ID: 1103779302

View in Genome Browser
Species Human (GRCh38)
Location 12:123388870-123388892
Sequence AGGCCGCTCCGGAGGGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 251}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103779302_1103779330 29 Left 1103779302 12:123388870-123388892 CCGCCCGCCCTCCGGAGCGGCCT 0: 1
1: 0
2: 3
3: 16
4: 251
Right 1103779330 12:123388922-123388944 CGGGCCGGGCGCCGGACGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 149
1103779302_1103779312 9 Left 1103779302 12:123388870-123388892 CCGCCCGCCCTCCGGAGCGGCCT 0: 1
1: 0
2: 3
3: 16
4: 251
Right 1103779312 12:123388902-123388924 GCCCCTACCAGCCCCCTCCCCGG 0: 1
1: 1
2: 7
3: 70
4: 611
1103779302_1103779329 28 Left 1103779302 12:123388870-123388892 CCGCCCGCCCTCCGGAGCGGCCT 0: 1
1: 0
2: 3
3: 16
4: 251
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779302_1103779314 10 Left 1103779302 12:123388870-123388892 CCGCCCGCCCTCCGGAGCGGCCT 0: 1
1: 0
2: 3
3: 16
4: 251
Right 1103779314 12:123388903-123388925 CCCCTACCAGCCCCCTCCCCGGG 0: 1
1: 0
2: 13
3: 149
4: 907
1103779302_1103779322 21 Left 1103779302 12:123388870-123388892 CCGCCCGCCCTCCGGAGCGGCCT 0: 1
1: 0
2: 3
3: 16
4: 251
Right 1103779322 12:123388914-123388936 CCCCTCCCCGGGCCGGGCGCCGG 0: 1
1: 0
2: 10
3: 75
4: 569
1103779302_1103779318 15 Left 1103779302 12:123388870-123388892 CCGCCCGCCCTCCGGAGCGGCCT 0: 1
1: 0
2: 3
3: 16
4: 251
Right 1103779318 12:123388908-123388930 ACCAGCCCCCTCCCCGGGCCGGG 0: 1
1: 1
2: 3
3: 64
4: 651
1103779302_1103779317 14 Left 1103779302 12:123388870-123388892 CCGCCCGCCCTCCGGAGCGGCCT 0: 1
1: 0
2: 3
3: 16
4: 251
Right 1103779317 12:123388907-123388929 TACCAGCCCCCTCCCCGGGCCGG 0: 1
1: 0
2: 2
3: 29
4: 265
1103779302_1103779325 25 Left 1103779302 12:123388870-123388892 CCGCCCGCCCTCCGGAGCGGCCT 0: 1
1: 0
2: 3
3: 16
4: 251
Right 1103779325 12:123388918-123388940 TCCCCGGGCCGGGCGCCGGACGG 0: 1
1: 0
2: 1
3: 12
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103779302 Original CRISPR AGGCCGCTCCGGAGGGCGGG CGG (reversed) Intronic