ID: 1103779329

View in Genome Browser
Species Human (GRCh38)
Location 12:123388921-123388943
Sequence CCGGGCCGGGCGCCGGACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 353}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103779302_1103779329 28 Left 1103779302 12:123388870-123388892 CCGCCCGCCCTCCGGAGCGGCCT 0: 1
1: 0
2: 3
3: 16
4: 251
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779308_1103779329 20 Left 1103779308 12:123388878-123388900 CCTCCGGAGCGGCCTGGCGGCGC 0: 1
1: 0
2: 2
3: 10
4: 110
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779307_1103779329 21 Left 1103779307 12:123388877-123388899 CCCTCCGGAGCGGCCTGGCGGCG 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779310_1103779329 8 Left 1103779310 12:123388890-123388912 CCTGGCGGCGCCGCCCCTACCAG 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779301_1103779329 29 Left 1103779301 12:123388869-123388891 CCCGCCCGCCCTCCGGAGCGGCC 0: 1
1: 0
2: 3
3: 38
4: 284
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779316_1103779329 -7 Left 1103779316 12:123388905-123388927 CCTACCAGCCCCCTCCCCGGGCC 0: 1
1: 0
2: 10
3: 130
4: 1156
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779304_1103779329 25 Left 1103779304 12:123388873-123388895 CCCGCCCTCCGGAGCGGCCTGGC 0: 1
1: 0
2: 1
3: 24
4: 208
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779305_1103779329 24 Left 1103779305 12:123388874-123388896 CCGCCCTCCGGAGCGGCCTGGCG 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779315_1103779329 -6 Left 1103779315 12:123388904-123388926 CCCTACCAGCCCCCTCCCCGGGC 0: 1
1: 0
2: 3
3: 72
4: 592
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779313_1103779329 -5 Left 1103779313 12:123388903-123388925 CCCCTACCAGCCCCCTCCCCGGG 0: 1
1: 0
2: 1
3: 56
4: 664
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779311_1103779329 -2 Left 1103779311 12:123388900-123388922 CCGCCCCTACCAGCCCCCTCCCC 0: 1
1: 5
2: 33
3: 436
4: 2954
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353
1103779309_1103779329 17 Left 1103779309 12:123388881-123388903 CCGGAGCGGCCTGGCGGCGCCGC 0: 1
1: 0
2: 2
3: 38
4: 171
Right 1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG 0: 1
1: 0
2: 3
3: 25
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103779329 Original CRISPR CCGGGCCGGGCGCCGGACGG TGG Intronic
900180132 1:1307659-1307681 CCGGGCCGGGCCGCGGCCGCCGG - Intronic
900180152 1:1307728-1307750 CCGGGGTGGGCGCAGGCCGGGGG - Intronic
900189944 1:1349136-1349158 CCGGGCGGGGCGCAGGCGGGCGG - Intronic
900413922 1:2526435-2526457 GCAGGCCGGGCGCCGGGCGCGGG - Intronic
900626628 1:3611541-3611563 CCGGGCTGGGGGCGGGCCGGGGG - Intergenic
901079018 1:6573167-6573189 CCCGGCCGGGCACCGGGCGCGGG + Intronic
901084636 1:6603013-6603035 CGGGGGCGGGCGCCGCGCGGGGG - Intronic
901242551 1:7704032-7704054 CAGGGCGGGGCGGAGGACGGTGG - Intronic
901506595 1:9689486-9689508 CGGGGCGGGGCGCCGGCTGGGGG - Intronic
902398569 1:16145271-16145293 CAGGGCCGGGGGCAGGGCGGGGG + Intronic
902444392 1:16452771-16452793 CTGGGCGGGGCGGCGGGCGGGGG - Intronic
902998068 1:20243085-20243107 CGGGGCAGGGCGGAGGACGGGGG - Intergenic
903263225 1:22142516-22142538 CCGGGAGGGGCGCCGGACGCGGG - Intronic
903468454 1:23568415-23568437 CGGGGCCAGGCGCCGGGAGGAGG + Intergenic
903501018 1:23800283-23800305 CCGCGCCAGGCGCGGGGCGGGGG - Intronic
904751066 1:32741767-32741789 GCGGGCGGGGCGCAGGCCGGCGG - Intergenic
905199592 1:36306919-36306941 CGGGGACGGGCGCCGGTGGGCGG + Intronic
906044499 1:42817318-42817340 CGGGGCCGCGCGCCGGGGGGAGG + Intronic
