ID: 1103783195

View in Genome Browser
Species Human (GRCh38)
Location 12:123413203-123413225
Sequence CCGCACCCGGCTTTTTTTTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 1, 2: 8, 3: 58, 4: 366}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103783195_1103783203 14 Left 1103783195 12:123413203-123413225 CCCCAAAAAAAAGCCGGGTGCGG 0: 1
1: 1
2: 8
3: 58
4: 366
Right 1103783203 12:123413240-123413262 AATCCCAGTGTGTCCGGAATTGG 0: 14
1: 19
2: 62
3: 181
4: 548
1103783195_1103783207 18 Left 1103783195 12:123413203-123413225 CCCCAAAAAAAAGCCGGGTGCGG 0: 1
1: 1
2: 8
3: 58
4: 366
Right 1103783207 12:123413244-123413266 CCAGTGTGTCCGGAATTGGTGGG 0: 33
1: 112
2: 405
3: 788
4: 790
1103783195_1103783205 17 Left 1103783195 12:123413203-123413225 CCCCAAAAAAAAGCCGGGTGCGG 0: 1
1: 1
2: 8
3: 58
4: 366
Right 1103783205 12:123413243-123413265 CCCAGTGTGTCCGGAATTGGTGG 0: 28
1: 71
2: 224
3: 529
4: 894
1103783195_1103783201 8 Left 1103783195 12:123413203-123413225 CCCCAAAAAAAAGCCGGGTGCGG 0: 1
1: 1
2: 8
3: 58
4: 366
Right 1103783201 12:123413234-123413256 GCCTGTAATCCCAGTGTGTCCGG 0: 9
1: 25
2: 337
3: 7300
4: 124136
1103783195_1103783208 25 Left 1103783195 12:123413203-123413225 CCCCAAAAAAAAGCCGGGTGCGG 0: 1
1: 1
2: 8
3: 58
4: 366
Right 1103783208 12:123413251-123413273 GTCCGGAATTGGTGGGTTCTTGG 0: 864
1: 1041
2: 450
3: 161
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103783195 Original CRISPR CCGCACCCGGCTTTTTTTTG GGG (reversed) Exonic
901042777 1:6375493-6375515 CCACACCCAGCTAATTTTTGGGG - Intronic
901543285 1:9935837-9935859 CGGCACCCTGCTTTATTATGTGG - Intronic
901570523 1:10156393-10156415 CCACACCCAGCTAATTTTTGTGG + Intronic
902261612 1:15229401-15229423 CCACACCCAGCTAATTTTTGTGG - Intergenic
903187639 1:21637993-21638015 CCATACCCGGCTAATTTTTGTGG - Intronic
903247000 1:22023514-22023536 CCACGCCCAGCCTTTTTTTGAGG - Intergenic
903434052 1:23332891-23332913 CCACACCCGGCTGCTTTTTTTGG - Intronic
903915278 1:26759356-26759378 CCACACCTGGCTTATTTTTGGGG + Intronic
903947587 1:26973420-26973442 CCACACCCGGCTAATCTTTGTGG - Intergenic
904415064 1:30355847-30355869 CCGCGCCCAGCTAATTTTTGTGG + Intergenic
904472414 1:30744228-30744250 CCACACCTGCCTTCTTTTTGGGG - Intronic
904661411 1:32088125-32088147 CCGTGCCTGGCTTTTTTTTTTGG - Intronic
904669875 1:32155892-32155914 CCACGCCCGGCTAATTTTTGTGG + Intronic
904739452 1:32662039-32662061 CCACACCCAGCTAATTTTTGTGG + Intronic
905601242 1:39253667-39253689 CCACGCCCGGCTAATTTTTGAGG + Intronic
906314885 1:44780096-44780118 CCGCACCCGGCCTGCTTTTTGGG + Intergenic
906624167 1:47311438-47311460 CTGCACCCGGCTAATTTTTTTGG + Intronic
