACAGG - Intergenic
917695674 1:177520766-177520788 CCTCAAGTCCTGATCAGAGCAGG - Intergenic
917853599 1:179084718-179084740 CCAGAATACCTGCTCTGGGCTGG + Intronic
918827872 1:189350096-189350118 TCTGATTTCCTTTTCTGGGCTGG - Intergenic
919837509 1:201585145-201585167 CCTGAAGTCAGGCACTGGGCTGG + Intergenic
919942939 1:202300875-202300897 CATGAAGGCCTTTTCTGGGATGG - Exonic
920074466 1:203326344-203326366 ACTGAAGTCCTGCTCTTGGGGGG + Intergenic
920512297 1:206560247-206560269 CCTGAAGCTCTGTTCTAGCCAGG - Intronic
921297084 1:213714539-213714561 CCTGATGGCCAGCTCTGGGCTGG + Intergenic
922545437 1:226453257-226453279 CCAGAGGCCCTGTGCTGGGCTGG - Intergenic
923429679 1:233908020-233908042 CCTTAAAACCTCTTCTGGGCCGG - Intronic
924201764 1:241667685-241667707 TCTGAAGGCCTGTTCTGAGCTGG - Intronic
1063704686 10:8419482-8419504 CCTGCAGTGCTGGTCAGGGCAGG + Intergenic
1064042487 10:11980142-11980164 CCTGGAGTGCTGTGCTAGGCAGG - Intronic
1070820836 10:79353188-79353210 CCTGCAGTTCTGCTCTTGGCTGG + Intronic
1071525337 10:86355001-86355023 TCTCACTTCCTGTTCTGGGCTGG - Intronic
1073275380 10:102305873-102305895 TGTGAAGTACTGTTCTGGGCAGG + Intronic
1073959742 10:108912410-108912432 CCTCAAGTCCTGTGCTGCCCAGG - Intergenic
1074277910 10:112022469-112022491 CCTGAAGCCTTGGCCTGGGCTGG - Intergenic
1074869397 10:117564996-117565018 CCTGAAATCCAATGCTGGGCTGG - Intergenic
1075023484 10:118967634-118967656 CCTGAAGTCCGGTGCTGGGGTGG + Intergenic
1075165576 10:120065258-120065280 CCTGAGGTGCTGTTCATGGCTGG + Intergenic
1076119148 10:127921935-127921957 TCTGAAGCCCTGTGCTGGGCAGG + Intronic
1076280356 10:129241716-129241738 CCTGCTGTCCTGCACTGGGCAGG - Intergenic
1076703621 10:132288461-132288483 CAGGAAGTCCAGCTCTGGGCTGG - Intronic
1076999084 11:313622-313644 GCTGCAGTCCTGCTCTGTGCGGG - Intronic
1077043049 11:532988-533010 CCTGAACTCCAGGTCTGGCCAGG + Intronic
1077487485 11:2845750-2845772 CCTGGGCTCCTGCTCTGGGCAGG + Intronic
1078476223 11:11632682-11632704 CCCGAAATCCTGCCCTGGGCTGG + Intergenic
1081840792 11:46200116-46200138 CCTGAACACCTGCTCTGTGCTGG - Intergenic
1083301068 11:61739841-61739863 CCTGGAGTCCTGCTCAGGGCTGG - Intronic
1083927268 11:65815573-65815595 CCAGAAGTTCTGTTCTGTGCTGG + Intergenic
1084007533 11:66331246-66331268 CCTGATGCCCTGGTTTGGGCGGG + Intronic
1085089451 11:73697921-73697943 ACTGAAGTCCTACTGTGGGCTGG + Intronic
1085347771 11:75779295-75779317 CCTGAAGTCCAGGTGTGGGCTGG + Intronic
1086747707 11:90451096-90451118 CCTGAAGGCCTGTCCTTGACAGG + Intergenic
1088573934 11:111251460-111251482 ACTGAAGTCCACGTCTGGGCTGG + Intergenic
1090014285 11:123072061-123072083 CCAGAAGTCTAGCTCTGGGCTGG - Exonic
