ID: 1103774032

View in Genome Browser
Species Human (GRCh38)
Location 12:123352290-123352312
Sequence TTGGCTAATGCCATTTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103774032_1103774035 26 Left 1103774032 12:123352290-123352312 CCTACAAAAATGGCATTAGCCAA 0: 1
1: 0
2: 0
3: 17
4: 261
Right 1103774035 12:123352339-123352361 TTCGCTCTTGTTGCCCAAGGTGG 0: 8
1: 542
2: 11131
3: 34328
4: 28887
1103774032_1103774034 23 Left 1103774032 12:123352290-123352312 CCTACAAAAATGGCATTAGCCAA 0: 1
1: 0
2: 0
3: 17
4: 261
Right 1103774034 12:123352336-123352358 AGTTTCGCTCTTGTTGCCCAAGG 0: 91
1: 350
2: 350
3: 315
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103774032 Original CRISPR TTGGCTAATGCCATTTTTGT AGG (reversed) Intronic
903723830 1:25426319-25426341 CTGTGTAATCCCATTTTTGTAGG - Intronic
905833850 1:41099111-41099133 TTAGATAATCCCAGTTTTGTTGG - Intronic
907531917 1:55107878-55107900 TTTGTTAATGACAGTTTTGTGGG - Intronic
907548254 1:55281872-55281894 CTGGCTGATGCCAATTTTGAAGG + Intergenic
907704041 1:56817773-56817795 TTAGCTAATCACATTTTTATGGG - Intronic
909375345 1:74934999-74935021 TGGGTTAATGCCATTACTGTAGG + Intergenic
910121039 1:83790801-83790823 TTGGCTAAAGCCACATTTCTTGG - Intergenic
910159278 1:84256232-84256254 TTGGCCATGGACATTTTTGTGGG - Intergenic
910370801 1:86513280-86513302 TTGGCAAAAGCCGTTTGTGTAGG - Intergenic
912106460 1:106282974-106282996 TTAACTAATGCAATTTTTTTTGG + Intergenic
912158147 1:106947682-106947704 TTCTCTACTTCCATTTTTGTAGG - Intergenic
913343211 1:117780897-117780919 TGGGTTTATGCCATTATTGTGGG - Intergenic
914215332 1:145621888-145621910 TTGGTTATAGCCATTTTAGTTGG - Intronic
914467283 1:147942273-147942295 TTGGTTATAGCCATTTTAGTTGG - Intronic
916018441 1:160771732-160771754 TTGGTTAATGCCATTATCTTGGG + Intergenic
917886177 1:179387402-179387424 TGGACTAATGCCATTATTGCAGG - Intronic
918138054 1:181694485-181694507 TGGATTAATGCCATTATTGTGGG + Intronic
918393341 1:184089368-184089390 ATGGCTAAGGCCCTATTTGTTGG + Intergenic
918613423 1:186517256-186517278 CTGGCTATTGCCATGTTTCTAGG - Intergenic
919321726 1:196049335-196049357 TAGGCTTAAGCCTTTTTTGTGGG + Intergenic
919413387 1:197275349-197275371 TTGGTTAATACCACTTTTATTGG + Intronic
919698061 1:200599618-200599640 TAAGCAATTGCCATTTTTGTAGG - Intronic
919872642 1:201834543-201834565 TTGGATAATGCCATTCTTAGAGG - Intronic
919940360 1:202281945-202281967 TGGGCTAATGGCATTTGTGGTGG + Intronic
921883764 1:220282646-220282668 TGGATTAATGCCATTATTGTGGG - Intergenic
923334740 1:232958362-232958384 TTGGCACTTGCCATTTTTTTTGG + Intronic
924837188 1:247662348-247662370 TTTAATAATGCAATTTTTGTAGG + Intergenic
1063829985 10:9941565-9941587 TTGGCTCATGCAATTTTTGGAGG + Intergenic
1064238817 10:13605804-13605826 TTGACTAATTGCATTATTGTAGG + Intronic
1065578858 10:27151427-27151449 TGGACTAACGCCATTATTGTGGG + Intronic
1065678615 10:28205891-28205913 TAGATTAATGCCATTATTGTAGG + Intronic
