ID: 1103778516

View in Genome Browser
Species Human (GRCh38)
Location 12:123384002-123384024
Sequence TTCTCCCGCCTCTTCGGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 61}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103778516_1103778531 30 Left 1103778516 12:123384002-123384024 CCGCCGCCGAAGAGGCGGGAGAA 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1103778531 12:123384055-123384077 ACTACGGGCAGCCTGCGGAGAGG 0: 1
1: 0
2: 1
3: 4
4: 83
1103778516_1103778526 14 Left 1103778516 12:123384002-123384024 CCGCCGCCGAAGAGGCGGGAGAA 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1103778526 12:123384039-123384061 TCCGAGTTGGCCTATCACTACGG 0: 1
1: 0
2: 0
3: 3
4: 27
1103778516_1103778528 15 Left 1103778516 12:123384002-123384024 CCGCCGCCGAAGAGGCGGGAGAA 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1103778528 12:123384040-123384062 CCGAGTTGGCCTATCACTACGGG 0: 1
1: 0
2: 0
3: 0
4: 21
1103778516_1103778524 1 Left 1103778516 12:123384002-123384024 CCGCCGCCGAAGAGGCGGGAGAA 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1103778524 12:123384026-123384048 GGCGGGGCCTTTCTCCGAGTTGG 0: 1
1: 0
2: 0
3: 5
4: 67
1103778516_1103778530 25 Left 1103778516 12:123384002-123384024 CCGCCGCCGAAGAGGCGGGAGAA 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1103778530 12:123384050-123384072 CTATCACTACGGGCAGCCTGCGG 0: 1
1: 0
2: 0
3: 4
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103778516 Original CRISPR TTCTCCCGCCTCTTCGGCGG CGG (reversed) Exonic
901086225 1:6613825-6613847 CTCTCCCGCCTCTACCGCCGCGG + Exonic
902237311 1:15065693-15065715 ATCTCCCGCGTCTTCGCCAGAGG + Exonic
904988962 1:34576165-34576187 TTCTCCCTCCACTTCCGGGGTGG + Intergenic
906309992 1:44747003-44747025 TTCTCCCGCCTCAGCCTCGGGGG + Intronic
911116628 1:94252471-94252493 TTCTCCTGCCTCTACGGCACAGG - Intronic
911188673 1:94927211-94927233 TCCTCCCGCCTCTGCGCCGAGGG + Exonic
912274066 1:108238445-108238467 TTCTCCCGCCTCTGCTGCCTGGG + Intronic
912287201 1:108381417-108381439 TTCTCCCGCCTCTGCTGCCTGGG - Intronic
912294153 1:108455878-108455900 TTCTCCCGCCTCTGCTGCCTGGG - Intronic
924520892 1:244805252-244805274 TTCTCCTGCCTCCTGGGCAGAGG + Intergenic
1065342488 10:24721551-24721573 TTCTCCCGTCTCTGTGGCTGTGG - Intronic
1073287742 10:102398783-102398805 TTCTCCCAGCCCTTCGGGGGTGG + Exonic
1078076701 11:8168813-8168835 TTCTCCGTACTCTTCGGCGCCGG + Intronic
1082190701 11:49239785-49239807 TTCTCCCACCTCCTCGGCCCTGG - Intergenic
1085208034 11:74748901-74748923 TACTCGGGCCTCTTCCGCGGCGG + Exonic
1095581648 12:43806507-43806529 CTCTCCCGCTTCTTCCGGGGGGG + Intergenic
1097307042 12:58080925-58080947 TTCTGCTACCTCTTCGGCTGAGG - Intergenic
1098595730 12:72272157-72272179 TTCTCCCCCCACTCCAGCGGCGG - Intronic
1103778516 12:123384002-123384024 TTCTCCCGCCTCTTCGGCGGCGG - Exonic
1111822195 13:93227774-93227796 TCCTGCGGCTTCTTCGGCGGGGG + Intronic
1115595878 14:34908724-34908746 TTCTCCTGCCTCTGCGTCTGAGG - Intergenic
1118500793 14:66360700-66360722 TTCTCCCACCTCTGGGGCCGAGG - Intergenic