1091276672 11:134357495-134357517 CTTCAAGTCCTGTGCTGGGATGG - Intronic
1091825586 12:3510193-3510215 CCTGGGGTCCTGCTCTGGGGTGG + Intronic
1094818279 12:34206548-34206570 CTTGAACCCCTGTTCTGGCCCGG + Intergenic
1095099056 12:38162675-38162697 CCTGACCCCCTGTTCTGGCCTGG - Intergenic
1095493180 12:42757566-42757588 CGTGAAGACCTTTTCTGGGAGGG + Intergenic
1097921245 12:65076624-65076646 TCTGAATACCTGTTCTGTGCTGG + Intronic
1100467027 12:94855441-94855463 ACAAAAGTCCTGTCCTGGGCAGG + Intergenic
1103764165 12:123269985-123270007 CCTGAAGTCCTGTTCTGGGCTGG - Intronic
1103933139 12:124461046-124461068 CCTGAAGCCCTCCTTTGGGCCGG - Intronic
1105587665 13:21759922-21759944 GCTGAAGTCCTGGTGTTGGCAGG - Intergenic
1106420258 13:29580050-29580072 CCTGACTTCCTGTTTAGGGCTGG + Intronic
1107893557 13:44935895-44935917 CCTGCACTACTGTTCTGGACTGG + Intergenic
1108701211 13:52945838-52945860 CCTGAAATCAAGTTGTGGGCAGG + Intergenic
1108764896 13:53615376-53615398 CCTGAAATCCTTTTCTAAGCTGG - Intergenic
1113007209 13:105720504-105720526 ACTGAACACCTGTTCTGGTCTGG - Intergenic
1113879991 13:113619659-113619681 TCTGAAGTGCTGCTCGGGGCCGG + Intronic
1114399797 14:22399591-22399613 CCTGAAGGGCTGTTCTTGGGGGG - Intergenic
1114640654 14:24217583-24217605 CAAGAACTCCTGTTCTGGCCGGG - Intronic
1116825776 14:49672158-49672180 CCTGTAGTCATAATCTGGGCTGG - Intronic
1116857018 14:49961543-49961565 CCTGGAAACCTGTACTGGGCTGG - Intergenic
1117777664 14:59199113-59199135 CCTGAGATCCTGTTCTTGGCTGG + Intronic
1118443728 14:65833839-65833861 ACTGAAGTCCTGTACTATGCAGG + Intergenic
1118454355 14:65931214-65931236 CCTGAGTTCCAGTTCTGGGTCGG - Intergenic
1119549383 14:75497272-75497294 GCTGAAGGCCTCCTCTGGGCAGG - Intergenic
1119711917 14:76828571-76828593 CCTGGAGTCCTCCTCCGGGCTGG + Intronic
1122774867 14:104112658-104112680 CCTGAAGGCCTTTGTTGGGCAGG + Exonic
1125463985 15:39933416-39933438 CCGGTAGTCTTGTTCTGGGAAGG + Intergenic
1129668269 15:77591923-77591945 ACTGGAGTCCTGTGCTGGCCTGG + Intergenic
1129831767 15:78675471-78675493 CCTGAAGTCCTGGGCAGCGCAGG - Intronic
1129936459 15:79454172-79454194 CCTGGTGACTTGTTCTGGGCAGG + Intronic
1129994280 15:79991174-79991196 CATGATGCCCTGTTATGGGCAGG - Intergenic
1129997603 15:80020358-80020380 CTTAAATTCCTGGTCTGGGCTGG + Intergenic
1130971396 15:88736487-88736509 CCTCATGCCCTGTTCTGGGTGGG - Intergenic
1131048711 15:89333000-89333022 TCTGAGGTCCTGTTACGGGCTGG - Intronic
1132091921 15:98954145-98954167 CCTGATGTCCTGAACTGGACAGG - Intronic
1132356292 15:101173784-101173806 CCTGCACTGCTGTTCTGGGCTGG - Intergenic