1065795837 10:29307552-29307574 TTGGCTAATGCCAATATGGCAGG - Intronic
1065947125 10:30615085-30615107 TTGGCTAATGCCAATATGGCAGG + Intronic
1066148413 10:32587459-32587481 TAGATTAATGCCATTATTGTAGG - Intronic
1067187272 10:44041818-44041840 TTGGCCAGTGCCTTTTCTGTAGG - Intergenic
1068565150 10:58566681-58566703 TTGACTATGGCCATTTTTGCAGG + Intronic
1072362375 10:94672206-94672228 TTGACTAATGCCATATAAGTGGG - Intergenic
1072362651 10:94674818-94674840 TTGACTAATGCCATATAAGTGGG + Intergenic
1073771999 10:106745003-106745025 TTGGCTAATAAACTTTTTGTTGG - Intronic
1074046630 10:109845294-109845316 GTGGCCAATGCCCTTTTAGTAGG - Intergenic
1074751055 10:116587699-116587721 TTGGCTGAAGCCACTTTTGGGGG - Intergenic
1078509431 11:11974562-11974584 TGGATTAATGCCATTATTGTGGG - Intronic
1079551960 11:21710839-21710861 TTGGTTAAAGCAAGTTTTGTGGG - Intergenic
1079931332 11:26565842-26565864 TTGGCTAAGGCCAACATTGTAGG + Exonic
1081024529 11:37993773-37993795 TTGGCTTATGCCATGTTGGAAGG - Intergenic
1086767914 11:90722363-90722385 TCTGCTAAATCCATTTTTGTAGG - Intergenic
1086921548 11:92593483-92593505 TGGTCTAATCCCATTTTTGGAGG + Intronic
1087700647 11:101432734-101432756 TTGACTGAAGCCATTTTTGCAGG - Intergenic
1088966592 11:114728417-114728439 ATTCCTAATACCATTTTTGTTGG + Intergenic
1089629195 11:119773412-119773434 TTGGCACATGCCATTCATGTTGG - Intergenic
1090824863 11:130377697-130377719 TTTTCTAATGCCATCTTGGTTGG - Intergenic
1094049488 12:26203650-26203672 TTAGTTAATGCCATATGTGTAGG - Intronic
1094395777 12:30003736-30003758 TGGGTTAATGTCATTATTGTGGG + Intergenic
1095652247 12:44625350-44625372 TTGGTTGATGCCATTATGGTGGG - Intronic
1096050726 12:48605355-48605377 TTGCCTTCTGCCATGTTTGTAGG - Intergenic
1097495194 12:60322802-60322824 TTTGCTAATGCCTTTTTTTAAGG - Intergenic
1097955335 12:65479492-65479514 TTCTATAATGCCATTTATGTTGG + Intronic
1099603705 12:84774492-84774514 TAGCCTAATGACATTTTTGAAGG - Intergenic
1100152559 12:91758117-91758139 TTGGATTTTGCCATTTTTATTGG - Intergenic
1100164744 12:91903629-91903651 TAGGTCAATGCCATTATTGTGGG - Intergenic
1100312414 12:93408924-93408946 TTGGGTTATGACATTTTTCTTGG - Exonic
1100962382 12:99977069-99977091 TGGATTAATGCCATTATTGTGGG - Intronic
1101058087 12:100940436-100940458 TTGGCTGAAGCCATTTTTGAAGG + Intronic
1103068700 12:117922215-117922237 TTGGCTGATGAAAATTTTGTAGG - Intronic
1103774032 12:123352290-123352312 TTGGCTAATGCCATTTTTGTAGG - Intronic
1104061898 12:125275710-125275732 TTGGCTAATGTGTTTTTTTTGGG + Intronic
1106386987 13:29296465-29296487 GTGGCTAATGCCACTTTGGGAGG - Intronic
1107408799 13:40139638-40139660 TTGGAAACTGCCATTTTTATGGG - Intergenic
1110298942 13:73902918-73902940 TTGGTTAATGCCATTTCTTTTGG + Intronic
1110896396 13:80757904-80757926 TTGGCTAAAGCAATCTTTATAGG + Intergenic
1112243960 13:97711379-97711401 TGGGCTAATTGCATTTTTCTAGG - Intergenic
1112398195 13:99052574-99052596 ATGGCTATTGCCCTTTTTTTTGG + Intronic