906208239 1:43998189-43998211 CAGGGCCGGGGGCCGGAGCGCGG + Intronic
906317842 1:44799857-44799879 CTGGGCCGGGCCCCGGGCGAGGG + Intergenic
906370363 1:45248223-45248245 ACGGGGCGGCCGCCGGGCGGAGG - Intronic
906636999 1:47416471-47416493 CCGGGCCGGGCGCGGGCGTGGGG - Exonic
907136182 1:52141909-52141931 CCGGGCCGGCCGCGGGCCGCGGG + Intergenic
907185026 1:52602719-52602741 CCGGGCCGGGCGCGGGATGGGGG - Intronic
908132191 1:61083805-61083827 CCGCTCCGCGCGCAGGACGGGGG + Intronic
908354959 1:63319856-63319878 CCGGCGCGGGCGCGGGACGTCGG + Intergenic
912878953 1:113390403-113390425 GCGCGCCGGGCGCCGCGCGGCGG + Intergenic
914869127 1:151458824-151458846 CCGCGGCGGGCGCCGGGGGGCGG + Intronic
915458170 1:156053951-156053973 CCTGGCCGGGCTCCGGACCTGGG - Intergenic
917553308 1:176058048-176058070 CCGGGGCGGCTGCCGGGCGGAGG - Intronic
919080255 1:192857773-192857795 CCGGGCGGCTGGCCGGACGGGGG - Intergenic
919802336 1:201361424-201361446 CTGGGCCGGGACCAGGACGGAGG - Intronic
919916842 1:202144320-202144342 CACGGCCGGGCGCCGGGCGGGGG - Intronic
920184583 1:204152074-204152096 CCGGGGCGGGGGCGGGCCGGGGG - Intergenic
920912670 1:210233019-210233041 CCGGGCTGGGCGCGGGCCGCGGG + Intronic
921190037 1:212700313-212700335 CCGCGCCGGGGGGCGGACGCAGG - Intergenic
921390294 1:214608242-214608264 CCAGGCCGGGGGCCGGGGGGCGG - Intronic
922440514 1:225652589-225652611 CCGGGCCGGGAGAGGGAAGGCGG + Intronic
1064022943 10:11823814-11823836 CCGGGTTGGGGGACGGACGGTGG - Intronic
1065025231 10:21534540-21534562 CCGGGCCGGGCGGGGGGCGCCGG + Intronic
1065092861 10:22252553-22252575 CCGGGCCGGGCCCGAGTCGGAGG - Intergenic
1065342893 10:24723401-24723423 CCGCGGCGGGCGCCCGGCGGGGG - Intronic
1065712864 10:28533639-28533661 TCGGGCCGGGCGGCGGCGGGGGG + Intronic
1070162550 10:73874659-73874681 GCGGGCCGGGGGCCGGGCGGGGG - Intergenic
1071086894 10:81875440-81875462 GCGGGCGGGGGCCCGGACGGCGG + Exonic
1073147891 10:101292348-101292370 GCAGGCCGGGCGCCGGCCGCTGG - Intergenic
1074377403 10:112951338-112951360 CCGAGCCGGGCGCGGGGCCGGGG - Intronic
1075207067 10:120457160-120457182 CGGAGGCGGGCGCCGGGCGGGGG - Exonic
1075801823 10:125159326-125159348 GCGGGCCGGGCTCCCGGCGGCGG + Intronic
1075801854 10:125159420-125159442 GCGGGCCGGGCGGCGGGCGCGGG - Intronic
1076722202 10:132397558-132397580 TCGGGGCGGGCGCCGGGCCGGGG + Intronic
1076828585 10:132982978-132983000 CGGCGCTGGGAGCCGGACGGTGG - Intergenic
1076828597 10:132983016-132983038 CGGCGCTGGGAGCCGGACGGTGG - Intergenic
1076828609 10:132983054-132983076 CGGCGCTGGGAGCCGGACGGTGG - Intergenic
1076828634 10:132983130-132983152 CGGCGCTGGGAGCCGGACGGTGG - Intergenic
1077107934 11:849942-849964 CCGGAGCAGGCGCCGGCCGGCGG + Intronic
1077328054 11:1972124-1972146 CTGGGCAGGGCACCGGACGAGGG + Intronic
1078175099 11:8964348-8964370 CCGAGCCGGGAGCCGGTCGCGGG - Exonic
1078594347 11:12674173-12674195 CCGCGCCGGGAGACGGAGGGCGG + Intergenic
1080551448 11:33376534-33376556 ACGGCCCGGGCGCCGGAGGGAGG - Intergenic
1081831613 11:46120403-46120425 CCCGGCGGGGGGCCGGCCGGGGG - Intronic
1081832185 11:46122441-46122463 CCGGGAGGGGCGGGGGACGGGGG + Intergenic
1083272981 11:61581275-61581297 GCGGGCGGGGCGCGGGGCGGCGG - Intergenic
1083904891 11:65662979-65663001 CCGGCCCCTGCGCCGGGCGGCGG - Exonic
1083940280 11:65891797-65891819 CCGGTCCCGGCGCCCGATGGGGG - Intergenic
1083997225 11:66278429-66278451 CCGCGCCGGGCGGCGGCCCGGGG - Exonic
1084517954 11:69646601-69646623 CTGGGCTGGGAGCCGGACGTCGG - Intronic
1085474819 11:76783256-76783278 CCCTGCCGGGCGCCGGGTGGCGG - Intronic
1087138151 11:94740634-94740656 CCCGGCCGGGCGCTGGGCCGCGG - Intronic
1089622140 11:119728405-119728427 CGGGGCTGGGAGCCGGATGGCGG - Intronic
