ID: 1103764656 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:123271630-123271652 |
| Sequence | GCGGGCGCGCCGGGCGCGGC GGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 1047 | |||
| Summary | {0: 1, 1: 7, 2: 20, 3: 154, 4: 865} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1103764641_1103764656 | 10 | Left | 1103764641 | 12:123271597-123271619 | CCAAGTTCGGTTTGTAAGACATC | 0: 1 1: 0 2: 0 3: 5 4: 39 |
||
| Right | 1103764656 | 12:123271630-123271652 | GCGGGCGCGCCGGGCGCGGCGGG | 0: 1 1: 7 2: 20 3: 154 4: 865 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1103764656 | Original CRISPR | GCGGGCGCGCCGGGCGCGGC GGG | Exonic | ||