1114360654 14:21968496-21968518 TTGGCTAAGGTCAATTTTCTAGG + Intergenic
1117285967 14:54286105-54286127 AAGGGTAATGCCATTTATGTTGG - Intergenic
1118894850 14:69937263-69937285 TTGCCTAATCCCATGTTTGAGGG + Intronic
1119428964 14:74553315-74553337 TTAGAAATTGCCATTTTTGTAGG + Intronic
1126673730 15:51139320-51139342 TTGGCTATGGCCATCTTAGTAGG + Intergenic
1126769001 15:52036524-52036546 TGGGTTAATGTCATTATTGTGGG - Intronic
1131129916 15:89891694-89891716 TTGGTTAAAGACATTTTAGTGGG - Intronic
1135426961 16:22346451-22346473 TTGGTTAATGACATTTCTTTTGG + Exonic
1135912168 16:26571429-26571451 TGGACTAATGCCATTATTGTGGG - Intergenic
1138628787 16:58276554-58276576 ATGCCTAAAGACATTTTTGTGGG - Intronic
1138826488 16:60326669-60326691 TTGGCTCATTCCACTTTTGCTGG + Intergenic
1139254255 16:65526117-65526139 TTGCCTAATTCCACTCTTGTAGG - Intergenic
1139432984 16:66921054-66921076 TTGGCTAATTCAGTTTTGGTGGG - Intergenic
1140689755 16:77470320-77470342 TGGGCTAATGCATTCTTTGTAGG - Intergenic
1141320046 16:82999917-82999939 GTGTCTAATGACATTTTTGGTGG + Intronic
1141767647 16:86069575-86069597 TTGGCTAATGCTATCATTTTGGG + Intergenic
1143775210 17:9194898-9194920 TAGGAAATTGCCATTTTTGTGGG - Intronic
1144446841 17:15339100-15339122 TGGAATAATGCCATTATTGTGGG + Intronic
1148656012 17:49284157-49284179 TTAGCCAATGACATTTTTCTAGG - Intergenic
1149440934 17:56673322-56673344 TTGATTAATGCCATTATTGCAGG - Intergenic
1149991137 17:61384198-61384220 TTGGCTGATGCCATTTAGGGTGG - Intronic
1153116829 18:1667819-1667841 TTGGCTTCTGCCATTTCTATGGG - Intergenic
1153447189 18:5187589-5187611 TGGGTTAATGCCATTATTGTAGG - Intronic
1156208138 18:34908073-34908095 TTGGCTGATGCCATATCTGGTGG - Intergenic
1156352940 18:36316408-36316430 TTGGGCAATGCCCTTTTTGCTGG - Intronic
1158485078 18:57859005-57859027 TGGATTAATGCCATTATTGTGGG + Intergenic
1158806553 18:60980467-60980489 TTGATTAATGCTGTTTTTGTGGG - Intergenic
1159214220 18:65368701-65368723 TTAGCTAATTCCATTTATTTTGG + Intergenic
1159368391 18:67500355-67500377 TTGTCTAATGTGATGTTTGTAGG - Intergenic
1159614564 18:70566550-70566572 TTTTCTCATGCCATTTTTATGGG + Intergenic
1162637896 19:11984764-11984786 TTGGGTACTACCATTTTGGTGGG + Intergenic
1163182159 19:15612101-15612123 TTAGATAATCCCAATTTTGTTGG - Intergenic
927378328 2:22445620-22445642 TTGGCTGAAGTCATGTTTGTTGG + Intergenic
928382319 2:30829344-30829366 ATGGCTAATGGCATTTATGGGGG + Intergenic
929682518 2:44005915-44005937 TTGGCTAAAGTCATTCTTTTTGG + Intergenic
930240919 2:48934954-48934976 ATGGCTAATACCAAGTTTGTTGG - Intergenic
930410936 2:51026570-51026592 TCGGCTAATGACATTTATCTGGG - Intronic
930499764 2:52199204-52199226 TTTTATAATGCCATTTATGTGGG - Intergenic
930598576 2:53417440-53417462 TTGGCAAATGTCAAATTTGTAGG + Intergenic
930708707 2:54529784-54529806 TTGGATGATCCCAATTTTGTTGG - Intronic
930746859 2:54893444-54893466 TGGATTAATGCCATTATTGTAGG - Intronic