1090780355 11:130002131-130002153 GGGGGCCGGGCGCCGGGCTGGGG - Intronic
1091273053 11:134331748-134331770 CGGGGCGGGGCCCCGGCCGGGGG - Intergenic
1202811033 11_KI270721v1_random:27304-27326 CTGGGCAGGGCACCGGACGAGGG + Intergenic
1093464859 12:19439407-19439429 GCGGGGCGGGCGCCGGGCGGGGG + Intronic
1093894659 12:24562706-24562728 CCGGGGCGGGCGCCGGGCCGCGG - Intergenic
1096271095 12:50167053-50167075 GGGGGCCGGGCGCGGGCCGGGGG - Intronic
1096515372 12:52152518-52152540 CCACGCCGGGCGCCTGAGGGTGG + Intergenic
1098255438 12:68611095-68611117 CGGGGCCGGGCGCCGGCTGAGGG + Intronic
1100565449 12:95790332-95790354 CCGGGCCGGGCGGGTGCCGGAGG + Exonic
1101446809 12:104742619-104742641 CTGGGCAGGGTGCCGGAGGGGGG - Intronic
1102254033 12:111405960-111405982 CCGGGCGGGCAGCCGGGCGGAGG - Exonic
1102478717 12:113205857-113205879 CCAGGCCGGAAGCCGGACTGCGG - Intronic
1103527894 12:121579705-121579727 AGGGGCCGGGCGCTGGGCGGTGG - Intronic
1103614247 12:122142132-122142154 CCGGGCCTGGCGCCGGTGAGCGG + Exonic
1103649681 12:122422764-122422786 CGGGGCCGGGCGCGGGCCGCAGG - Intergenic
1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG + Intronic
1103800378 12:123533823-123533845 CCGGGCCGGGCGCCTCGGGGCGG + Intergenic
1103856168 12:123972665-123972687 CCGGGCCGGGCCGCCGAGGGAGG + Exonic
1104448887 12:128853680-128853702 CTGGGCCGGGGGCCGGGGGGCGG + Intronic
1105472054 13:20703718-20703740 CCGAGCCGGGGGCCGCACGGGGG - Intronic
1105577903 13:21670220-21670242 CCGCGGCGGGCTTCGGACGGTGG + Intergenic
1106087679 13:26557880-26557902 CCGGGCCGGGCGGCTGTCGGGGG + Intronic
1106508420 13:30392025-30392047 CCGGGCCGGGCTGTGGACGAGGG - Intergenic
1107086558 13:36432393-36432415 CCGGGCCGGGCGGGGCAGGGCGG - Exonic
1108518279 13:51222580-51222602 CCGGGCCGGGCCGCGGGCGGGGG + Intronic
1108648117 13:52450434-52450456 CCGGGCCGCGCGCCCACCGGGGG + Intronic
1110318616 13:74135601-74135623 GCGGGGCGCGCGGCGGACGGAGG + Intergenic
1110630319 13:77698602-77698624 CGGGGGCGGGGGGCGGACGGGGG + Intronic
1113492842 13:110705984-110706006 GCGGGCCGGGCGGCGAGCGGGGG - Exonic
1113541776 13:111115156-111115178 CCAGGCCGTGCGCGGGGCGGCGG - Intronic
1114270649 14:21098259-21098281 GGGGGCCGGGTGGCGGACGGGGG + Intronic
1115119964 14:29927527-29927549 CAGGGCCGGGCAGCGGAGGGCGG + Exonic
1115120058 14:29927856-29927878 GCGGCCCGAGCGCCGGGCGGGGG + Intronic
1117315088 14:54565945-54565967 CCGGACCCGGCGCAGGGCGGGGG - Intergenic
1117424459 14:55580375-55580397 CCGGGACGGGCGCCGGCGGCGGG + Intronic
1117722016 14:58637830-58637852 CCGGGCGGCGCGCCTGACAGAGG + Intronic
1117978648 14:61321508-61321530 CAGGGCCGGGCCGCGGACCGCGG + Intronic
1118752346 14:68816419-68816441 CCGGGCCGGGCGCGGGGCCCGGG + Intergenic
1119051844 14:71377257-71377279 ACGGGGCGGCGGCCGGACGGGGG + Intronic
1119744151 14:77032627-77032649 CAGAGCCGGGCGCCAAACGGCGG + Intergenic
1120905684 14:89619166-89619188 CCCGGGCGGGCGCCGGGCGCAGG - Intergenic
1122445060 14:101761928-101761950 CGGGCCCGGCCGCGGGACGGAGG + Intronic
1122719957 14:103716230-103716252 CCAGGGCGGGCGCCGGGAGGCGG + Intronic
1122982158 14:105196781-105196803 CCGCGCCGGGCGCCGCGGGGAGG - Intergenic
1123004257 14:105314115-105314137 CCGGGCCTGGCGGCGGTCGCGGG - Exonic
1123036819 14:105475001-105475023 CCGGCCCCGGCCCCGGACCGAGG + Intronic
1125536160 15:40441871-40441893 CCGGGCCGGGGGCGGCAGGGGGG + Intronic
1126436650 15:48644876-48644898 CCGGCCCGGGGGACGGGCGGCGG - Exonic
1126466187 15:48963340-48963362 CCCGGGCGAGCGCCGGTCGGGGG + Exonic
1126573185 15:50172896-50172918 ACGGGGCGGCTGCCGGACGGAGG - Intronic
1127982567 15:64045809-64045831 CAGGCCGGGGCGCCTGACGGCGG + Intronic
