ID: 1103767765

View in Genome Browser
Species Human (GRCh38)
Location 12:123293901-123293923
Sequence CTGCACCTCCACCACTGGAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103767762_1103767765 -8 Left 1103767762 12:123293886-123293908 CCTCAGGTCCAGCGACTGCACCT 0: 1
1: 0
2: 1
3: 10
4: 187
Right 1103767765 12:123293901-123293923 CTGCACCTCCACCACTGGAGTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1103767760_1103767765 -1 Left 1103767760 12:123293879-123293901 CCCACTTCCTCAGGTCCAGCGAC 0: 1
1: 0
2: 2
3: 13
4: 126
Right 1103767765 12:123293901-123293923 CTGCACCTCCACCACTGGAGTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1103767759_1103767765 0 Left 1103767759 12:123293878-123293900 CCCCACTTCCTCAGGTCCAGCGA 0: 1
1: 0
2: 2
3: 17
4: 195
Right 1103767765 12:123293901-123293923 CTGCACCTCCACCACTGGAGTGG 0: 1
1: 0
2: 3
3: 26
4: 209
1103767761_1103767765 -2 Left 1103767761 12:123293880-123293902 CCACTTCCTCAGGTCCAGCGACT 0: 1
1: 0
2: 1
3: 23
4: 435
Right 1103767765 12:123293901-123293923 CTGCACCTCCACCACTGGAGTGG 0: 1
1: 0
2: 3
3: 26
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103767765 Original CRISPR CTGCACCTCCACCACTGGAG TGG Exonic
900485914 1:2922699-2922721 CTGAACCTGCAGCCCTGGAGAGG + Intergenic
900595459 1:3478316-3478338 CTGCCTCCCCACCACTGCAGGGG + Intronic
900895873 1:5482497-5482519 CTCCACCGCCACCTCGGGAGAGG + Intergenic
901069861 1:6511719-6511741 CTTCACCTCCAGGCCTGGAGTGG + Intronic
901214541 1:7548491-7548513 CAGCACCTCCACCCCTAAAGGGG - Intronic
901455155 1:9358890-9358912 CTGCACCTCCAGGACTGGGTGGG - Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
901789535 1:11647120-11647142 CTGCATCTCCACCACTGCACTGG + Intergenic
902540823 1:17153242-17153264 CCGCACCTCCAACACTGGCAGGG - Intergenic
902573705 1:17363403-17363425 CTGAGCCACCACCCCTGGAGGGG + Intronic
902809966 1:18882446-18882468 CTGCACCTCCCCCACAGGCCTGG + Intronic
904364097 1:29999603-29999625 CTGCACCTCCACAGCTGGGGTGG - Intergenic
905091657 1:35435191-35435213 CTGCACCTCCCAGCCTGGAGAGG - Intronic
906059195 1:42937260-42937282 CTGCACCTCCACCACCGTGCTGG - Intronic
907823922 1:57997292-57997314 CAGCACTTCCAGCACTTGAGAGG - Intronic
907946326 1:59139682-59139704 CAGCACCACCACCACTGCATAGG - Intergenic
908513568 1:64870019-64870041 GTGCACCTCCATCAGTGGGGGGG - Intronic
911043270 1:93608546-93608568 CAGCACCTCCAGGACTGCAGAGG - Intronic
911091769 1:94022872-94022894 CTGCACCTCCAGAACAGGTGCGG - Intronic
911433891 1:97830242-97830264 TTGGGCCTCCACCACTGTAGAGG + Intronic
912403579 1:109417508-109417530 CTGCACCTCCCCCACTCCCGTGG + Intronic
912591331 1:110824182-110824204 CAGCACCTGCTGCACTGGAGGGG + Intergenic
913672465 1:121110611-121110633 CTGCACCCCAGCCAGTGGAGAGG + Intergenic
914024229 1:143897975-143897997 CTGCACCCCAGCCAGTGGAGAGG + Intergenic
914662722 1:149806002-149806024 CTGCACCCCAGCCAGTGGAGAGG + Intronic
915306773 1:154984381-154984403 CTGTACCTCCTCTACTCGAGGGG - Intronic