931572934 2:63688884-63688906 TGGATTAATGCCATTATTGTGGG + Intronic
931641031 2:64381158-64381180 TTTGCTGAAGCAATTTTTGTTGG + Intergenic
932634355 2:73375094-73375116 TGGATTAATGCCATTATTGTAGG + Intergenic
934081661 2:88473560-88473582 TTGGCTACTGCCATGTTTCCTGG + Intergenic
934870834 2:97863705-97863727 TTGGATAAAGCCATTTTAATTGG - Intronic
936154048 2:110036875-110036897 TCTGCTAATGCCATCTTTGCAGG - Intergenic
936190636 2:110334540-110334562 TCTGCTAATGCCATCTTTGCAGG + Intergenic
936986912 2:118320018-118320040 TTTGCTAATGGCATTTTTAAGGG - Intergenic
937078125 2:119121797-119121819 CTGGGCAATGCCATTTATGTTGG - Intergenic
938819748 2:134945014-134945036 TTGGCTAATGTCATTTTACAGGG + Intronic
939543800 2:143527110-143527132 TTGGAAAATGTCATTTTTTTTGG - Intronic
939948392 2:148438648-148438670 TTGGCTAATGCTATTATGATGGG + Intronic
940094044 2:149953317-149953339 TTGGATTATGCCATTATTGTGGG - Intergenic
941575071 2:167219929-167219951 TTGGTTTAGGCCATTTTTGGGGG - Intronic
941859724 2:170266418-170266440 TGGGCTAATTACATTTTTGTAGG + Intronic
941944148 2:171076257-171076279 TGGATTAATGCCATTATTGTGGG + Intronic
942434042 2:175951632-175951654 TTGGTTAATGACATTTGGGTTGG + Intronic
943489798 2:188536713-188536735 ATGGCCAATGCCATTTTTCAGGG - Intronic
945755894 2:213846498-213846520 TTTACTAATGACATTTTTATTGG - Intronic
946453583 2:219801897-219801919 TGGATTAATGCCATTTTTGAGGG - Intergenic
1169355227 20:4899645-4899667 TTGGCCGATGCCATGTGTGTGGG - Exonic
1169478502 20:5954580-5954602 TGTGCTAATGCCATATTTGTTGG + Intronic
1169616902 20:7457938-7457960 TGGATTAATGCCATTATTGTGGG + Intergenic
1170195324 20:13683310-13683332 TGGACTAATGTCATTATTGTGGG + Intergenic
1170311983 20:15002294-15002316 TTGGCTATGGCCATTCTTTTAGG + Intronic
1170841293 20:19926591-19926613 TTGGGTAATGCGGTTTTTTTAGG + Intronic
1170913014 20:20593644-20593666 TTGGCAAATGCCATTTTTTATGG + Intronic
1172181668 20:33007576-33007598 TTGGCAAAGGCCATGTTTGCAGG + Intergenic
1175031755 20:55961726-55961748 TTGGCTAATGAAATGTTTGTAGG - Intergenic
1176719819 21:10384012-10384034 TTGGCCGATGTCATTTTTGGGGG + Intergenic
1178264584 21:31131163-31131185 TAGGTTAATTCCATTTATGTAGG - Intronic
1179020452 21:37635900-37635922 TCACCTAATTCCATTTTTGTTGG + Intronic
1180632664 22:17240560-17240582 ATGGATAATGCCATCTTTCTAGG + Intergenic
1181986755 22:26805291-26805313 CAGGCTATTGCCATTTTTGGAGG + Intergenic
1183138321 22:35911978-35912000 TTTGTTAATTCCATGTTTGTAGG + Intronic
1183325817 22:37193125-37193147 ATGGCTAATGGCAGTTTTGTGGG - Intronic
1183480635 22:38062883-38062905 ATGGCTATTGCCATTCTTATTGG + Intronic
1183729862 22:39612113-39612135 TGGATTAATGCCATTATTGTGGG + Intronic
950504554 3:13386598-13386620 CTGGGTAATGCCCTTTTTCTGGG - Intronic
951763798 3:26174146-26174168 TTGATTACGGCCATTTTTGTAGG + Intergenic
951786704 3:26428520-26428542 TTAGCCAATACCATTTTAGTAGG + Intergenic