1128315107 15:66655121-66655143 CCGGGCCGGGAGCCGGGTGGGGG - Intronic
1128743179 15:70097022-70097044 CGGGGCCGGGCGGCGGGCGCGGG + Exonic
1129116567 15:73368293-73368315 CCGGGCCGGGGGCAGGAGCGCGG + Exonic
1130370600 15:83283428-83283450 CCGTGCTGGGAGCCGGGCGGCGG - Intronic
1131431718 15:92393794-92393816 CGGAGCCGGGCGCGGGGCGGGGG + Intergenic
1131466026 15:92655505-92655527 CCGGGCCCCGGGCCGGGCGGTGG + Exonic
1132576267 16:665817-665839 CCGGGCCGGGGGCGGGATGGGGG + Intronic
1132604578 16:788414-788436 GCGGGCCGGGGGCGGGCCGGGGG - Intergenic
1132847949 16:2009361-2009383 CCCGGCCGTGCGGCTGACGGCGG - Intronic
1132987817 16:2777189-2777211 CCGGGCCGGGCCGGGGGCGGCGG - Intronic
1133009769 16:2904655-2904677 CCGAGTCGGGCGCCTGTCGGAGG - Intergenic
1133784446 16:8963626-8963648 CGGGGCCGCGGGCCGGCCGGGGG + Intronic
1137036812 16:35575160-35575182 CAGGGCCCGGCGCCGGCGGGTGG + Intergenic
1137617224 16:49855392-49855414 CGGGCCCGGGCCCCGCACGGAGG + Intronic
1138398889 16:56730013-56730035 CGGGGCCGGGGGCGGGGCGGAGG - Intronic
1138604775 16:58081660-58081682 CCGGGCCGAGGGCCGGACTGAGG - Intergenic
1139664821 16:68448190-68448212 CGTGGCCGGGCGCCGGAGGTCGG - Intronic
1140406410 16:74714155-74714177 CCGGGCTGAGGGCAGGACGGAGG + Exonic
1141989615 16:87602596-87602618 GCGGGCCGGGCGCGGGGCGGCGG - Intronic
1142240385 16:88941939-88941961 CCGGGCCAGGCGCCGCGCTGGGG - Intronic
1142876162 17:2853250-2853272 CCGGGGCGGGCGCCGGGCTCAGG + Intronic
1143183512 17:4997961-4997983 CCCGGGCGGGCGCCGGCCGCTGG + Exonic
1144991754 17:19237977-19237999 CCGGACCGGGCTCTGCACGGGGG - Intronic
1145190834 17:20841574-20841596 CCAGGCCGGGGGCCGGGGGGCGG + Intronic
1146034003 17:29390550-29390572 GCGGGCCGGCCGGCGGACGGCGG - Intronic
1147124027 17:38353007-38353029 GCGGGCCGGGAGCTGGACGCGGG + Exonic
1147157760 17:38552785-38552807 CAGGGCCGGGCACCAGCCGGTGG + Exonic
1147315347 17:39617773-39617795 CCGTGCCAGGCGCGGGGCGGGGG - Intergenic
1147395706 17:40140811-40140833 CCGGGCGGCGAGCCGGCCGGGGG + Intronic
1147400464 17:40177728-40177750 CCGTGCCAGGCGCCAGACTGGGG - Intronic
1149470896 17:56914229-56914251 GCGGGCTGGGCGCGGGACGCCGG + Intergenic
1149610508 17:57955267-57955289 CCGGGCCGCGGGCCGGGCGGGGG + Exonic
1150823813 17:68457415-68457437 CCGGGCCGAGCCCCCGATGGAGG - Exonic
1151597555 17:75087788-75087810 CAGGGCCGGGCTCCGGACGCAGG - Intronic
1151954490 17:77373607-77373629 GTGGGCCTGGCGCGGGACGGGGG + Intronic
1152049275 17:77959378-77959400 CGGGGCCTGGCGCCGCACGCGGG - Intergenic
1152077552 17:78168755-78168777 CCGGGCCTGGCGACGGAGAGGGG - Intronic
1152349700 17:79777936-79777958 CCGCGCGGGGCCCCGGGCGGGGG - Intergenic
1152375978 17:79919263-79919285 CCTGGCAGGGCGCCGGGCGAGGG - Intergenic
1152396367 17:80035922-80035944 CCGGGCCGGGGGCGGGCCCGGGG - Intergenic
1152402425 17:80075552-80075574 CCGGGGCGGGCGGCAGATGGAGG - Intronic
1152407879 17:80107906-80107928 CCGGCCCGGGCGCTGGGCGGCGG - Intergenic
1152809877 17:82376367-82376389 CCGGGCTGGGGGCTGGAGGGGGG - Intergenic
1152911201 17:83005845-83005867 CCGGGCAGGGCGGAGGGCGGGGG - Intronic
1153855131 18:9137303-9137325 GCGGGGCGGGGGCCGGGCGGAGG + Intronic
1157849127 18:51030692-51030714 CCGGGGCGGGCTCCCGACGACGG + Intronic
1160201821 18:76802189-76802211 CCCGGCCGGGCGCCAGGTGGCGG + Intronic
1160531412 18:79567158-79567180 CCGGGCTTGGCGCCGGCCAGGGG - Intergenic
1160706324 19:531839-531861 CCGGGCCGCGCACCGTCCGGGGG - Exonic
1160747636 19:719463-719485 CCGGGGTGGGCGTCGGGCGGGGG + Intronic
1160930771 19:1568486-1568508 CCCGCCCGAGCGCCGGGCGGAGG - Intergenic
1160947828 19:1651895-1651917 CCGGCCCGGGCGCCGGAGTTTGG - Intronic