1132514953 16:361918-361940 CCTGAAGTCCTCCTCTCAGCAGG - Intergenic
1133233376 16:4376737-4376759 CCTGAAGTCCTGTGCTGAAGGGG + Intronic
1133338255 16:5020609-5020631 CCTGACGAGCTGTGCTGGGCAGG - Intergenic
1136270802 16:29147100-29147122 TCTGAAGTCCTGACCGGGGCTGG - Intergenic
1136492897 16:30622140-30622162 CCTGAAGTCGGGTTGTGGCCTGG + Intronic
1137250403 16:46736922-46736944 CCTGAGGACCTGCTCTCGGCAGG - Intronic
1138594376 16:58022062-58022084 CCTCAGGTCCTGTGCTGGGGTGG + Intergenic
1140730242 16:77849821-77849843 GCTGAGGTTCTGTTCTGGGCGGG - Intronic
1142584024 17:959465-959487 TCTGAAGTCCTTTATTGGGCCGG - Intronic
1142679008 17:1534658-1534680 CCTGAATTACTCTGCTGGGCAGG - Intronic
1143343349 17:6231596-6231618 CCTGTAGTCCTGTGTGGGGCAGG + Intergenic
1147212197 17:38878179-38878201 GCGTGAGTCCTGTTCTGGGCAGG + Exonic
1147498142 17:40937166-40937188 CCTGAGATCCTGTTCTGAGCTGG - Intronic
1148496610 17:48056714-48056736 CCTGAATTTCTGTTTTGGGTTGG + Intronic
1148856562 17:50582195-50582217 CCTGAATTCCTTCTCTGGTCTGG - Intronic
1149784712 17:59425213-59425235 CTTGATGTGCTGTCCTGGGCAGG + Intergenic
1150849909 17:68694736-68694758 CCTGTAGACCTGTCCTGGGCAGG - Intergenic
1152103577 17:78316401-78316423 CTTGATGCCCGGTTCTGGGCAGG - Intergenic
1152736718 17:82000860-82000882 CCTGCAGCCCTGTGCTGGGCTGG + Intronic
1152807477 17:82363077-82363099 GCTGAGATCCTGTTCTTGGCTGG - Exonic
1154255016 18:12775022-12775044 CCTGATGTCATTTTCTGGTCTGG + Intergenic
1156457039 18:37300587-37300609 CCTGAGCTCCTGCTCTGGGCAGG + Intronic
1156468080 18:37360670-37360692 CCTGCAGGCTTCTTCTGGGCAGG + Intronic
1157746982 18:50144505-50144527 ACTGAAGTCCTGTTTTTGGATGG - Intronic
1158905350 18:62006047-62006069 CCTCCAGTCCTGTTATGGGAGGG + Intergenic
1160579348 18:79874845-79874867 CCTGAAGTCCCGGCCTGCGCTGG - Intronic
1161068335 19:2248858-2248880 TCTGGGGTCCTGTTCTGGGGAGG + Intergenic
1161383597 19:3979521-3979543 CCTGAAATCTTGTTCTGGCGGGG - Intronic
1161383968 19:3981237-3981259 GCTGAAGTCCTCAGCTGGGCAGG - Intronic
1161680712 19:5678426-5678448 TCTGAAGTCCTTTATTGGGCCGG + Exonic
1162262347 19:9543230-9543252 CCTCAAATCCTGTTGTGGGATGG - Intergenic
1162904133 19:13813402-13813424 CCTGCAGTCCTGGGCTGGTCTGG + Intronic
1163142308 19:15358081-15358103 CCTGAAGTCAGGTTGTGGGCTGG + Intronic
1163480977 19:17556060-17556082 CCCGCTGTCCTCTTCTGGGCGGG + Intronic
1163860977 19:19742694-19742716 GCTGAGGGCCTGTGCTGGGCCGG - Intergenic
1164833567 19:31341343-31341365 CCTGATGTCCTGTGGTGGTCTGG + Intronic
1164884051 19:31761738-31761760 CCTGCAGTCCTGGGCTTGGCAGG + Intergenic
1166529482 19:43534046-43534068 CCTGCAGTCCTGGAATGGGCGGG - Intronic