951845832 3:27083289-27083311 TTAGCTCAGGCCATTTCTGTGGG + Intergenic
952803223 3:37317646-37317668 TTAGATAATGCCATCTTTATTGG - Intronic
953307344 3:41842508-41842530 TGGCTTAATGCCATTCTTGTGGG + Intronic
954782079 3:53069265-53069287 TAGGCTAATGTCAGTGTTGTGGG + Intronic
955090090 3:55742069-55742091 GTGGCTAAAACCATTTTTTTTGG - Intronic
956401339 3:68883221-68883243 TTGGCAAAAGCCATTTTCTTGGG + Intronic
956821379 3:72957364-72957386 TTGGAGAATGCCTTTTGTGTAGG + Intronic
957892236 3:86375483-86375505 TTAGAAAATGCCATTTTTGTTGG - Intergenic
959828627 3:110832919-110832941 TTGTCTTATGCCAGTTTTCTAGG + Intergenic
960497420 3:118391832-118391854 TTAGCTAATGATTTTTTTGTGGG - Intergenic
960610554 3:119551413-119551435 TGGATTAATGCCATTTTTTTGGG + Intronic
960806668 3:121590353-121590375 TGGATTAATGCCATTATTGTGGG + Intergenic
961604037 3:128080448-128080470 TTGGCTGAGGTCATGTTTGTCGG - Intronic
961656877 3:128447626-128447648 TGGTCTCATGCCACTTTTGTGGG + Intergenic
963711203 3:148749617-148749639 TTTTGTAATGCCATTTTTGGGGG - Intergenic
963954729 3:151241254-151241276 TTTGGTATTGCCATTTTTGAAGG - Intronic
964306553 3:155347257-155347279 TGGATTAATGCCATTGTTGTAGG - Intergenic
964575310 3:158159903-158159925 TTGCTTAATGCCATGTATGTGGG + Intronic
965065989 3:163849693-163849715 TTGATTATGGCCATTTTTGTAGG - Intergenic
965514229 3:169603791-169603813 TTAGACAATGCCATTGTTGTGGG - Intronic
965745845 3:171925246-171925268 TTGATTATGGCCATTTTTGTGGG - Intronic
966046035 3:175550864-175550886 TTGGCTGATGCCATTTAGTTTGG + Intronic
966158487 3:176944271-176944293 TTGATTATGGCCATTTTTGTAGG - Intergenic
966815909 3:183889665-183889687 CTGGCTAATGCTATTGCTGTGGG + Intergenic
966858041 3:184209658-184209680 TGGGCTAATTTTATTTTTGTAGG + Intronic
970792293 4:19873017-19873039 TGGGTTAATGCCATTATTGAGGG + Intergenic
971115267 4:23638964-23638986 TTGACTATTGCCATTCTTGCAGG + Intergenic
971262542 4:25070221-25070243 TTGGCTACTGCTATTTTTGGTGG + Intergenic
971682595 4:29720266-29720288 TTGGATAATACCATTATTTTAGG + Intergenic
974438796 4:61890607-61890629 TGGATTAATGCCATTATTGTGGG - Intronic
974874413 4:67685701-67685723 TTGATTAATACCATTATTGTAGG + Intronic
974916140 4:68181251-68181273 TTGACAATTCCCATTTTTGTGGG - Intergenic
976708697 4:88045645-88045667 TTGTCAAATGCCCATTTTGTAGG - Intronic
976852352 4:89561866-89561888 TTGGCTAATTTCAATTTTTTTGG + Intergenic
977415473 4:96727392-96727414 TTGGCTTATGCAAATTTTGGAGG - Intergenic
977527177 4:98159563-98159585 ATGGCTAATGGCATTTATGGGGG + Intergenic
978008423 4:103648964-103648986 TTGGATAAAGCCATTTTAGTTGG + Intronic
978009963 4:103668472-103668494 GTGGCTGTTGCAATTTTTGTTGG + Intronic
979490574 4:121322363-121322385 TTTTCAAATGCCATATTTGTAGG - Intergenic
980799252 4:137727728-137727750 TTGACAAAAGCCATTTTAGTTGG + Intergenic
981124103 4:141085903-141085925 TAGTCTAATGCCATTTCAGTGGG + Intronic
981523664 4:145690949-145690971 CTGGCTAATTCTTTTTTTGTGGG - Intronic
