ID: 1103779309

View in Genome Browser
Species Human (GRCh38)
Location 12:123388881-123388903
Sequence GCGGCGCCGCCAGGCCGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 171}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103779309_1103779329 17 Left 1103779309 12:123388881-123388903 CCGGAGCGGCCTGGCGGCGCCGC 0: 1
1: 0
2: 2
3: 38
4: 171
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779309_1103779322 10 Left 1103779309 12:123388881-123388903 CCGGAGCGGCCTGGCGGCGCCGC 0: 1
1: 0
2: 2
3: 38
4: 171
Right 1103779322 12:123388914-123388936 CCCCTCCCCGGGCCGGGCGCCGG 0: 1
1: 0
2: 10
3: 75
4: 569
1103779309_1103779312 -2 Left 1103779309 12:123388881-123388903 CCGGAGCGGCCTGGCGGCGCCGC 0: 1
1: 0
2: 2
3: 38
4: 171
Right 1103779312 12:123388902-123388924 GCCCCTACCAGCCCCCTCCCCGG 0: 1
1: 1
2: 7
3: 70
4: 611
1103779309_1103779317 3 Left 1103779309 12:123388881-123388903 CCGGAGCGGCCTGGCGGCGCCGC 0: 1
1: 0
2: 2
3: 38
4: 171
Right 1103779317 12:123388907-123388929 TACCAGCCCCCTCCCCGGGCCGG 0: 1
1: 0
2: 2
3: 29
4: 265
1103779309_1103779318 4 Left 1103779309 12:123388881-123388903 CCGGAGCGGCCTGGCGGCGCCGC 0: 1
1: 0
2: 2
3: 38
4: 171
Right 1103779318 12:123388908-123388930 ACCAGCCCCCTCCCCGGGCCGGG 0: 1
1: 1
2: 3
3: 64
4: 651
1103779309_1103779314 -1 Left 1103779309 12:123388881-123388903 CCGGAGCGGCCTGGCGGCGCCGC 0: 1
1: 0
2: 2
3: 38
4: 171
Right 1103779314 12:123388903-123388925 CCCCTACCAGCCCCCTCCCCGGG 0: 1
1: 0
2: 13
3: 149
4: 907
1103779309_1103779330 18 Left 1103779309 12:123388881-123388903 CCGGAGCGGCCTGGCGGCGCCGC 0: 1
1: 0
2: 2
3: 38
4: 171
Right 1103779330 12:123388922-123388944 CGGGCCGGGCGCCGGACGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 149
1103779309_1103779331 21 Left 1103779309 12:123388881-123388903 CCGGAGCGGCCTGGCGGCGCCGC 0: 1
1: 0
2: 2
3: 38
4: 171
Right 1103779331 12:123388925-123388947 GCCGGGCGCCGGACGGTGGGCGG 0: 1
1: 0
2: 4
3: 26
4: 287
1103779309_1103779325 14 Left 1103779309 12:123388881-123388903 CCGGAGCGGCCTGGCGGCGCCGC 0: 1
1: 0
2: 2
3: 38
4: 171
Right 1103779325 12:123388918-123388940 TCCCCGGGCCGGGCGCCGGACGG 0: 1
1: 0
2: 1
3: 12
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103779309 Original CRISPR GCGGCGCCGCCAGGCCGCTC CGG (reversed) Intronic