1125181800 15:36887408-36887430 CTCTCCTGCCTCTTCCGCGGCGG - Intergenic
1129844988 15:78764077-78764099 TGCTCCCGCAGCTGCGGCGGAGG - Exonic
1131121996 15:89828551-89828573 TTCTCCGGCCTCTTGGTCCGGGG - Intergenic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1134129065 16:11636143-11636165 TTCTCCAGCCTCCTCGGAGCCGG + Intronic
1136453995 16:30370207-30370229 TTCTGCGGCCTCCCCGGCGGGGG - Exonic
1136556473 16:31010452-31010474 GTCTCCCGCCTCTGTGCCGGAGG + Exonic
1137761966 16:50948324-50948346 CTCTCCAGCCTCCTCCGCGGCGG + Intergenic
1142005432 16:87687563-87687585 TCCTCCTGCCTCTGGGGCGGGGG - Intronic
1143663879 17:8345100-8345122 TTCTCCCTCTTCTTTGGGGGTGG + Intronic
1147325436 17:39667566-39667588 TGTTCCCGCCACTTCGGGGGCGG - Intergenic
1154241451 18:12657546-12657568 CTCTCCCGCGTCGTCGGCCGCGG + Exonic
1160388865 18:78515179-78515201 TTCTCCCTCCTCTCTTGCGGTGG - Intergenic
1161203754 19:3029490-3029512 TTCTCCCGCCCCTCCGGGAGGGG - Intronic
1161977138 19:7613054-7613076 GTCTCCCTCGTCCTCGGCGGCGG - Exonic
1162258092 19:9509546-9509568 TTATCCCGCCTCTTCTTCAGTGG - Intergenic
1163558872 19:18007573-18007595 TTCTCCCGGCTCTACAGAGGTGG + Intronic
926737537 2:16084749-16084771 TTCTCCCCCCTCTGGGGCAGAGG + Intergenic
931870101 2:66446995-66447017 TTCCCCCGCTTCTTCGGAGGAGG - Intronic
944811030 2:203328100-203328122 TTCTCCAGCCGCTCCAGCGGCGG + Intergenic
948518680 2:238522292-238522314 CTCCCCCTCCTCTTCGGCTGTGG + Intergenic
1181726586 22:24815345-24815367 ATCTCCCATCTCTTCGGCTGCGG - Intronic
1183318855 22:37152692-37152714 TTCTCCCCCTTTTTTGGCGGGGG + Intronic
1185338550 22:50281600-50281622 TTCTGCCGCCGCTTGGGCGGGGG + Exonic
950052545 3:10003353-10003375 TTATTCCTCCTTTTCGGCGGTGG - Intronic
950657235 3:14444129-14444151 TTGTCCTGCCTCTTTGGAGGTGG - Intronic
966446189 3:180004004-180004026 TTGTCACACCTCTTGGGCGGGGG - Intronic
970332785 4:15002866-15002888 TTCTCCGTCCCCCTCGGCGGCGG + Exonic
985636416 5:1037978-1038000 TTCTCCGGCCCCTTCGGCCGGGG - Exonic
997952502 5:138253370-138253392 TTCTCTCCTCTCTTCAGCGGAGG - Exonic
1002928805 6:1619880-1619902 GACTCCCGCCGCTTCGGGGGAGG - Intergenic
1004208502 6:13614807-13614829 GTCGCCCGCGTCTTCGTCGGTGG + Intronic
1009437625 6:63636072-63636094 CTCCTCCTCCTCTTCGGCGGCGG + Exonic
1011754510 6:90485104-90485126 TTCTCCCGGCCCTGCAGCGGGGG + Intergenic
1014205448 6:118651320-118651342 TCCTCCTGCTTCTTCGGCGGCGG + Intronic
1018400485 6:163415130-163415152 CCCTCCCTCCTCTCCGGCGGCGG + Exonic
1018723148 6:166589008-166589030 TTCTTCCTCCTTTTCTGCGGGGG - Intronic
1034258400 7:149737212-149737234 TTGTCCCACCTCTTCCGAGGGGG + Intergenic
1034649228 7:152676200-152676222 TGCTCCCGCCTCCCCGGCCGCGG - Intergenic
1040809488 8:51435702-51435724 TTCTTCCACCTCCTCTGCGGTGG - Intronic
1042699796 8:71599822-71599844 TTCTCCCTCCATTTCGGCCGTGG + Intergenic
1045488730 8:102654479-102654501 TCCTCCCGCATCTGAGGCGGAGG - Intronic
1049761234 8:144332825-144332847 TTCTCCCGCCTCTGCGCCCCTGG - Exonic
1203781438 EBV:103180-103202 TTCTGCCGCAACTGCGGCGGGGG - Intergenic
1189320353 X:40083702-40083724 TCCTCCCCGCTCCTCGGCGGAGG + Intronic