982878889 4:160685930-160685952 TTGGCAAGTGCCATTTTGCTGGG - Intergenic
984766744 4:183405702-183405724 TTGGAAAATGCTATTTTTATTGG - Intergenic
987041891 5:14070656-14070678 TGGATTAATGCCATTATTGTGGG - Intergenic
987734430 5:21822285-21822307 TTGGCTATTGCCATTCTGATAGG - Intronic
988134675 5:27155544-27155566 TTGATTATGGCCATTTTTGTAGG + Intergenic
988314894 5:29611952-29611974 TTAGGTGATTCCATTTTTGTGGG - Intergenic
988343283 5:30003683-30003705 TGGATTAATGCCATTATTGTGGG - Intergenic
991100865 5:62791128-62791150 TAGACTAATGCCATTATTTTGGG + Intergenic
992603345 5:78427715-78427737 TTGATTATTGCCATTTTAGTGGG + Intronic
992991259 5:82286081-82286103 TTGGTTCATGCCTTATTTGTGGG - Intronic
993227795 5:85190484-85190506 TGGGCTAATAGCATTTTTGGTGG + Intergenic
993761533 5:91802024-91802046 TTGCCTAATGTCTTTTATGTAGG - Intergenic
995065281 5:107855128-107855150 CTGGCTACTGCCATTGCTGTGGG - Intergenic
995585415 5:113643328-113643350 TGGATTAATGCCATTGTTGTAGG + Intergenic
995920071 5:117301405-117301427 TGGTCCAAGGCCATTTTTGTTGG - Intergenic
996040061 5:118799301-118799323 TTTGCTAAGCCCATTTTGGTTGG + Intergenic
996227645 5:121020375-121020397 TTGGTTAATACCATTTATTTAGG - Intergenic
996363953 5:122680247-122680269 TGGATTAATGCCATTATTGTGGG + Intergenic
997657357 5:135565289-135565311 TTGGCTTATGACATTTTTTTTGG + Intergenic
997910898 5:137872177-137872199 TGTGAGAATGCCATTTTTGTAGG - Intronic
999222314 5:149990582-149990604 CTGACTAATTTCATTTTTGTAGG + Intronic
1000773044 5:165380963-165380985 TGGAATAATGCCATTATTGTAGG - Intergenic
1000951839 5:167493487-167493509 TTGGCTCATAGAATTTTTGTGGG + Intronic
1003629669 6:7775046-7775068 TGGATTAATGCCATTATTGTGGG - Intronic
1003674295 6:8188770-8188792 TAGGCTGATCCTATTTTTGTAGG + Intergenic
1004545530 6:16594916-16594938 TTAGTTAATGCCATGTTTGAAGG - Intronic
1004708181 6:18144131-18144153 GTGGCTAATGCCTATTTTATTGG - Intronic
1006852955 6:37112614-37112636 TGGATTAATGCCATTGTTGTGGG - Intergenic
1011254612 6:85407681-85407703 TTGGCTAATGCTGCTCTTGTGGG + Intergenic
1013004015 6:106053767-106053789 TTGGCTAATGTCCTTTTTCGTGG + Intergenic
1015291825 6:131546250-131546272 TTGCATAATGCCAATTTTGGTGG + Intergenic
1016218476 6:141633886-141633908 TTGTCTAATTCCATTTTTCCAGG - Intergenic
1018006047 6:159622962-159622984 TGGATTAATGCCATTATTGTGGG - Intergenic
1019347364 7:537674-537696 TTGGCCAATGTCTTTTTTGGGGG - Intergenic
1019565325 7:1676110-1676132 TTGGCTAATGCCATCTCCCTTGG - Intergenic
1019656568 7:2199146-2199168 TTTGCAAATGCCATTTTGGCAGG - Intronic
1019796366 7:3052148-3052170 TTGTATACTGACATTTTTGTAGG - Intergenic
1019946047 7:4330211-4330233 TTGGCTACATCCATTTTGGTTGG - Intergenic
1020743111 7:12047087-12047109 TTGCCTTAAGCCATTTTTTTAGG - Intergenic
1020857474 7:13448161-13448183 TTGACTAATGCCATATATATGGG - Intergenic
1023629298 7:42147770-42147792 TTGCCTATTCCCATTTTTGATGG - Intronic
