ID: 1103766505

View in Genome Browser
Species Human (GRCh38)
Location 12:123283967-123283989
Sequence CTGTGGGAGGGCAAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103766505_1103766516 -5 Left 1103766505 12:123283967-123283989 CCACCCACCTTGCCCTCCCACAG No data
Right 1103766516 12:123283985-123284007 CACAGTGCTGGGATTACAGGCGG 0: 19
1: 1668
2: 1844
3: 1351
4: 1631
1103766505_1103766513 -8 Left 1103766505 12:123283967-123283989 CCACCCACCTTGCCCTCCCACAG No data
Right 1103766513 12:123283982-123284004 TCCCACAGTGCTGGGATTACAGG 0: 2641
1: 295980
2: 261775
3: 149501
4: 132181
1103766505_1103766517 -4 Left 1103766505 12:123283967-123283989 CCACCCACCTTGCCCTCCCACAG No data
Right 1103766517 12:123283986-123284008 ACAGTGCTGGGATTACAGGCGGG 0: 30
1: 1872
2: 2759
3: 2305
4: 2305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103766505 Original CRISPR CTGTGGGAGGGCAAGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr