ID: 1103779310

View in Genome Browser
Species Human (GRCh38)
Location 12:123388890-123388912
Sequence CTGGTAGGGGCGGCGCCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 157}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103779310_1103779338 30 Left 1103779310 12:123388890-123388912 CCTGGCGGCGCCGCCCCTACCAG 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1103779338 12:123388943-123388965 GGCGGCTGCGAGCGGGCGGGAGG 0: 1
1: 0
2: 6
3: 80
4: 593
1103779310_1103779331 12 Left 1103779310 12:123388890-123388912 CCTGGCGGCGCCGCCCCTACCAG 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1103779331 12:123388925-123388947 GCCGGGCGCCGGACGGTGGGCGG 0: 1
1: 0
2: 4
3: 26
4: 287
1103779310_1103779322 1 Left 1103779310 12:123388890-123388912 CCTGGCGGCGCCGCCCCTACCAG 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1103779322 12:123388914-123388936 CCCCTCCCCGGGCCGGGCGCCGG 0: 1
1: 0
2: 10
3: 75
4: 569
1103779310_1103779329 8 Left 1103779310 12:123388890-123388912 CCTGGCGGCGCCGCCCCTACCAG 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779310_1103779330 9 Left 1103779310 12:123388890-123388912 CCTGGCGGCGCCGCCCCTACCAG 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1103779330 12:123388922-123388944 CGGGCCGGGCGCCGGACGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 149
1103779310_1103779336 26 Left 1103779310 12:123388890-123388912 CCTGGCGGCGCCGCCCCTACCAG 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1103779336 12:123388939-123388961 GGTGGGCGGCTGCGAGCGGGCGG 0: 1
1: 0
2: 3
3: 25
4: 337
1103779310_1103779318 -5 Left 1103779310 12:123388890-123388912 CCTGGCGGCGCCGCCCCTACCAG 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1103779318 12:123388908-123388930 ACCAGCCCCCTCCCCGGGCCGGG 0: 1
1: 1
2: 3
3: 64
4: 651
1103779310_1103779334 22 Left 1103779310 12:123388890-123388912 CCTGGCGGCGCCGCCCCTACCAG 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1103779334 12:123388935-123388957 GGACGGTGGGCGGCTGCGAGCGG 0: 1
1: 0
2: 0
3: 20
4: 278
1103779310_1103779325 5 Left 1103779310 12:123388890-123388912 CCTGGCGGCGCCGCCCCTACCAG 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1103779325 12:123388918-123388940 TCCCCGGGCCGGGCGCCGGACGG 0: 1
1: 0
2: 1
3: 12
4: 174
1103779310_1103779337 27 Left 1103779310 12:123388890-123388912 CCTGGCGGCGCCGCCCCTACCAG 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1103779337 12:123388940-123388962 GTGGGCGGCTGCGAGCGGGCGGG 0: 1
1: 0
2: 1
3: 32
4: 278
1103779310_1103779335 23 Left 1103779310 12:123388890-123388912 CCTGGCGGCGCCGCCCCTACCAG 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1103779335 12:123388936-123388958 GACGGTGGGCGGCTGCGAGCGGG 0: 1
1: 0
2: 1
3: 12
4: 163
1103779310_1103779317 -6 Left 1103779310 12:123388890-123388912 CCTGGCGGCGCCGCCCCTACCAG 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1103779317 12:123388907-123388929 TACCAGCCCCCTCCCCGGGCCGG 0: 1
1: 0
2: 2
3: 29
4: 265
1103779310_1103779314 -10 Left 1103779310 12:123388890-123388912 CCTGGCGGCGCCGCCCCTACCAG 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1103779314 12:123388903-123388925 CCCCTACCAGCCCCCTCCCCGGG 0: 1
1: 0
2: 13
3: 149
4: 907

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103779310 Original CRISPR CTGGTAGGGGCGGCGCCGCC AGG (reversed) Intronic