1024660484 7:51488247-51488269 TGGATTAATGCCATTATTGTGGG + Intergenic
1027708167 7:81561776-81561798 TTTGATAATGCTATTTTTGCAGG - Intergenic
1028058510 7:86279215-86279237 TAGGATAATGCTATCTTTGTAGG + Intergenic
1028163770 7:87514929-87514951 CTGGCTACTTCCATTTTTGTTGG + Intronic
1028394637 7:90354241-90354263 TTACTTAATGCCATTTTAGTGGG + Intronic
1028775214 7:94668405-94668427 ATGAATAAAGCCATTTTTGTTGG - Exonic
1030126446 7:106156875-106156897 TTTGCTTCTGCCATTTTTCTGGG - Intergenic
1030280369 7:107768396-107768418 TTGAGAAATCCCATTTTTGTAGG + Intronic
1038970032 8:32622905-32622927 TTGGAAAATGCCCTTATTGTTGG + Intronic
1039895431 8:41713558-41713580 TTAGATAGTGGCATTTTTGTAGG - Intronic
1040674992 8:49738228-49738250 TTTGTTAGTGCCATTTTAGTAGG - Intergenic
1040786256 8:51167311-51167333 TATGCTAATGCCACTTTTCTGGG - Intergenic
1041882158 8:62764106-62764128 TTGGCTGATGCCCTTTGGGTTGG + Intronic
1044360224 8:91274561-91274583 TGGACTAATGCCATTATTGAGGG - Intronic
1045165315 8:99598035-99598057 TTGGCTAACTCCATGTTTGAGGG + Intronic
1046105824 8:109665058-109665080 TTGGCTCATTACATTTCTGTTGG - Intronic
1046173275 8:110541723-110541745 TTTGCTTATGCCAGTTTTGTAGG + Intergenic
1046942182 8:119941977-119941999 TTGGCTCATGCCAACTTTTTGGG + Intronic
1048057210 8:130878873-130878895 TTGGATATGGGCATTTTTGTGGG - Intronic
1050229235 9:3501148-3501170 TTGGCAAATTCCAGTTTTCTTGG + Intronic
1050732034 9:8720029-8720051 TTGCCTTAAGCCATTTTTGAAGG - Intronic
1050887808 9:10787289-10787311 TTGTCTAATGCCTTGTTTTTAGG - Intergenic
1051084170 9:13328858-13328880 TTAGCTCTTGGCATTTTTGTGGG + Intergenic
1051367084 9:16328883-16328905 CTGGATAGTGCCATTTTTGGAGG + Intergenic
1052431949 9:28377718-28377740 TTTAATAATGCCATTTTTCTAGG + Intronic
1055013207 9:71589616-71589638 TGGTCCAATGCCATTTTTGCCGG + Intergenic
1057050317 9:91918523-91918545 TAGGAAACTGCCATTTTTGTAGG + Intronic
1060739274 9:126087611-126087633 TGGATTAATGCCATTATTGTGGG - Intergenic
1188032735 X:25282453-25282475 TGGATTAATGCCATTATTGTGGG + Intergenic
1192186599 X:68951253-68951275 TAGATTAATGCCATTATTGTGGG - Intergenic
1192991459 X:76462499-76462521 TTGATTATTGCCATTTTTGCAGG + Intergenic
1193431949 X:81418746-81418768 TGGACTAATGACATTATTGTGGG - Intergenic
1194193669 X:90866324-90866346 TTGGCTATTGATATTTGTGTGGG - Intergenic
1195048106 X:101072812-101072834 TAGCCTAATGCCATCTTTATTGG + Intergenic
1195320764 X:103719996-103720018 TGGGCCAATGCACTTTTTGTTGG - Intronic
1195770442 X:108345655-108345677 GGGGCTAATGCAAATTTTGTGGG + Intronic
1196081122 X:111632296-111632318 TTTGCTAATTCTATTTCTGTAGG + Intergenic
1197244533 X:124154645-124154667 TTGTCTCATGCCATCTTTATCGG - Intronic
1197312029 X:124916690-124916712 TGGATTAATGCCATTATTGTGGG + Intronic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic
1200702113 Y:6411120-6411142 TTGGCTAACTCCATATTTGAGGG - Intergenic
1201031998 Y:9753578-9753600 TTGGCTAACTCCATATTTGAGGG + Intergenic