ID: 1103779329

View in Genome Browser
Species Human (GRCh38)
Location 12:123388921-123388943
Sequence CCGGGCCGGGCGCCGGACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 353}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103779311_1103779329 -2 Left 1103779311 12:123388900-123388922 CCGCCCCTACCAGCCCCCTCCCC 0: 1
1: 5
2: 33
3: 436
4: 2954
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779305_1103779329 24 Left 1103779305 12:123388874-123388896 CCGCCCTCCGGAGCGGCCTGGCG 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779315_1103779329 -6 Left 1103779315 12:123388904-123388926 CCCTACCAGCCCCCTCCCCGGGC 0: 1
1: 0
2: 3
3: 72
4: 592
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779309_1103779329 17 Left 1103779309 12:123388881-123388903 CCGGAGCGGCCTGGCGGCGCCGC 0: 1
1: 0
2: 2
3: 38
4: 171
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779313_1103779329 -5 Left 1103779313 12:123388903-123388925 CCCCTACCAGCCCCCTCCCCGGG 0: 1
1: 0
2: 1
3: 56
4: 664
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779310_1103779329 8 Left 1103779310 12:123388890-123388912 CCTGGCGGCGCCGCCCCTACCAG 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779316_1103779329 -7 Left 1103779316 12:123388905-123388927 CCTACCAGCCCCCTCCCCGGGCC 0: 1
1: 0
2: 10
3: 130
4: 1156
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779304_1103779329 25 Left 1103779304 12:123388873-123388895 CCCGCCCTCCGGAGCGGCCTGGC 0: 1
1: 0
2: 1
3: 24
4: 208
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779301_1103779329 29 Left 1103779301 12:123388869-123388891 CCCGCCCGCCCTCCGGAGCGGCC 0: 1
1: 0
2: 3
3: 38
4: 284
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779308_1103779329 20 Left 1103779308 12:123388878-123388900 CCTCCGGAGCGGCCTGGCGGCGC 0: 1
1: 0
2: 2
3: 10
4: 110
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779302_1103779329 28 Left 1103779302 12:123388870-123388892 CCGCCCGCCCTCCGGAGCGGCCT 0: 1
1: 0
2: 3
3: 16
4: 251
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779307_1103779329 21 Left 1103779307 12:123388877-123388899 CCCTCCGGAGCGGCCTGGCGGCG 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103779329 Original CRISPR CCGGGCCGGGCGCCGGACGG TGG Intronic