919307161 1:195856392-195856414 CAGTGACTCCACCACTGGAGTGG - Intergenic
920184182 1:204150422-204150444 TTGTACCTCCACCACTGGATGGG - Intronic
920186443 1:204162200-204162222 CTGTACCTCCACCACAGTGGTGG + Intronic
920975236 1:210779840-210779862 CTGAACCTCCACTTCTGCAGTGG + Intronic
922250391 1:223844849-223844871 TTGCACCTCTCCCACTGAAGTGG - Intronic
924611305 1:245575994-245576016 CTGCACCTCCACTCCTGCAAAGG + Intronic
1063019397 10:2112246-2112268 GGGCATCTCCACCACAGGAGAGG + Intergenic
1063078234 10:2738303-2738325 CTGCAGCTCCAGCTTTGGAGAGG - Intergenic
1064876692 10:20002814-20002836 CTACACCTCAGCCACTGCAGAGG - Intronic
1067070667 10:43128788-43128810 CTTCCCCTCCAGCCCTGGAGGGG - Exonic
1067778026 10:49177005-49177027 CTGCACCTCCCCCTCTGGAAGGG - Intronic
1068299474 10:55120141-55120163 ATTCACCTCCACAACTGGAGTGG - Intronic
1070517971 10:77225667-77225689 CTGTGCCACCACCACTGAAGAGG + Intronic
1070561008 10:77566532-77566554 CTGAGCCCCCATCACTGGAGAGG + Intronic
1071149036 10:82611416-82611438 CAGCCCCTCCACCCCTGGACAGG + Intronic
1071721622 10:88152399-88152421 TGGCACATCCATCACTGGAGTGG - Intergenic
1073523766 10:104160040-104160062 CTGCACCTGCACCCATGAAGTGG - Intronic
1073625773 10:105095317-105095339 CTGCTCCTCCACCACTTGTCCGG - Intronic
1074874079 10:117600911-117600933 ACGCACTTCCACCACTGCAGGGG + Intergenic
1074930680 10:118122776-118122798 CTGGAGATCCACCATTGGAGTGG + Intergenic
1076259792 10:129056119-129056141 CTGCACGTGCTCCGCTGGAGCGG + Intergenic
1077094428 11:793277-793299 CAGCTCCCCCATCACTGGAGGGG - Intronic
1082868436 11:57920705-57920727 CTGCTGCTCTGCCACTGGAGTGG - Intergenic
1083629806 11:64089644-64089666 CATCACCTCCACCCCAGGAGTGG - Intronic
1084791429 11:71477504-71477526 CAGCACCTGCACCACTGCGGCGG - Intronic
1085596931 11:77819873-77819895 CTGCTCCTCCCCCACGGGAGGGG - Intronic
1086649035 11:89264168-89264190 CTGCATTTCCACCTCTGGATTGG - Intronic
1087287783 11:96284282-96284304 ATGGACCTGCACCTCTGGAGAGG - Intronic
1090744543 11:129695732-129695754 CTGCACCCTCAGCACTGGAGAGG + Intergenic
1092670203 12:10853658-10853680 CTGCACCTCAGGCACTGGAAAGG + Intronic
1093385370 12:18547295-18547317 CCGCACTGCCACCATTGGAGTGG - Intronic
1094398438 12:30034360-30034382 CTGCAGCTTGACCAATGGAGGGG - Intergenic
1095820545 12:46473825-46473847 CCGTATCTCCACCACTGGAGAGG - Intergenic
1096327005 12:50672411-50672433 CTGTTGCTCCACGACTGGAGAGG - Intronic
1097057607 12:56259067-56259089 CTTCCCCTCCTCCAATGGAGAGG + Intergenic
1097595264 12:61621121-61621143 CTGAAGCCCCACCACTGGGGAGG - Intergenic
1102046652 12:109833573-109833595 CTGCACCTCCCCCGCAGGGGAGG - Intergenic
1103086643 12:118066537-118066559 CTCCACCTGCACCCCTGGCGGGG - Exonic
1103767765 12:123293901-123293923 CTGCACCTCCACCACTGGAGTGG + Exonic
1104761057 12:131297776-131297798 CTGAACCGCCACCGCTGCAGAGG - Intergenic
1104818720 12:131663016-131663038 CTGAACCGCCACCGCTGCAGAGG + Intergenic
1105845785 13:24292498-24292520 CTGCACCTGCAGCTCTGGAGAGG + Intronic
1106945594 13:34824257-34824279 CAGCATCTCCACCACTAGACTGG - Intergenic