925093348 2:1172957-1172979 CCTGGTGTCCAGTTATGGGCTGG - Intronic
925224679 2:2172803-2172825 CCAGAAGCCCCGTGCTGGGCAGG + Intronic
926474696 2:13308253-13308275 CCTGCAGCCCGGGTCTGGGCGGG - Intergenic
927880273 2:26685438-26685460 CCTGAGGTCCAGGCCTGGGCAGG - Intergenic
927898522 2:26801915-26801937 CCTGAAATCCTCGGCTGGGCTGG + Intergenic
928623068 2:33110661-33110683 CCTGAAATCCCCTTCTGGGCTGG - Exonic
929549290 2:42879335-42879357 CCTGCAGTGCTGTTCTGAGGAGG + Intergenic
930692382 2:54377966-54377988 ACTAAGCTCCTGTTCTGGGCTGG - Intronic
931612835 2:64122137-64122159 CCTGAAGTAGTGTTCTTGGTGGG + Intronic
931789054 2:65647117-65647139 CCAGAAGCCCTGCTGTGGGCAGG + Intergenic
932707994 2:74041469-74041491 GCTGTAGTCCTGTTCAGGTCAGG + Intronic
933808644 2:86018226-86018248 TCTGAAGGCCTGGCCTGGGCGGG - Intergenic
936992478 2:118380818-118380840 CCTGATGGCCTATCCTGGGCAGG + Intergenic
944503755 2:200388620-200388642 CCTGTAGTCTTTTTCTGGGTGGG - Intronic
946601366 2:221363560-221363582 CCTGAAGTCGTGCTGTGTGCTGG - Intergenic
947445817 2:230161781-230161803 CCTGGAGTCCTGTGCTGGGAGGG + Intergenic
947731723 2:232435030-232435052 CCTGAGGTCCTGTCCTGGGGAGG - Intergenic
948523804 2:238558417-238558439 CAGGAAGTGCTGTTCTGGGCAGG - Intergenic
1169029821 20:2398428-2398450 CCTCATGTCAGGTTCTGGGCTGG + Intronic
1169160473 20:3373323-3373345 CCTGGTTTCCTGTACTGGGCAGG + Intronic
1169215138 20:3789193-3789215 CCTGAAGGACAGCTCTGGGCAGG - Intronic
1169532438 20:6500314-6500336 CCTGCAGTCATGTTTTGGGGTGG + Intergenic
1170571962 20:17637613-17637635 CCTATAGTCCTGGTCTGGGGAGG - Intronic
1172533624 20:35653288-35653310 CAGGCAGTCCTGTGCTGGGCAGG + Exonic
1172641038 20:36440663-36440685 GCTGAGGTCCAGGTCTGGGCTGG - Intronic
1172864497 20:38085301-38085323 CTTGAATTCCAGTTCTAGGCAGG + Intronic
1174038447 20:47682673-47682695 CTTGGATTTCTGTTCTGGGCTGG - Intronic
1176587886 21:8607288-8607310 CATGGAGTCATGTTCTAGGCAGG + Intergenic
1178032937 21:28548536-28548558 GCTGTAGTCCTGATCTAGGCTGG - Intergenic
1178597293 21:33966374-33966396 CCTGAAGTCCTAAGCTGGGTTGG - Intergenic
1178981816 21:37270687-37270709 TCTGAAGGCCTGTTGTCGGCTGG + Intergenic
1179163088 21:38913558-38913580 CCTGAACTTTTGTTCTGGGAAGG - Intergenic
1179243188 21:39609652-39609674 CCTGAAGTCCCGTTCTGGCAGGG + Exonic
1179439470 21:41382952-41382974 ACTGTGGTCCTGGTCTGGGCAGG + Intronic
1180270718 22:10584287-10584309 CATGGAGTCATGTTCTAGGCAGG + Intergenic
1180702239 22:17787837-17787859 CCTGAAGGCATCATCTGGGCAGG + Exonic
1180867088 22:19125991-19126013 CCTGAGGTCATGGTCTGGACTGG - Intergenic
1180981140 22:19878557-19878579 CCTGAAGGTCTGGTCTGGGATGG + Intronic