1161063713 19:2227550-2227572 CGGGGCGGGGGGCCGGAGGGCGG + Intronic
1161139014 19:2637092-2637114 CCGGGCCTGGAGCCGGCAGGGGG - Intronic
1161215817 19:3094592-3094614 CCGGGCCGGGGGCCGGGGGGCGG + Exonic
1161216193 19:3096015-3096037 CTGGGCCGGGGGCGGGGCGGTGG + Intronic
1161241131 19:3224612-3224634 CCGGGGCGGGCGCGGGCGGGAGG + Intergenic
1161293373 19:3507256-3507278 CGGGGCAGGACGCAGGACGGAGG - Intronic
1161802622 19:6424532-6424554 CCGGGCGGGGGGTCGGCCGGGGG - Exonic
1161851392 19:6739688-6739710 CCGGGGAGGGCGGCGGGCGGCGG + Exonic
1161992931 19:7695277-7695299 CAGGGCAGGGAGCCAGACGGGGG - Intronic
1162079315 19:8209210-8209232 CGGGGCCTGGCGCGGGGCGGGGG - Intronic
1162145555 19:8610829-8610851 CCAGGCCGGGCGGCGGCAGGCGG - Intergenic
1162490063 19:10986544-10986566 CCGGGCCGGGACCCGGGCCGGGG - Exonic
1162573073 19:11483571-11483593 CCGGACCGCGGGCCGGAAGGAGG - Exonic
1162731712 19:12722296-12722318 ACGGGCCGGGCGGGGGAGGGGGG - Intronic
1162778673 19:12995688-12995710 CCGGGCCGAGCGCGGGGCCGCGG + Exonic
1162932275 19:13963074-13963096 GCGGGCGGGGCGCCAGGCGGCGG - Intronic
1162948484 19:14057383-14057405 CCGCGCCGCGCGCCGGGAGGTGG - Exonic
1165420061 19:35718079-35718101 CCGGGCCGGCCGCGGGGCGCCGG + Exonic
1165459506 19:35936452-35936474 CCGAGGCGGGGGCCGGGCGGGGG - Intronic
1166776394 19:45315483-45315505 CCGTGGCGAGCGCCGGGCGGTGG - Exonic
1166873885 19:45885874-45885896 CCGAGCCGGAGGCCGGACCGTGG - Exonic
1168328274 19:55549903-55549925 CCGGGCCGGGCACCTGAGGTCGG - Intergenic
1168350786 19:55674605-55674627 CGGGGCTGGGCGCAGGTCGGGGG - Intronic
927472414 2:23385861-23385883 CCGGGCCGGGCGTGGGAGCGGGG + Intronic
927713948 2:25341200-25341222 GAGGGCCGGGCGCCGGGGGGAGG + Intronic
927881444 2:26692663-26692685 CGGGGCCGGGCGGAGGAGGGCGG + Intergenic
927893109 2:26764597-26764619 CGGGGCTGCGCCCCGGACGGGGG + Intronic
927896579 2:26786409-26786431 CCGGAGCGGATGCCGGACGGCGG - Intronic
928186550 2:29115692-29115714 CCGGGCCGCGGGCTGGCCGGCGG + Intronic
928314069 2:30232413-30232435 CCGGGCCGGGCGCGGGGCGTCGG + Intronic
929242313 2:39665763-39665785 CCGGGCCGGGGGCGGGCGGGCGG + Intronic
929452701 2:42047863-42047885 CCGGGCCGGGCGGCCGGAGGGGG + Intergenic
931602534 2:64019033-64019055 CCCGGCCGGGCGCCGGGCGGCGG - Exonic
932567146 2:72917431-72917453 CGGGGCGGGGCGAGGGACGGCGG - Intronic
934045600 2:88170557-88170579 ACGGGCGGGGCGACGGACGTGGG - Intronic
935032703 2:99337653-99337675 CCGGGCGCGGCGTCGGACCGGGG + Intronic
935112420 2:100105146-100105168 CGGGGCCGGGCGCGGGCGGGCGG - Intronic
935692520 2:105744610-105744632 ACGGGCCGGGCGCCGGGGGCAGG - Intergenic
935971597 2:108534667-108534689 CCGGGCCTGGCGCGGGCGGGCGG + Intronic
937221499 2:120345295-120345317 CCCGGCCGGGCGCGGGGCGCCGG - Intergenic
937950842 2:127387355-127387377 GCGGGCTGGGCGCCGGGAGGGGG - Intronic
938796027 2:134718870-134718892 CCGGGGCGGCGGCGGGACGGTGG + Exonic
938836280 2:135106147-135106169 ACGGGGCGGCGGCCGGACGGAGG - Intronic
940640770 2:156342426-156342448 CGGGGCTGCGCGCCGGACGCCGG - Intergenic
940643254 2:156368354-156368376 CCGGGGTGGTTGCCGGACGGAGG - Intergenic
941029218 2:160493113-160493135 CCGGGCGGCGCGCGGGGCGGCGG - Intronic
942890406 2:180980771-180980793 CAGTGCCGGGCTCCGGCCGGAGG - Exonic
942965973 2:181892287-181892309 CCCGGCCGGGCTCCGGGGGGAGG + Intronic
945251584 2:207769552-207769574 CGGGGCCGGGAGCCGGACGGAGG + Exonic
946326077 2:218985300-218985322 CCGGGCCGCGCGGGGGCCGGAGG - Exonic
948142442 2:235683850-235683872 TGGGGCCGGGCGGGGGACGGGGG - Intronic
949014463 2:241701780-241701802 CTGGGCCGCACGCCGGGCGGTGG + Intergenic