1107103253 13:36617062-36617084 GTGCACCTCCACTATTCGAGGGG + Intergenic
1107940029 13:45375276-45375298 CTGCACCTCCACCAAGGGCCTGG + Intergenic
1108065258 13:46571028-46571050 CTGCAAATCCACCAATGGAGAGG - Intronic
1111549212 13:89784678-89784700 CTGCACCTCCAACTCAGTAGCGG + Intergenic
1113222106 13:108116788-108116810 CTGCAGCTCTACCTCTGGAGAGG - Intergenic
1113500913 13:110773409-110773431 CTCCACCTCCACCAATGTTGTGG - Intergenic
1114344404 14:21780583-21780605 CCGCACCTCCCCCACTGCAGCGG - Intergenic
1115376945 14:32686812-32686834 CTGGAACTTCACCACAGGAGTGG - Intronic
1115814965 14:37153648-37153670 CTGAGGCCCCACCACTGGAGAGG - Intronic
1117077206 14:52116597-52116619 CTGCATCTCCACCAGTGTATAGG + Intergenic
1119484678 14:74979816-74979838 CAGCACATCCAGCAGTGGAGGGG + Intergenic
1119898031 14:78237462-78237484 ATCCATCTCCACCATTGGAGAGG - Intergenic
1120602772 14:86532513-86532535 CTTCAGCTCCATCCCTGGAGTGG - Intergenic
1120680132 14:87471286-87471308 CTGCAACTCCAGCTCTTGAGAGG - Intergenic
1121229345 14:92345169-92345191 TTGCACATCAACCAGTGGAGTGG + Intronic
1121354824 14:93205755-93205777 CTGCACCTACAAAACTGGAAAGG + Intronic
1121449401 14:93997863-93997885 CTGCATCCCCAGCTCTGGAGAGG - Intergenic
1121560675 14:94873268-94873290 CTGCTCCTCACCCACGGGAGTGG - Intergenic
1122120741 14:99552206-99552228 CTGCCCCTGCACCACTGGGGAGG + Intronic
1122693623 14:103542691-103542713 CAGCCCCTCCCCCTCTGGAGGGG + Intergenic
1122842935 14:104475623-104475645 CTGCAACTACCCCAGTGGAGTGG + Intronic
1202876024 14_KI270722v1_random:1045-1067 CTGCCCCCCCACCATTAGAGAGG - Intergenic
1124192594 15:27593498-27593520 TTGCATCTCCAGCACTGCAGTGG + Intergenic
1124685534 15:31778574-31778596 CAGCACCTGCAGCATTGGAGTGG - Intronic
1128156020 15:65392339-65392361 CTGCACCTTCAACTCTGCAGGGG + Exonic
1129371219 15:75096864-75096886 CTGCTACTCCAGCACAGGAGGGG + Intronic
1129458369 15:75687702-75687724 CTGCACCTCCAGCAGCGCAGTGG + Exonic
1131389569 15:92035785-92035807 CTGCATCCCCACCCCAGGAGAGG - Intronic
1132585403 16:704015-704037 CTCCTCCTGCACCACTGGTGGGG + Intronic
1132725628 16:1337109-1337131 CTGCACCTGCACCCATGCAGAGG + Intronic
1132745898 16:1436212-1436234 CCCCACCTTCCCCACTGGAGGGG - Intronic
1141606310 16:85155676-85155698 ATGCACCTCCATCACAGCAGAGG + Intergenic
1141659767 16:85435592-85435614 CTGCAACTCCTCCCCTTGAGTGG + Intergenic
1142058106 16:88013301-88013323 CCACACCTCCACCACTTCAGAGG - Intronic
1143057594 17:4173847-4173869 CTGCACCCCCACCCCTAGAATGG + Intronic
1143182832 17:4994426-4994448 CTGCACCTGCATGACTGGACGGG + Exonic
1144671277 17:17133974-17133996 CTTCAGCTCCACCAGAGGAGTGG - Intronic
1148670618 17:49407365-49407387 CAGCAGCTCCACCACTGAACAGG + Intronic
1151243919 17:72779761-72779783 CTGCACCTACATCTGTGGAGAGG + Intronic
1151785259 17:76272164-76272186 CAGCCCCTCCTCCAGTGGAGCGG + Intergenic
1151984230 17:77531699-77531721 CTGTATCTCCAGGACTGGAGAGG + Intergenic
1151984307 17:77532249-77532271 CTGTATCTCCAGGACTGGAGAGG - Intergenic