907254804 1:53170840-53170862 CCACACCCAGCTAATTTTTGTGG - Intergenic
908280254 1:62526093-62526115 CCACGCCCGGCTATTTTTTGTGG + Intronic
908758207 1:67488357-67488379 CCACACCCGGCTGTATTTTTTGG - Intergenic
909159949 1:72134492-72134514 CCGCACCTGGCTATTTTTTGGGG + Intronic
910477393 1:87621720-87621742 TCACACCCGGCTAATTTTTGTGG - Intergenic
910658458 1:89643245-89643267 CCACACCCAGCTATTTTTTGTGG + Intronic
910962079 1:92773483-92773505 CCGCACTTGGCTAATTTTTGGGG - Intronic
912394028 1:109325843-109325865 CCACACCCAGCTAATTTTTGTGG - Intronic
912836847 1:113004146-113004168 CTGCACCCGGACTTTTTTTTGGG + Intergenic
913000057 1:114571349-114571371 CTGTACCCAGCTTTTTTTTGCGG + Intronic
915005946 1:152636363-152636385 CCACACCCAGCTAATTTTTGTGG - Intergenic
915115559 1:153596937-153596959 CCACGCCCGGCTAATTTTTGGGG + Intergenic
917024372 1:170625999-170626021 CCACACCTGGCTTTTTTTTTGGG + Intergenic
919888286 1:201950956-201950978 CCACACCCGGCTAGTTTTTGTGG - Intergenic
919920806 1:202165449-202165471 CCGCAGACCGCTTTTTTGTGGGG + Intergenic
920107858 1:203567144-203567166 CCACGCCCGGCTAATTTTTGTGG - Intergenic
920791985 1:209101820-209101842 CCACACCTGGCTAATTTTTGTGG + Intergenic
921357134 1:214295631-214295653 CAGCACCAGGCTTTGTTCTGAGG - Intronic
922528291 1:226323319-226323341 CCTCACCCAGCTAATTTTTGTGG - Intergenic
923134248 1:231103627-231103649 CCACACCTGGCTAATTTTTGTGG + Intergenic
924364971 1:243283136-243283158 CCGCACCCGGCCTGATTTTTGGG + Intronic
924762383 1:247000347-247000369 CCACGCCCGGCTAATTTTTGTGG - Intronic
1064201402 10:13288022-13288044 CCACGCCCGGCTAATTTTTGTGG - Intronic
1064759323 10:18602216-18602238 CCACACCCAGCTAATTTTTGTGG + Intronic
1064800476 10:19064995-19065017 CCGCACCCGGCCCTTTTCTAGGG - Intronic
1065491077 10:26282096-26282118 CCACACCTGGCTAATTTTTGTGG + Intronic
1066118809 10:32263767-32263789 ACGAACCCTGCTTTTTTTTCTGG + Intergenic
1066963331 10:42240968-42240990 CCACACCCAGCTAATTTTTGCGG + Intergenic
1068281057 10:54870493-54870515 CCGCGCCCGGTCTTTTTATGTGG - Intronic
1069384685 10:67873701-67873723 CCACACCTGGCTAATTTTTGTGG - Intergenic
1072743636 10:97925113-97925135 CCACACCTGGCTAATTTTTGAGG - Intronic
1073126038 10:101150208-101150230 CCACACCCGCCTTTTTTTTCTGG + Intergenic
1073795332 10:106981366-106981388 TTGCACCTGGCTCTTTTTTGAGG + Intronic
1077923833 11:6661297-6661319 CCACACTCGGCTAGTTTTTGTGG + Intergenic
1078227826 11:9409000-9409022 CTGCACCCGGCTTTTCTGGGGGG + Intronic
1079025476 11:16944354-16944376 CCGCGCCCGGCTTATTTTTTGGG - Intronic
1079517129 11:21282333-21282355 CCACACCTGGCTAATTTTTGTGG + Intronic
