ID: 1103766516

View in Genome Browser
Species Human (GRCh38)
Location 12:123283985-123284007
Sequence CACAGTGCTGGGATTACAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6513
Summary {0: 19, 1: 1668, 2: 1844, 3: 1351, 4: 1631}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103766504_1103766516 11 Left 1103766504 12:123283951-123283973 CCTGGTCTCAAGCAATCCACCCA No data
Right 1103766516 12:123283985-123284007 CACAGTGCTGGGATTACAGGCGG 0: 19
1: 1668
2: 1844
3: 1351
4: 1631
1103766506_1103766516 -8 Left 1103766506 12:123283970-123283992 CCCACCTTGCCCTCCCACAGTGC No data
Right 1103766516 12:123283985-123284007 CACAGTGCTGGGATTACAGGCGG 0: 19
1: 1668
2: 1844
3: 1351
4: 1631
1103766501_1103766516 30 Left 1103766501 12:123283932-123283954 CCCAGGCTGGTCTCAAACTCCTG 0: 19126
1: 38854
2: 56666
3: 50459
4: 31838
Right 1103766516 12:123283985-123284007 CACAGTGCTGGGATTACAGGCGG 0: 19
1: 1668
2: 1844
3: 1351
4: 1631
1103766502_1103766516 29 Left 1103766502 12:123283933-123283955 CCAGGCTGGTCTCAAACTCCTGG 0: 18758
1: 81811
2: 152089
3: 186177
4: 177040
Right 1103766516 12:123283985-123284007 CACAGTGCTGGGATTACAGGCGG 0: 19
1: 1668
2: 1844
3: 1351
4: 1631
1103766507_1103766516 -9 Left 1103766507 12:123283971-123283993 CCACCTTGCCCTCCCACAGTGCT 0: 2
1: 870
2: 61667
3: 153526
4: 161703
Right 1103766516 12:123283985-123284007 CACAGTGCTGGGATTACAGGCGG 0: 19
1: 1668
2: 1844
3: 1351
4: 1631
1103766505_1103766516 -5 Left 1103766505 12:123283967-123283989 CCACCCACCTTGCCCTCCCACAG No data
Right 1103766516 12:123283985-123284007 CACAGTGCTGGGATTACAGGCGG 0: 19
1: 1668
2: 1844
3: 1351
4: 1631

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103766516 Original CRISPR CACAGTGCTGGGATTACAGG CGG Intergenic
Too many off-targets to display for this crispr