1151991029 17:77574368-77574390 CTGCTTCTCCCCCACAGGAGTGG - Intergenic
1152391393 17:80005969-80005991 CTTCAGATCCACCACTAGAGGGG + Intronic
1152439586 17:80297833-80297855 CTGTAATTCCAGCACTGGAGAGG + Intronic
1152530801 17:80917989-80918011 CTGCACCTCCACCACAAGGATGG + Intronic
1155228538 18:23751722-23751744 GTGTACCTCCAACACAGGAGAGG - Intronic
1157546413 18:48549760-48549782 TTTCTCCTCCTCCACTGGAGCGG - Intronic
1157725535 18:49960869-49960891 CTTCACCTTCACCACTTGGGAGG + Intronic
1159051090 18:63422119-63422141 CTGCGCCTCGACCACAGGCGCGG + Intronic
1160952367 19:1673914-1673936 ATCCAGCCCCACCACTGGAGAGG - Intergenic
1161121976 19:2532747-2532769 CTGCCTCTCAACCACTAGAGTGG + Intronic
1161428244 19:4216275-4216297 CAGCACCTCGGCCCCTGGAGGGG - Exonic
1161516277 19:4698338-4698360 CTCCAGCTCTACCACTTGAGTGG + Intronic
1161549616 19:4904634-4904656 CTGCATCTCCCCCATTGGATGGG + Intronic
1161709408 19:5839394-5839416 CTGGGTCTTCACCACTGGAGAGG + Exonic
1164485854 19:28655105-28655127 CAGCACCTCCGCCCCTGGAGGGG - Intergenic
1164707462 19:30330947-30330969 CTGCACTTCCAGCAATGGACTGG + Intronic
1164969047 19:32514920-32514942 ATTCACATCCCCCACTGGAGTGG - Intergenic
1165317502 19:35065718-35065740 CTGCATCTCCATCCCTGGGGTGG - Intronic
1166100017 19:40566154-40566176 GTGCACCTCCAGCACTGAGGAGG - Exonic
1202674637 1_KI270710v1_random:31765-31787 CTGCCCCCCCACCATTAGAGAGG + Intergenic
925043182 2:749760-749782 CTGCACCTCCCTCACTGATGTGG - Intergenic
925084482 2:1097240-1097262 CTGCACCTGCACCGCTGGCCGGG + Intronic
925733912 2:6943862-6943884 CTGCACCTCCATCTCTCTAGAGG - Intronic
925752849 2:7105303-7105325 GTGCACCTCCACCCCTGGGCAGG + Intergenic
926158047 2:10468926-10468948 GTTCACCCCCATCACTGGAGAGG + Intergenic
927300180 2:21503195-21503217 CTAGCCCTCCACCCCTGGAGAGG + Intergenic
927880948 2:26689833-26689855 CTGCTCATCCATCAGTGGAGGGG - Intergenic
936079825 2:109424381-109424403 CTGAAGCCCCACCACTGGACAGG - Intronic
938716652 2:134027798-134027820 CTGCAGCTGCACCCCTGCAGGGG + Intergenic
941644245 2:168023436-168023458 CTGCACCTCCACCACTGGGAAGG - Intronic
943476563 2:188364974-188364996 TTTGACATCCACCACTGGAGTGG + Intronic
943841980 2:192594988-192595010 CTGCTACACAACCACTGGAGGGG - Intergenic
947840514 2:233204601-233204623 CTGCACCTCCAGCACTCCAAGGG + Exonic
1168874687 20:1163339-1163361 CTGCCCCTCCACACCTAGAGCGG + Intronic
1169628668 20:7600645-7600667 AGGCACCTCTACCAATGGAGAGG + Intergenic
1169899961 20:10542929-10542951 CTGCATTTCCAGCACTGGAATGG - Intronic
1173902659 20:46602224-46602246 CTCCACCTCAGCCTCTGGAGTGG - Intronic
1174428154 20:50448053-50448075 CTGCACCCGGACCACTGCAGTGG - Intergenic
1175154841 20:56963709-56963731 CTGCTCCTCCACCCTGGGAGGGG - Intergenic
1175720329 20:61281743-61281765 CGCCACCTCCTCCCCTGGAGGGG + Intronic
1176237426 20:64060162-64060184 CTGCACCTCCTGCCCAGGAGGGG + Intronic
1176685437 21:9844699-9844721 CTCCACCTCCAGATCTGGAGAGG - Intergenic
1176867707 21:14063182-14063204 CTGCCCACCCACCACTGGAGGGG - Intergenic