1080526842 11:33130871-33130893 CCACACCCGGCTAATTTTTGTGG - Intronic
1081117595 11:39223342-39223364 CCGTGCCCGGCCTTTTCTTGGGG - Intergenic
1081893530 11:46565549-46565571 CCACACCCGGCTAATTTTTTTGG - Intronic
1083853824 11:65382375-65382397 CCGCACCCGGCCTCTCTCTGTGG - Intronic
1084318908 11:68362533-68362555 CCACACCCAGCTAATTTTTGGGG - Intronic
1085240848 11:75053849-75053871 CCGCACCCGGCTAATTTTTTTGG + Intergenic
1086036901 11:82427034-82427056 CCGCACCCAGCCTCTTTTTGTGG - Intergenic
1087755030 11:102046537-102046559 CCGCACCCGGCCTGTTTCTATGG - Intergenic
1087760343 11:102098575-102098597 CCGTGCCCGGCCTTTTTTTTTGG - Intergenic
1089482714 11:118820274-118820296 CCACACCCGGCTAATTTTTGTGG + Intergenic
1092200217 12:6577264-6577286 CCACACCCAGCTGTTTTTTTTGG - Intronic
1093346959 12:18049742-18049764 CCACACCCGGCTAATTTTTTTGG - Intergenic
1094612047 12:32003781-32003803 CCACCCCCAGCTTATTTTTGTGG + Intergenic
1096002129 12:48138882-48138904 CCACACCCGGCTAATTTTTTTGG - Intronic
1096811980 12:54176514-54176536 CCGTGCCCGGCCTTTTTTTTTGG - Intronic
1097216352 12:57416815-57416837 GCCCAGCTGGCTTTTTTTTGTGG - Intronic
1097255390 12:57669867-57669889 CCCCACCCGGCTAATTTTTGGGG - Intergenic
1097297325 12:57980728-57980750 CCACACCCAGCTAATTTTTGTGG - Intergenic
1097668112 12:62504535-62504557 CCGCACCCGGCCTGTTTTTATGG + Intronic
1097853444 12:64436734-64436756 CCACACCTGGCTAATTTTTGTGG + Intronic
1098353677 12:69589272-69589294 CCCCACCCCTCTTTTTTTTTTGG + Intronic
1100299521 12:93294329-93294351 CCACACCTGGCTAATTTTTGTGG - Intergenic
1101902296 12:108799741-108799763 CCACTCCTGGCTTTTTTTTGCGG - Intronic
1102087059 12:110150365-110150387 CCGCACCCGGCCATGTTTTTAGG + Intronic
1102135297 12:110569040-110569062 CTGCACCTGGCTTTTTTTGAGGG - Intronic
1102340141 12:112115021-112115043 CCACGCCCGGCTAATTTTTGTGG - Intergenic
1102411743 12:112726083-112726105 CCGCACCCAGCCTTTTTTTTCGG + Intronic
1103588925 12:121976751-121976773 CCACACCGGGCAATTTTTTGGGG - Intronic
1103783195 12:123413203-123413225 CCGCACCCGGCTTTTTTTTGGGG - Exonic
1104457687 12:128928910-128928932 CCGCACCCGGCCTCTTTGTGGGG + Intronic
1105457727 13:20556739-20556761 CCGCACCTGGCTAATTTTTTGGG + Intergenic
1105758471 13:23491679-23491701 CTGTTCCCGGCTGTTTTTTGAGG + Intergenic
1105777733 13:23678608-23678630 CCACACCCGGCTAATTTTTGTGG + Intergenic
1106005437 13:25765853-25765875 ACAGACCCGGGTTTTTTTTGAGG - Intronic
1109555711 13:63972940-63972962 CCACACCCAGCTAATTTTTGTGG + Intergenic
1111718674 13:91913538-91913560 CAGATCCCAGCTTTTTTTTGAGG - Intronic
1112034484 13:95484708-95484730 CCACACCTGGCTAATTTTTGTGG - Intronic