1181128949 22:20718134-20718156 TTTGAGGTCCTTTTCTGGGCTGG - Intronic
1181313937 22:21960130-21960152 ACTGAGCTCCTGCTCTGGGCAGG + Intronic
1181527218 22:23496893-23496915 ACTGAACTCCTGTCCTGAGCTGG - Intergenic
1181852158 22:25757303-25757325 CTTGAAGTCCTGGTCAGGCCAGG + Intronic
1182872879 22:33664098-33664120 ACTGAACACCTGTTCAGGGCAGG + Intronic
1183364717 22:37400710-37400732 CTTGAACTCCTGTTCTGGGCCGG - Intronic
949139470 3:614457-614479 CATGGAGTCATGTTCTAGGCAGG - Intergenic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
950570219 3:13795230-13795252 GCTGAAGTCATGGTGTGGGCAGG - Intergenic
950692311 3:14669642-14669664 GCTGGAGTCCTGGGCTGGGCTGG - Intronic
953036968 3:39220610-39220632 CCTGGAGTTCTAATCTGGGCTGG - Intergenic
953409670 3:42683557-42683579 CCTGCAGTCCAGGGCTGGGCTGG + Intergenic
953749564 3:45598850-45598872 CCTGTAGGCCTGGTCTGTGCTGG + Intronic
953920737 3:46949540-46949562 CCTGCAGCCCTGGACTGGGCAGG + Intronic
954670606 3:52289476-52289498 CCAGAAGGCGTGTTCTTGGCAGG + Intronic
954915081 3:54142036-54142058 CCTGAAGACCTGCTCTGGTCTGG + Intronic
956374098 3:68595573-68595595 TGTGAATTCCTGTTCTAGGCTGG - Intergenic
958762781 3:98328803-98328825 CCTCAGGTGCTGTTCAGGGCTGG - Intergenic
960323420 3:116265494-116265516 ACTGAAGTCATGTTCTGGCAGGG - Intronic
961870895 3:129987408-129987430 GCTTAAGTCTTGTGCTGGGCTGG + Intergenic
962030918 3:131599609-131599631 CCAGAAGTGGTGATCTGGGCTGG + Intronic
964154848 3:153572792-153572814 TCTGATGACCTGCTCTGGGCAGG - Intergenic
966850755 3:184163753-184163775 CCTGCATCCCTGTGCTGGGCTGG + Intronic
968637237 4:1686872-1686894 GCTGCAGGGCTGTTCTGGGCAGG + Intergenic
969530710 4:7728803-7728825 ACTGAACTTCTCTTCTGGGCTGG + Intronic
971099335 4:23445780-23445802 CCTGTAGACCTGTGCTGGTCTGG + Intergenic
973788630 4:54358232-54358254 CATGGAATCCTGGTCTGGGCTGG + Intergenic
975714093 4:77189121-77189143 CCTGAACTCATATTCTGAGCTGG - Intronic
975760900 4:77618752-77618774 CCACAAGACCTGTCCTGGGCTGG - Intergenic
976296461 4:83477630-83477652 CCTGAAGTCGTGTTTTGGCAAGG - Intronic
976428348 4:84932269-84932291 CCTGATTCTCTGTTCTGGGCTGG + Exonic
978746648 4:112202218-112202240 CCTGAATGCATGTTCTGAGCTGG - Intergenic
979429503 4:120611654-120611676 CCTGTGGTCCTTTTCTGAGCAGG + Intergenic
979943900 4:126800536-126800558 GCTGAAGTCCTCTCTTGGGCTGG - Intergenic
980416892 4:132501044-132501066 CCTGAAGTCCAGTCAGGGGCGGG - Intergenic
983219231 4:165028508-165028530 CCTGAAGTACTGTTCACGTCAGG - Intergenic
984557028 4:181226630-181226652 TCTTAAGTCCTGCTCTGGTCAGG + Intergenic
984850628 4:184149536-184149558 TCTGAAGGCCTGCCCTGGGCAGG + Intronic