1178344372 21:31812203-31812225 CTGCACCTCCACCCCAGGGAGGG - Intergenic
1179156972 21:38859283-38859305 CTGCAACCCCACCTCTCGAGGGG - Intergenic
1179915867 21:44477806-44477828 GAGCACCTGCACCACGGGAGAGG + Intergenic
1179915884 21:44477879-44477901 GAGCACCTGCACCACGGGAGAGG + Intergenic
1181112515 22:20610352-20610374 TGACACCTCCACCACTGGTGGGG + Intergenic
1181341366 22:22182429-22182451 CTCCTCCTCCACCACTGCAGAGG + Intergenic
1182043920 22:27259630-27259652 CAGCAGCTCCAGCCCTGGAGAGG - Intergenic
949185640 3:1188213-1188235 CTGCATCCCCAGAACTGGAGGGG + Intronic
952273370 3:31853828-31853850 CTGCTCCAGCACCACTGGACTGG - Intronic
954460272 3:50622628-50622650 TTGCACCTTCTCCACAGGAGAGG + Intronic
957730194 3:84125177-84125199 CCGCACCTACCCCACTGCAGTGG - Intergenic
961393863 3:126572414-126572436 CTGCTCCCACACCACTGCAGAGG - Exonic
961524182 3:127486105-127486127 CTGCAGCTCCGCCACTGCTGTGG - Intergenic
961571838 3:127804829-127804851 AGGCACCTCGACCCCTGGAGAGG + Intronic
962267918 3:133956407-133956429 CTGCATAGACACCACTGGAGAGG - Intronic
962577519 3:136768626-136768648 CTGTACCCCCACTGCTGGAGAGG - Intergenic
965604696 3:170486299-170486321 CATCATCGCCACCACTGGAGAGG - Exonic
968649869 4:1756268-1756290 CTGCACCCCCACCCCAGGAGGGG + Intergenic
969322966 4:6424158-6424180 CTGGAGCTCCAGCTCTGGAGAGG + Intronic
969671763 4:8593574-8593596 ATGCACCCCCACACCTGGAGAGG - Intronic
974240353 4:59238290-59238312 TTGCACTCCCACCACAGGAGTGG + Intergenic
975121645 4:70735226-70735248 CTCCACCTCCCCCTCAGGAGGGG - Intronic
979283063 4:118889057-118889079 CTGCATTTCCATGACTGGAGGGG + Exonic
980091291 4:128445774-128445796 AAGCACCTCCTGCACTGGAGGGG + Intergenic
980348892 4:131663169-131663191 CTCCACCTCCAGATCTGGAGAGG - Intergenic
982107565 4:152024122-152024144 CAGCACCCCCACCCCTGCAGGGG - Intergenic
982176538 4:152710331-152710353 CTGCTCCTCCAGGACTAGAGTGG + Intronic
982545030 4:156723880-156723902 CTGCACCTCCCCCACTGTAGTGG - Intergenic
985220557 4:187699185-187699207 CTGGGCCTCCATGACTGGAGAGG - Intergenic
985817194 5:2135724-2135746 CAGCACAGCCACCAGTGGAGGGG + Intergenic
986300806 5:6477003-6477025 GTGGACCTCCAGCACTGGTGTGG - Intronic
987301377 5:16600588-16600610 CTGCCCCGCCCCCACAGGAGAGG + Intronic
995400154 5:111731840-111731862 CTGCAGCGCCAACAGTGGAGAGG + Intronic
997592996 5:135086961-135086983 CAGCACCTCCAACTCTGGAGTGG - Intronic
999111019 5:149121474-149121496 CTGCACTACCTCCAGTGGAGAGG + Intergenic
999282922 5:150376604-150376626 CTGCATCTCCAGCACAGGTGAGG + Exonic
1002051895 5:176576071-176576093 CTGCACCTTCACCCCCGAAGAGG + Exonic
1003616780 6:7661431-7661453 CTGCCCCTCCACTACAGGAGAGG + Intergenic
1004635701 6:17465621-17465643 CTGTACCATCCCCACTGGAGTGG - Intronic
1008332361 6:50260159-50260181 GTGCACCTCCACCAGAGCAGTGG + Intergenic
1013619445 6:111873451-111873473 CTGCCCCTCCAGCTCCGGAGGGG + Exonic
1016936983 6:149454905-149454927 CTCCACCTCCACGGCTGCAGGGG + Intronic
1019452918 7:1108796-1108818 GTGCACCCCCCTCACTGGAGCGG + Intronic