1112065111 13:95784519-95784541 CTGCACCCAGAGTTTTTTTGGGG + Intronic
1112522131 13:100105684-100105706 CCACACCCAGCTAATTTTTGTGG - Intronic
1113782446 13:112984388-112984410 CCGCACCTGGCTAATTTTTTTGG + Intronic
1115627991 14:35214608-35214630 CCGGCCCCAGCTTTGTTTTGGGG - Intronic
1116458885 14:45147905-45147927 TCACGCCCGGCTTTTTTTTTGGG - Intronic
1117554550 14:56870847-56870869 CCACACCTGGCTAATTTTTGGGG + Intergenic
1117682256 14:58216278-58216300 CCACACCCAGCTAATTTTTGGGG + Intronic
1118743010 14:68754732-68754754 CCACGCCCGGCTAATTTTTGTGG + Intergenic
1119596859 14:75943081-75943103 CCGACACCGCCTTTTTTTTGTGG - Intronic
1119838337 14:77771201-77771223 CCCCACCCCAATTTTTTTTGAGG + Intergenic
1120963530 14:90147401-90147423 CCACACCTGGCTTGTTTTTTTGG + Intronic
1121169938 14:91845070-91845092 CGTCACCCGGCTAATTTTTGTGG - Intronic
1121726439 14:96155331-96155353 CTGCACCCGGCCTTAGTTTGCGG - Intergenic
1123029355 14:105444081-105444103 CCGCACCCGGCCTTTTTAGATGG - Intronic
1202843285 14_GL000009v2_random:143967-143989 CCATACCCGGCTAATTTTTGTGG - Intergenic
1202912682 14_GL000194v1_random:134219-134241 CCATACCCGGCTAATTTTTGTGG - Intergenic
1202879954 14_KI270722v1_random:48455-48477 CCATACCCGGCTGATTTTTGTGG + Intergenic
1123441726 15:20296439-20296461 CCACACCCAGCTAATTTTTGCGG - Intergenic
1123973824 15:25533857-25533879 CCACACCTGGCTAATTTTTGTGG + Intergenic
1124322780 15:28727266-28727288 CCACACCCGGCTAATCTTTGTGG - Intronic
1124523698 15:30427831-30427853 CCACACCCGGCTAATCTTTGTGG - Intergenic
1124534969 15:30538384-30538406 CCACACCCGGCTAATCTTTGTGG + Intergenic
1124574409 15:30895538-30895560 CCACACCCGGCTAATCTTTGTGG + Intergenic
1124763680 15:32469217-32469239 CCACACCCGGCTAATCTTTGTGG - Intergenic
1125658323 15:41376395-41376417 CCGCGCCCAGCCTGTTTTTGAGG - Intronic
1125700901 15:41682634-41682656 CCACGCCCGGCTAATTTTTGTGG + Intronic
1125701823 15:41693128-41693150 CCACACCCGGCTTCTATTGGAGG + Intronic
1126116125 15:45209282-45209304 CCACACCTGGCTAATTTTTGGGG - Intergenic
1129053214 15:72799419-72799441 CCGCACCTGGCTAATTTTTGGGG + Intergenic
1129448949 15:75638901-75638923 CCGCGCCCGGCTAATTTTTGTGG - Intergenic
1129967809 15:79752446-79752468 CCACACCTGGCTGATTTTTGAGG + Intergenic
1130084640 15:80767137-80767159 CCACACCCGGCTACTTTTTGTGG - Intergenic
1130945271 15:88546383-88546405 CCGCCCCAGGCTTTTCTTTCCGG - Intronic
1131398760 15:92108035-92108057 CTGCAGCCCGCTTTTTTTAGGGG - Intronic
1131733033 15:95302030-95302052 CCACACCCAGCTAATTTTTGCGG - Intergenic
1132918150 16:2365890-2365912 CTGCCCCCGGCTTTTCTCTGTGG + Intergenic
1133341500 16:5039458-5039480 CCACACCCGGCTAATTTTGGGGG - Intronic