985655132 5:1127490-1127512 TCTGAAGTCCAGGTGTGGGCAGG - Intergenic
986337089 5:6763344-6763366 TCTGAAGACCCGTTCCGGGCAGG - Intergenic
987622567 5:20354524-20354546 CCTGAAGTCCCATTTGGGGCAGG - Intronic
990652816 5:57921888-57921910 CCTGGTGTCCTCTTCTGGGCTGG + Intergenic
992359596 5:76023485-76023507 CTTGTACTCCTGTTCTGGGATGG - Intergenic
992678244 5:79127198-79127220 CCTGAAGGCCTGTTGGGAGCTGG + Intronic
994720049 5:103369949-103369971 ACTGAAGTCCTGTTCTTCGTGGG + Intergenic
995041492 5:107593291-107593313 ACTGAAGTCCGGTCCTGTGCTGG - Intronic
997244440 5:132334875-132334897 GCTGCAGTACTGTTCTGGGGAGG + Exonic
997385385 5:133468202-133468224 CCAGAGGTCCTGTGCTGGGTGGG - Intronic
998109283 5:139488566-139488588 CCGGAAGTGCTGGTCTGGGCTGG + Intergenic
998515727 5:142752207-142752229 CCTGGAATGCTGTTCTGGGTGGG + Intergenic
1001562241 5:172677344-172677366 TCTGAAGGCCTGTTCTATGCAGG + Intronic
1001684449 5:173582998-173583020 ACTGAAGTCCCCATCTGGGCGGG + Intergenic
1001964918 5:175903340-175903362 CCTGCAGACCTGTGCTGGGTAGG - Intergenic
1002061305 5:176627530-176627552 CCAGAGGGCCTGATCTGGGCTGG + Intronic
1002252037 5:177935848-177935870 CCTGCAGACCTGTGCTGGGTAGG + Intergenic
1002892644 6:1348945-1348967 CCTGAAGGCTTGTGCTTGGCAGG + Intergenic
1002915545 6:1525384-1525406 GCTGATGTCCTCTTCTGGGGAGG - Intergenic
1003195866 6:3914031-3914053 CCTGAAGGGCTGCTCTGGCCAGG + Intergenic
1005809141 6:29502965-29502987 TCTGAAATCCAGGTCTGGGCAGG + Intergenic
1005890943 6:30137204-30137226 CCGGAAGCCCTGTTCTGAGGAGG + Exonic
1006058722 6:31404110-31404132 CCTGAAGTCCTGTCCTCTCCCGG + Intronic
1006071207 6:31498995-31499017 CCTGAAGTCCTGTCCTCTCCCGG + Intronic
1006898194 6:37484034-37484056 CCTGCAGAGCTGCTCTGGGCAGG + Intronic
1007622572 6:43223961-43223983 CATGAAGTGCTGTGCTGGGAGGG + Intronic
1008125459 6:47663511-47663533 CAAGAAGTCATCTTCTGGGCCGG - Intronic
1010880982 6:81171401-81171423 ACTGAAGTACTTTACTGGGCAGG - Intergenic
1013606838 6:111758622-111758644 CCTGAACTCCTGTTCTCCACTGG + Intronic
1016736879 6:147488911-147488933 CCTCAAGTCCTGTTCTGGGAAGG - Intergenic
1023060431 7:36321441-36321463 CCTGAGGGCCTGTTATGGGAGGG - Intergenic
1023764782 7:43500393-43500415 CCTGAAAGACTGTTCTGGGGCGG - Intronic
1023877396 7:44294413-44294435 TCTGCATGCCTGTTCTGGGCTGG - Intronic
1027171213 7:75874072-75874094 CCTGAAGGCCTACTCTGTGCAGG + Intronic
1027214332 7:76174120-76174142 CCTGACCTCCAGTTCTGGTCTGG + Intergenic
1027214335 7:76174125-76174147 CCTCCAGTTCTGGTCTGGGCAGG + Intergenic
1029340667 7:99941286-99941308 CTAGATGTCCTTTTCTGGGCTGG - Intergenic