1168753093 20:297645-297667 CCGGGCCGCGGGCCGCGCGGGGG - Exonic
1168991712 20:2101903-2101925 CTGGCCCGGGCGCCGGCGGGAGG + Exonic
1172015511 20:31870496-31870518 CCGGGCCGGGGGTCGGCGGGCGG - Exonic
1172910841 20:38407725-38407747 ACGGGGCGGCGGCCGGACGGGGG - Intergenic
1174246927 20:49188398-49188420 CCGGGCCTGGAGGCGGGCGGGGG - Intergenic
1175847496 20:62066165-62066187 CCGGGCGGGGCGCGGGATGCGGG + Intergenic
1176190802 20:63808638-63808660 CCTGGCCGAGCGCTGGACCGAGG - Intronic
1176380673 21:6110960-6110982 CGCGGCCGAGCGCCGGGCGGAGG - Intergenic
1178992503 21:37367309-37367331 CGAGGCCGGGCGCCGAGCGGCGG - Intronic
1179209361 21:39312968-39312990 CGGGGGCGGGCGGCGGGCGGCGG + Intronic
1179375438 21:40846708-40846730 CCGGGCCGGGCGGAGCGCGGGGG - Exonic
1179511972 21:41879233-41879255 CCGGGGCGGGCGGCGGGCGCAGG + Intronic
1179529727 21:42010422-42010444 GGGCGCCGGGCGCCGGAGGGCGG + Intergenic
1179742799 21:43427280-43427302 CGCGGCCGAGCGCCGGGCGGAGG + Intergenic
1179810207 21:43865247-43865269 CCGGGCCGGGCCCAGGGCCGAGG + Intronic
1180649985 22:17369604-17369626 CGAGGGCGGGCGCCGGGCGGGGG - Exonic
1180650218 22:17370307-17370329 CGGGGCCGGGCGCGGGGGGGGGG + Intronic
1180908366 22:19431576-19431598 GCGGGGCGGGCGGCGGCCGGAGG - Exonic
1181094356 22:20495624-20495646 CGGGGGCGGGCGCGGGCCGGAGG - Intronic
1182398965 22:30059846-30059868 ACGGGGCGGCGGCCGGACGGAGG - Intergenic
1182804344 22:33057962-33057984 CCGGGCCGGGCGCTGGGTGGAGG + Intronic
1182903989 22:33920873-33920895 CCTGGCCGGGCGCGGGAGGCGGG - Intronic
1183538277 22:38415622-38415644 CAGGGCAGGGCGCGGGAGGGCGG + Intergenic
1183606024 22:38867036-38867058 CCGGGCGGGGCAGGGGACGGCGG + Exonic
1184101426 22:42343527-42343549 CGGGGCCGGGCTCCGGAGCGCGG + Intronic
1184236710 22:43186999-43187021 CCGGGCCAGACGCCGGAGGAGGG - Exonic
1184737654 22:46408870-46408892 CAGGGGCGGGCGCCGGAGGAAGG + Intronic
1184759720 22:46537521-46537543 GCGGGCCCGGCGCGGGGCGGGGG + Intergenic
1184766907 22:46576978-46577000 CCGAGCCGGCCGCGGGGCGGGGG + Intronic
1185133163 22:49052092-49052114 CGGGGCCGGGCCCGGGACCGAGG - Intergenic
1185420274 22:50731049-50731071 CCGGGGCCGGGGCCGGACGCGGG - Intergenic
950650213 3:14402543-14402565 CCGGGCCGGGGGCGGGGCCGGGG - Intergenic
950683792 3:14602637-14602659 CGGGGCAGGGCGCCCGCCGGGGG - Intergenic
954110255 3:48429504-48429526 CTGGCCCGGGCGGCGGGCGGGGG - Intronic
954327184 3:49869938-49869960 CCGGGCCGGGGGCGGGCTGGGGG + Exonic
954468873 3:50674955-50674977 CGGCGCCGGGAGCCGGGCGGCGG + Intergenic
954615533 3:51967296-51967318 GCGGGCCGGGCGGGGCACGGCGG - Intronic
954812364 3:53256019-53256041 CGAGGCCGGGCGCGGGGCGGGGG + Exonic
958779424 3:98522984-98523006 CCGGGCCGGGCCGCGGCCCGGGG + Intronic
958814673 3:98901952-98901974 CCGGGCCGGGCGGGGGCCGCGGG - Intergenic
966886464 3:184380208-184380230 CCGGGCCGGGGGCGGTGCGGCGG - Exonic
967055379 3:185825189-185825211 CCGGGCCGGGCGGCGGCGCGCGG + Intergenic
967127225 3:186435402-186435424 ACGGGGCGGCCGCCGGGCGGGGG + Intergenic
968221388 3:196942652-196942674 CCGGGTCGGGCGCCGCGGGGCGG + Intergenic
968651944 4:1763607-1763629 GCGGGCGGGGCGCCGGGAGGGGG + Intergenic
968908051 4:3463556-3463578 GCGGGGCGGGCGGGGGACGGGGG + Intronic
969379109 4:6782807-6782829 CCGGGCGGCGCGGCGGCCGGCGG - Exonic
969614646 4:8245197-8245219 CCAGGCCGGGCGCTGGACACAGG - Intergenic
970409248 4:15790969-15790991 ACGGGGTGGCCGCCGGACGGAGG - Intronic
971351920 4:25862926-25862948 CCGGGCCGGCCGCCGCGCGCGGG + Exonic
972686883 4:41360700-41360722 CCGGGACCTGCGCCGGCCGGGGG + Intronic
973330417 4:48906376-48906398 CAGGGCTGGACGGCGGACGGGGG + Intronic
975795921 4:78007169-78007191 ACGGGCCGGCTGCCGGGCGGGGG + Intergenic
