ID: 1103764656

View in Genome Browser
Species Human (GRCh38)
Location 12:123271630-123271652
Sequence GCGGGCGCGCCGGGCGCGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1047
Summary {0: 1, 1: 7, 2: 20, 3: 154, 4: 865}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103764641_1103764656 10 Left 1103764641 12:123271597-123271619 CCAAGTTCGGTTTGTAAGACATC 0: 1
1: 0
2: 0
3: 5
4: 39
Right 1103764656 12:123271630-123271652 GCGGGCGCGCCGGGCGCGGCGGG 0: 1
1: 7
2: 20
3: 154
4: 865

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103764656 Original CRISPR GCGGGCGCGCCGGGCGCGGC GGG Exonic