ID: 1103764641

View in Genome Browser
Species Human (GRCh38)
Location 12:123271597-123271619
Sequence GATGTCTTACAAACCGAACT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 39}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103764641_1103764662 28 Left 1103764641 12:123271597-123271619 CCAAGTTCGGTTTGTAAGACATC 0: 1
1: 0
2: 0
3: 5
4: 39
Right 1103764662 12:123271648-123271670 GCGGGGCCAGGCCGCGAGGGCGG 0: 1
1: 1
2: 5
3: 62
4: 450
1103764641_1103764651 1 Left 1103764641 12:123271597-123271619 CCAAGTTCGGTTTGTAAGACATC 0: 1
1: 0
2: 0
3: 5
4: 39
Right 1103764651 12:123271621-123271643 CCCCGGGCGGCGGGCGCGCCGGG 0: 1
1: 0
2: 3
3: 62
4: 489
1103764641_1103764657 11 Left 1103764641 12:123271597-123271619 CCAAGTTCGGTTTGTAAGACATC 0: 1
1: 0
2: 0
3: 5
4: 39
Right 1103764657 12:123271631-123271653 CGGGCGCGCCGGGCGCGGCGGGG 0: 1
1: 2
2: 10
3: 125
4: 831
1103764641_1103764656 10 Left 1103764641 12:123271597-123271619 CCAAGTTCGGTTTGTAAGACATC 0: 1
1: 0
2: 0
3: 5
4: 39
Right 1103764656 12:123271630-123271652 GCGGGCGCGCCGGGCGCGGCGGG 0: 1
1: 7
2: 20
3: 154
4: 865
1103764641_1103764658 16 Left 1103764641 12:123271597-123271619 CCAAGTTCGGTTTGTAAGACATC 0: 1
1: 0
2: 0
3: 5
4: 39
Right 1103764658 12:123271636-123271658 GCGCCGGGCGCGGCGGGGCCAGG 0: 1
1: 1
2: 31
3: 248
4: 1623
1103764641_1103764661 25 Left 1103764641 12:123271597-123271619 CCAAGTTCGGTTTGTAAGACATC 0: 1
1: 0
2: 0
3: 5
4: 39
Right 1103764661 12:123271645-123271667 GCGGCGGGGCCAGGCCGCGAGGG 0: 1
1: 0
2: 1
3: 50
4: 381
1103764641_1103764646 -8 Left 1103764641 12:123271597-123271619 CCAAGTTCGGTTTGTAAGACATC 0: 1
1: 0
2: 0
3: 5
4: 39
Right 1103764646 12:123271612-123271634 AAGACATCCCCCCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 50
1103764641_1103764645 -9 Left 1103764641 12:123271597-123271619 CCAAGTTCGGTTTGTAAGACATC 0: 1
1: 0
2: 0
3: 5
4: 39
Right 1103764645 12:123271611-123271633 TAAGACATCCCCCCGGGCGGCGG 0: 1
1: 0
2: 2
3: 1
4: 21
1103764641_1103764660 24 Left 1103764641 12:123271597-123271619 CCAAGTTCGGTTTGTAAGACATC 0: 1
1: 0
2: 0
3: 5
4: 39
Right 1103764660 12:123271644-123271666 CGCGGCGGGGCCAGGCCGCGAGG 0: 1
1: 1
2: 4
3: 59
4: 452
1103764641_1103764654 6 Left 1103764641 12:123271597-123271619 CCAAGTTCGGTTTGTAAGACATC 0: 1
1: 0
2: 0
3: 5
4: 39
Right 1103764654 12:123271626-123271648 GGCGGCGGGCGCGCCGGGCGCGG 0: 1
1: 3
2: 29
3: 200
4: 1419
1103764641_1103764649 0 Left 1103764641 12:123271597-123271619 CCAAGTTCGGTTTGTAAGACATC 0: 1
1: 0
2: 0
3: 5
4: 39
Right 1103764649 12:123271620-123271642 CCCCCGGGCGGCGGGCGCGCCGG 0: 1
1: 1
2: 2
3: 44
4: 472
1103764641_1103764655 9 Left 1103764641 12:123271597-123271619 CCAAGTTCGGTTTGTAAGACATC 0: 1
1: 0
2: 0
3: 5
4: 39
Right 1103764655 12:123271629-123271651 GGCGGGCGCGCCGGGCGCGGCGG 0: 1
1: 6
2: 24
3: 224
4: 1460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103764641 Original CRISPR GATGTCTTACAAACCGAACT TGG (reversed) Exonic