975983599 4:80184283-80184305 CCGGGGCGGGGGCGGGACGCCGG - Intronic
976390410 4:84499405-84499427 GCGAGCCGGGCGCAGGCCGGGGG + Intergenic
979134016 4:117085624-117085646 CCGGGCCTGGCGCCGGGTAGGGG - Intergenic
980075436 4:128288339-128288361 CCGGGCTGGACGCCTGGCGGAGG + Exonic
984888747 4:184473522-184473544 CCCGACCGGGCGCTGGCCGGCGG + Intronic
985580553 5:693434-693456 GCTGGGCGGGCGCCGGACGCTGG - Intergenic
985783621 5:1883090-1883112 CCCGGCCGCGCGGTGGACGGAGG + Intronic
987303480 5:16617181-16617203 CGGGGCCGGGCGCCGGGAGCTGG + Intergenic
989634851 5:43522254-43522276 ACGGGGCGGCTGCCGGACGGAGG - Intergenic
990954666 5:61331003-61331025 GCGTGCCAGGCGGCGGACGGCGG - Intergenic
991375092 5:65957899-65957921 CCGGGGCGGCTGCCGGGCGGAGG + Intronic
991594449 5:68288488-68288510 CCGGGCGGGGCGTGGGGCGGAGG + Intronic
992627547 5:78648865-78648887 CCGGCCCGCTCGCGGGACGGAGG - Intronic
995515966 5:112954963-112954985 ACGGGGCGGCCGCCGGGCGGAGG - Intergenic
996091442 5:119355826-119355848 TCGGGCCGGCAGCCGGGCGGAGG - Intronic
997470476 5:134114628-134114650 CCGGGCCGGGGGCGGGACACAGG - Intergenic
998150692 5:139756029-139756051 CCTGGCGGGGCGCGGGAGGGCGG - Intergenic
999322631 5:150624788-150624810 CTGGGCCTGGCGCGGGGCGGGGG + Intronic
1001653257 5:173329783-173329805 GCGGGCGGGGCGCGGGGCGGGGG - Intergenic
1001906557 5:175478448-175478470 CCGGGCCTGGACCCGGAGGGCGG + Exonic
1001928726 5:175658092-175658114 CCGGCGCGGGCGCGGGACCGAGG + Exonic
1002021205 5:176365542-176365564 TCGGGCCGGGCGAGGGACGCAGG - Exonic
1002055703 5:176596944-176596966 CCGGCACGGGCGGCGGGCGGCGG + Exonic
1002059913 5:176620165-176620187 CTGGGCTGGGCGCCGGGTGGGGG - Exonic
1002170358 5:177371109-177371131 CCGGGGCCGGGGCCGGGCGGAGG + Intronic
1002524409 5:179807158-179807180 CCGGGGCGGGGGGCGGGCGGCGG + Intronic
1002645088 5:180649058-180649080 CCCGGCCGGGCCCCGGACTTGGG - Intronic
1002936748 6:1680573-1680595 CCTGGCCGGGCGCCCAAGGGAGG - Intronic
1003290844 6:4776838-4776860 CCGGGAGGGGCGGCGGGCGGGGG - Intronic
1004043944 6:12009149-12009171 CCGGGCCGCGCGCTGGGCGGAGG + Intronic
1004561969 6:16760568-16760590 CGCGGCCGGGTGCCGGGCGGGGG - Intronic
1004664083 6:17735274-17735296 CCGGGCGGCTCGCCGGGCGGGGG + Intergenic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1006891493 6:37433150-37433172 CGGGGCCGGGACCCGGCCGGGGG + Intergenic
1006898258 6:37484311-37484333 CCCGGCGGGGCGCCAGAGGGCGG - Intronic
1006932829 6:37697800-37697822 CCGGGCCGGGCTCCGGGGCGCGG + Exonic
1007557812 6:42782000-42782022 CGGGGCCGGGGGCCGGAGCGCGG - Intronic
1007702229 6:43771935-43771957 CCCGGCCGGGCGGGGGAGGGCGG - Intronic
1007927737 6:45663543-45663565 GCGGGCCGGGCTCGGGGCGGCGG - Intronic
1008919240 6:56824799-56824821 ACGGGGCGGCTGCCGGACGGAGG - Intronic
1010428190 6:75749214-75749236 CTCGGCGGGGCGCCGGCCGGCGG + Intronic
1011734177 6:90296055-90296077 CCGGGCCGGGGGCAGGGCCGCGG + Intronic
1013155739 6:107490061-107490083 CCGAGCCGGGGGCGGGCCGGGGG - Exonic
1017834817 6:158168009-158168031 CCGGTCCGCGCGCCAGACGGCGG + Intronic
1017954800 6:159169244-159169266 GCGGGCGGGGCGCGGGACGAAGG - Intergenic
1018727748 6:166627016-166627038 CCGGGCTGGGCGCGGGGCGATGG - Intronic
1019112131 6:169724601-169724623 CCGGGCCGGGGGCCGCGGGGAGG - Intronic
1019395711 7:816706-816728 CCGGGGCGGGCGCCGGGCTGCGG + Intronic
1019421765 7:954177-954199 CCGGGCCGGGCGCAGCGGGGGGG - Intronic
1019725089 7:2597484-2597506 CCGGGCCAGGCGCCAGGCGCAGG - Intronic
1022286314 7:28958187-28958209 CCGGGCCGGCCTCCGGACAAAGG - Exonic
1022400183 7:30028816-30028838 CCGGGCCGGGGGCGCGCCGGGGG + Intronic