1029437621 7:100571931-100571953 CCAGGAGTTCAGTTCTGGGCTGG - Intergenic
1029569784 7:101361992-101362014 CCTGAAGCCCTTTTCTGGATAGG + Intergenic
1031371506 7:120973034-120973056 CCTGAAATACTCTTTTGGGCAGG - Intronic
1033550522 7:142443146-142443168 CCAGAGCTGCTGTTCTGGGCTGG + Intergenic
1034215441 7:149401985-149402007 CCATAAGACCTGTTCTGGGAAGG - Intergenic
1034746897 7:153530693-153530715 CCTGCACTCCTGTTGTGGGGGGG - Intergenic
1035045167 7:155960936-155960958 CCTGAAGGCCAGCTCAGGGCAGG - Intergenic
1036667207 8:10754957-10754979 CCTGACACCCTGGTCTGGGCTGG - Intronic
1038242220 8:25820424-25820446 CTTGACTTCCTGTTCTGCGCTGG + Intergenic
1039498871 8:38001398-38001420 CCTTAAATCCTGTTGTGGGATGG + Intergenic
1039840115 8:41286975-41286997 CCTGGAGGCCTGCACTGGGCAGG - Intronic
1040636738 8:49284036-49284058 CCTGAAGACCTAGTCTGGGCTGG - Intergenic
1046650576 8:116832977-116832999 TCTGGAGACCTGTTCTGGACAGG - Intronic
1048813856 8:138312750-138312772 GCTGAAGTCCTTCTCTTGGCAGG - Intronic
1049554251 8:143274329-143274351 CCTGCAGTGCTGCTCTGGACCGG - Intronic
1049610597 8:143553129-143553151 CCTGAAGTCCCGCCCTGCGCGGG + Intergenic
1050428764 9:5539774-5539796 CCTGAAGGCCTGGGCAGGGCAGG + Intronic
1055925940 9:81509826-81509848 CATGAAGTCCTTCTCAGGGCAGG - Intergenic
1057243287 9:93431917-93431939 CCTGACTTCCTGTTCTGCACGGG + Intergenic
1057516072 9:95722490-95722512 CAGGAAGGCCTGCTCTGGGCTGG + Intergenic
1057964403 9:99489083-99489105 ACAGAAGGCTTGTTCTGGGCAGG - Intergenic
1058747431 9:108005547-108005569 CCTGCTGTCCTGTCCTGGTCAGG - Intergenic
1061451069 9:130667188-130667210 CCTCAAGGCCAGTCCTGGGCTGG + Intronic
1062244204 9:135555591-135555613 GCTGTGGTCATGTTCTGGGCTGG - Intergenic
1062253260 9:135608762-135608784 TCTCATGTCATGTTCTGGGCCGG - Intergenic
1203617892 Un_KI270749v1:85872-85894 CATGGAGTCATGTTCTAGGCAGG + Intergenic
1185803455 X:3034497-3034519 CCTGAGCTCCTGTTCTCTGCAGG - Intergenic
1187122009 X:16418639-16418661 CCTGGAGTCTTGTTTTGAGCAGG - Intergenic
1187127755 X:16469923-16469945 CCTGGTGTCCTGGTCTGGGAGGG + Intergenic
1189469571 X:41303182-41303204 CCTCTGGTCCTGTTCTGAGCTGG + Intergenic
1190511316 X:51176621-51176643 CTTGAAGTTCAGTTCTGTGCAGG + Intergenic
1196733277 X:118962869-118962891 CCTGAAGTTGTGTTAGGGGCTGG + Intergenic
1197800840 X:130346560-130346582 CCTGAAGTCGTGTTTTGGTAAGG - Exonic
1199474356 X:148229315-148229337 GCTGAAGTCCTGTTCTTGGCAGG - Intergenic
1201518521 Y:14846085-14846107 CCTCAGGCCCTGTGCTGGGCTGG + Intergenic
1201787021 Y:17795778-17795800 CCTGAAATACTGTTCTCTGCAGG + Intergenic
1201814532 Y:18110210-18110232 CCTGAAATACTGTTCTCTGCAGG - Intergenic