ID: 1103779398

View in Genome Browser
Species Human (GRCh38)
Location 12:123389108-123389130
Sequence CCGGGGCGCCGCGGCGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1070
Summary {0: 1, 1: 1, 2: 11, 3: 119, 4: 938}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103779380_1103779398 19 Left 1103779380 12:123389066-123389088 CCATGGGGGAAGGGGGCGCCGTG 0: 1
1: 1
2: 1
3: 21
4: 250
Right 1103779398 12:123389108-123389130 CCGGGGCGCCGCGGCGGCGCTGG 0: 1
1: 1
2: 11
3: 119
4: 938
1103779385_1103779398 1 Left 1103779385 12:123389084-123389106 CCGTGGGGCGCCGCCGGCCCTTC 0: 2
1: 0
2: 1
3: 16
4: 126
Right 1103779398 12:123389108-123389130 CCGGGGCGCCGCGGCGGCGCTGG 0: 1
1: 1
2: 11
3: 119
4: 938
1103779379_1103779398 23 Left 1103779379 12:123389062-123389084 CCGGCCATGGGGGAAGGGGGCGC 0: 2
1: 1
2: 2
3: 18
4: 264
Right 1103779398 12:123389108-123389130 CCGGGGCGCCGCGGCGGCGCTGG 0: 1
1: 1
2: 11
3: 119
4: 938
1103779389_1103779398 -9 Left 1103779389 12:123389094-123389116 CCGCCGGCCCTTCCCCGGGGCGC 0: 2
1: 0
2: 3
3: 32
4: 334
Right 1103779398 12:123389108-123389130 CCGGGGCGCCGCGGCGGCGCTGG 0: 1
1: 1
2: 11
3: 119
4: 938
1103779375_1103779398 28 Left 1103779375 12:123389057-123389079 CCTCGCCGGCCATGGGGGAAGGG 0: 1
1: 2
2: 1
3: 16
4: 168
Right 1103779398 12:123389108-123389130 CCGGGGCGCCGCGGCGGCGCTGG 0: 1
1: 1
2: 11
3: 119
4: 938

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103779398 Original CRISPR CCGGGGCGCCGCGGCGGCGC TGG Intronic