1022528309 7:31052309-31052331 CCAGGCTGGGCGCTGGAGGGAGG - Intergenic
1022536774 7:31103227-31103249 CCGGGCCAGTCGCCTGTCGGAGG - Exonic
1023937170 7:44748544-44748566 CGGGGCCGGGCGGCGGAGGCGGG - Intergenic
1025992470 7:66506241-66506263 TCGGGCCGGGGGCCGGTGGGTGG - Intergenic
1026837376 7:73647813-73647835 CAGGGGCGGGCGGCGGGCGGCGG + Intergenic
1026941263 7:74289376-74289398 CAGGGGCGGGCGCGGGAGGGCGG - Intergenic
1027189134 7:75987811-75987833 CTGGGCCGGGCGGAGGACAGAGG + Intronic
1029098350 7:98107011-98107033 GCGGACCGGGAGCCGGACCGAGG + Exonic
1030138930 7:106285332-106285354 CCGGCACGGGCGCGGGAGGGCGG + Intronic
1031919059 7:127588329-127588351 CGGGGGCGGGGCCCGGACGGGGG + Exonic
1033406410 7:141074149-141074171 CCGGGCCGTGCTCCGGTAGGCGG + Intergenic
1034441412 7:151087591-151087613 CCGGGCCTGGCGCTGGGCTGAGG + Intronic
1035169682 7:157010529-157010551 CCGGGGCGGGGCCCGCACGGAGG - Exonic
1035279455 7:157768441-157768463 CCGGGCCGGACGCCCCACGCTGG + Intronic
1035404383 7:158588126-158588148 CCGGGCCGGGCGGGGAGCGGCGG - Intergenic
1036810983 8:11867715-11867737 CCGGGCTGTGCGCCGGACCCCGG - Intronic
1036930585 8:12951884-12951906 CGGGCCCAGGCGCCGGACGCCGG + Intronic
1037134589 8:15446009-15446031 ACGGGCCGGCTGCCGGGCGGAGG + Intronic
1039467949 8:37797210-37797232 CCGGGCTGCGCGCCGGCCGGAGG - Intronic
1042137406 8:65645129-65645151 CCGCGCCGGCCGCCAGGCGGCGG + Intronic
1042926273 8:73971792-73971814 CCGGGCTGAGCGCGGGAGGGTGG - Intronic
1043053360 8:75407978-75408000 CCAGCCCGGGCCCCGGGCGGCGG - Intronic
1043502830 8:80873901-80873923 CGGGGCCGGGCCCGGGACAGGGG + Intronic
1047998471 8:130358246-130358268 CCAGGCCGGGCGGCGGGTGGCGG - Intronic
1047998614 8:130358719-130358741 CCGGGCCGGGGGCGGGGCGCGGG - Intronic
1049532245 8:143160351-143160373 CCGGGGCGGGGGCCGCGCGGGGG + Intronic
1049639336 8:143707595-143707617 CCGGGCCGGGGGCGGGGTGGGGG - Intronic
1056102440 9:83312751-83312773 CGGGGCGGGGCGCAGGGCGGCGG - Intronic
1057146855 9:92764456-92764478 CAGGCCCCGGCGCCGGGCGGGGG + Intronic
1057199883 9:93134295-93134317 GCGGGCCGGGGGCGGGCCGGGGG - Intergenic
1057921995 9:99105173-99105195 CCGGGCCGGGCCACAGGCGGTGG + Exonic
1058885886 9:109320830-109320852 CCGCGCCGCGCGCCGGCCGAGGG + Exonic
1058908257 9:109498361-109498383 CGGGCCCGCGCGCCGGGCGGGGG + Intergenic
1059414861 9:114156207-114156229 CCGGGCCAGGCGCGGCAGGGCGG - Intronic
1060700958 9:125748065-125748087 CCGGGCCCGGCGCGGGGCGATGG + Intronic
1061486683 9:130923868-130923890 CGGGGCCGGGAGCCTGAGGGAGG + Exonic
1061977321 9:134075953-134075975 ACGGGGCGGCGGCCGGACGGGGG - Intergenic
1062230602 9:135479804-135479826 GCGGCCCGGGCGCGGGGCGGCGG + Exonic
1062230648 9:135479930-135479952 GCGGGCCGGGGGCGGGCCGGAGG - Exonic
1062349637 9:136132661-136132683 CGAGGCCGGGCGCCTGACGCGGG - Intergenic
1062596506 9:137302168-137302190 CCGGGCCCGGCCGGGGACGGCGG + Exonic
1062659113 9:137619122-137619144 CCGGGCGGGGCGGCGGCAGGCGG + Intronic
1062659172 9:137619274-137619296 GCGGGCCGGGCGGCGGCTGGGGG + Intronic
1185750988 X:2609460-2609482 CCGGGGCGGCCACCAGACGGCGG - Intergenic
1187067500 X:15854856-15854878 CCGCCCCGGGGGCCGGACGAGGG + Exonic
1187915519 X:24149708-24149730 CTGGGCCGGGCTCCGGCTGGTGG - Intronic
1189325721 X:40109592-40109614 CCCGTCCGGGCCCCGGAGGGTGG - Intronic
1193969968 X:88039134-88039156 CCGGGTCGGGCGGGGGGCGGGGG - Intergenic
1197694898 X:129540305-129540327 CCGCGCCGGGCGCCGGGCGCCGG - Exonic
1197754309 X:129983712-129983734 CCGGGCCGGGCGCGGCGGGGAGG + Intronic
1198108613 X:133483812-133483834 ACGGGGCGGCAGCCGGACGGGGG + Intergenic
1200217527 X:154374672-154374694 GCGGGGCGGGCGCGGGGCGGGGG - Intergenic