1026450308 7:70523532-70523554 CTGCAGCTCCACCTAGGGAGAGG - Intronic
1027048496 7:75007006-75007028 CTGCACCCCCACCCATTGAGGGG - Intronic
1028640659 7:93039325-93039347 CTGCACCTCCCCCACTGCAGCGG - Intergenic
1029545580 7:101208802-101208824 CTGCACCTCCTCCTCTGGGAAGG + Intronic
1029990962 7:104962205-104962227 CTGCACATCCACAACTTGAAGGG + Intergenic
1032793482 7:135259381-135259403 TTGCACCTCCACAACTGCATGGG + Intergenic
1033638576 7:143237828-143237850 CAGCACCTCTACTGCTGGAGGGG + Intergenic
1036497073 8:9279295-9279317 CTGCACCCCAGCCCCTGGAGTGG + Intergenic
1040668536 8:49658926-49658948 CTGCACCCCCACCACAGCAGTGG - Intergenic
1041337602 8:56804621-56804643 CATCACCACCACCACTAGAGTGG + Intergenic
1048017763 8:130512839-130512861 ATGCACCTCCTCCATTGGACTGG - Intergenic
1048496943 8:134943145-134943167 CTTCACCTCCACCAATGGTGTGG + Intergenic
1048807097 8:138250943-138250965 CTGCACTTCCACCCCCGGAATGG - Exonic
1049011624 8:139891362-139891384 CTGCCCCTTCACCACTGGACAGG - Intronic
1049458008 8:142703861-142703883 CAGCGCCTCCACCACTGGAATGG - Exonic
1049744847 8:144258933-144258955 CTGCAGCTCCAGCACTGGCTGGG + Intronic
1049952710 9:660745-660767 CAGCAACTCTACCACTGGAAGGG + Intronic
1051707927 9:19900016-19900038 CTGAACCTTCACTACTTGAGGGG + Intergenic
1052892793 9:33719749-33719771 CTGCACCCTCAGCACTGGTGAGG + Intergenic
1053783874 9:41636908-41636930 CTCCACCTCCAGATCTGGAGAGG + Intergenic
1054171829 9:61847047-61847069 CTCCACCTCCAGATCTGGAGAGG + Intergenic
1054446690 9:65376060-65376082 CTCCACCTCCAGATCTGGAGAGG + Intergenic
1054665706 9:67733765-67733787 CTCCACCTCCAGATCTGGAGAGG - Intergenic
1055566053 9:77569404-77569426 TGGCCCCTCCAGCACTGGAGAGG - Intronic
1056675879 9:88677046-88677068 CTCCACATTCACCACTGGAGTGG - Intergenic
1056736001 9:89209771-89209793 CTCCACCTGCAGCACTGGTGTGG + Intergenic
1060591081 9:124817357-124817379 ATGCCACTCCACCACTGCAGTGG + Intergenic
1060933094 9:127501088-127501110 CTGCACCTCCAGCTCTGCAGGGG - Exonic
1185776835 X:2809968-2809990 ATGCAGCTCCACCTCTGGATGGG + Intronic
1186610872 X:11137065-11137087 CAGCACTTCCACCACTGGCTGGG - Intergenic
1189427011 X:40910714-40910736 CCCCACCTCCAACACTGGGGGGG + Intergenic
1190569617 X:51768235-51768257 CTGCACTTCGCCCACAGGAGAGG - Intergenic
1192343744 X:70284306-70284328 CTTCACCTCCACCAAAAGAGGGG + Exonic
1192386043 X:70671489-70671511 ATCCACTTCCAACACTGGAGAGG - Intronic
1195033440 X:100948759-100948781 CTGCGCCTCCCCCACAGGGGTGG + Intergenic
1195903588 X:109823038-109823060 CCACACCACCACCACTGCAGAGG + Intergenic
1196292510 X:113960061-113960083 CTGCACCCCCACCACTGATTTGG - Intergenic
1199303396 X:146238958-146238980 CTGCACCTGCACCAAAGAAGAGG - Intergenic
1200857856 Y:7958802-7958824 GTCCACCTCCACCACAGGATAGG - Intergenic
1201293159 Y:12441498-12441520 ATGCAGCTCCACCTCTGGACGGG - Intergenic
1201457927 Y:14191225-14191247 TTGCACCTCAGCCACTGGAGAGG - Intergenic
1201622829 Y:15979578-15979600 ATCCACCTGCACCACAGGAGAGG - Intergenic