ID: 1103779313

View in Genome Browser
Species Human (GRCh38)
Location 12:123388903-123388925
Sequence CCCGGGGAGGGGGCTGGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 722
Summary {0: 1, 1: 0, 2: 1, 3: 56, 4: 664}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103779313_1103779325 -8 Left 1103779313 12:123388903-123388925 CCCCTACCAGCCCCCTCCCCGGG 0: 1
1: 0
2: 1
3: 56
4: 664
Right 1103779325 12:123388918-123388940 TCCCCGGGCCGGGCGCCGGACGG 0: 1
1: 0
2: 1
3: 12
4: 174
1103779313_1103779337 14 Left 1103779313 12:123388903-123388925 CCCCTACCAGCCCCCTCCCCGGG 0: 1
1: 0
2: 1
3: 56
4: 664
Right 1103779337 12:123388940-123388962 GTGGGCGGCTGCGAGCGGGCGGG 0: 1
1: 0
2: 1
3: 32
4: 278
1103779313_1103779338 17 Left 1103779313 12:123388903-123388925 CCCCTACCAGCCCCCTCCCCGGG 0: 1
1: 0
2: 1
3: 56
4: 664
Right 1103779338 12:123388943-123388965 GGCGGCTGCGAGCGGGCGGGAGG 0: 1
1: 0
2: 6
3: 80
4: 593
1103779313_1103779330 -4 Left 1103779313 12:123388903-123388925 CCCCTACCAGCCCCCTCCCCGGG 0: 1
1: 0
2: 1
3: 56
4: 664
Right 1103779330 12:123388922-123388944 CGGGCCGGGCGCCGGACGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 149
1103779313_1103779336 13 Left 1103779313 12:123388903-123388925 CCCCTACCAGCCCCCTCCCCGGG 0: 1
1: 0
2: 1
3: 56
4: 664
Right 1103779336 12:123388939-123388961 GGTGGGCGGCTGCGAGCGGGCGG 0: 1
1: 0
2: 3
3: 25
4: 337
1103779313_1103779335 10 Left 1103779313 12:123388903-123388925 CCCCTACCAGCCCCCTCCCCGGG 0: 1
1: 0
2: 1
3: 56
4: 664
Right 1103779335 12:123388936-123388958 GACGGTGGGCGGCTGCGAGCGGG 0: 1
1: 0
2: 1
3: 12
4: 163
1103779313_1103779340 24 Left 1103779313 12:123388903-123388925 CCCCTACCAGCCCCCTCCCCGGG 0: 1
1: 0
2: 1
3: 56
4: 664
Right 1103779340 12:123388950-123388972 GCGAGCGGGCGGGAGGGCTGCGG 0: 1
1: 0
2: 9
3: 89
4: 606
1103779313_1103779339 18 Left 1103779313 12:123388903-123388925 CCCCTACCAGCCCCCTCCCCGGG 0: 1
1: 0
2: 1
3: 56
4: 664
Right 1103779339 12:123388944-123388966 GCGGCTGCGAGCGGGCGGGAGGG 0: 1
1: 0
2: 4
3: 31
4: 343
1103779313_1103779341 27 Left 1103779313 12:123388903-123388925 CCCCTACCAGCCCCCTCCCCGGG 0: 1
1: 0
2: 1
3: 56
4: 664
Right 1103779341 12:123388953-123388975 AGCGGGCGGGAGGGCTGCGGAGG 0: 1
1: 1
2: 9
3: 52
4: 551
1103779313_1103779334 9 Left 1103779313 12:123388903-123388925 CCCCTACCAGCCCCCTCCCCGGG 0: 1
1: 0
2: 1
3: 56
4: 664
Right 1103779334 12:123388935-123388957 GGACGGTGGGCGGCTGCGAGCGG 0: 1
1: 0
2: 0
3: 20
4: 278
1103779313_1103779329 -5 Left 1103779313 12:123388903-123388925 CCCCTACCAGCCCCCTCCCCGGG 0: 1
1: 0
2: 1
3: 56
4: 664
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779313_1103779331 -1 Left 1103779313 12:123388903-123388925 CCCCTACCAGCCCCCTCCCCGGG 0: 1
1: 0
2: 1
3: 56
4: 664
Right 1103779331 12:123388925-123388947 GCCGGGCGCCGGACGGTGGGCGG 0: 1
1: 0
2: 4
3: 26
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103779313 Original CRISPR CCCGGGGAGGGGGCTGGTAG GGG (reversed) Intronic