1134027111 16:10962901-10962923 CCACACCCAGCTAATTTTTGTGG - Intronic
1134109287 16:11504559-11504581 ACGTATCCGTCTTTTTTTTGGGG - Intronic
1134131548 16:11653811-11653833 CCACACCTGGCTAATTTTTGTGG + Intergenic
1134439295 16:14288234-14288256 CCACACCTGGCTTTTTTTTTGGG + Intergenic
1135996420 16:27252761-27252783 CCACACCCGGCTAATTTTTGTGG - Intronic
1136719472 16:32309072-32309094 CCACACCCAGCTAATTTTTGCGG + Intergenic
1136724501 16:32347474-32347496 CCACACCCAGCTAATTTTTGCGG + Intergenic
1136837845 16:33515352-33515374 CCACACCCAGCTAATTTTTGCGG + Intergenic
1136842828 16:33553514-33553536 CCACACCCAGCTAATTTTTGCGG + Intergenic
1137620284 16:49871830-49871852 CCACGCCCGGCTAATTTTTGTGG - Intergenic
1141102210 16:81206057-81206079 ACCCACCCACCTTTTTTTTGGGG - Intergenic
1141589016 16:85055212-85055234 CCGCCCCCAGCCTCTTTTTGTGG + Intronic
1141600382 16:85122476-85122498 CCACACCTGGCTAATTTTTGTGG - Intergenic
1141918171 16:87115007-87115029 CAGCACAAGGCTTTTTTTGGTGG - Intronic
1203001929 16_KI270728v1_random:170281-170303 CCACACCCAGCTAATTTTTGCGG - Intergenic
1203006959 16_KI270728v1_random:208697-208719 CCACACCCAGCTAATTTTTGCGG - Intergenic
1203133533 16_KI270728v1_random:1706687-1706709 CCACACCCAGCTAATTTTTGCGG - Intergenic
1203148028 16_KI270728v1_random:1815636-1815658 CCACACCCAGCTAATTTTTGCGG + Intergenic
1203152993 16_KI270728v1_random:1853812-1853834 CCACACCCAGCTAATTTTTGCGG + Intergenic
1142647302 17:1322925-1322947 CCACACCCAGCTAATTTTTGGGG + Intergenic
1143191275 17:5041900-5041922 CCGCACCCGGCCTATTTTTAAGG + Intronic
1143819450 17:9547944-9547966 CCACACCCAGCTAATTTTTGTGG + Intronic
1144052817 17:11511575-11511597 CTGAACCAGGCATTTTTTTGGGG - Intronic
1144316749 17:14069332-14069354 CCGCGCGCGGCTTTTTCTTCAGG + Intergenic
1144560341 17:16315984-16316006 CCGCGCCCGGCTCCTTTTTCAGG + Intronic
1145856850 17:28167703-28167725 CCACACCTGGCTAATTTTTGTGG - Intronic
1146859646 17:36285978-36286000 CCACACCTGGCTCATTTTTGTGG + Intronic
1147089970 17:38090065-38090087 CCACACCTGGCTCATTTTTGTGG + Intergenic
1147107241 17:38230456-38230478 CCACACCTGGCTCATTTTTGTGG - Intergenic
1147818929 17:43230221-43230243 CCACGCCCGGCTAATTTTTGTGG - Intergenic
1147820307 17:43237604-43237626 CCACGCCCGGCTACTTTTTGTGG + Intergenic
1147822412 17:43249488-43249510 CCACGCCCGGCTACTTTTTGTGG + Intergenic
1147823336 17:43254935-43254957 CCACGCCCGGCTACTTTTTGTGG + Intergenic
1147823705 17:43257076-43257098 CCACGCCCGGCTACTTTTTGTGG + Intergenic
1147824378 17:43261135-43261157 CCACGCCCGGCTACTTTTTGTGG + Intergenic
1147824921 17:43264277-43264299 CCACGCCCGGCTACTTTTTGTGG + Intergenic
1147828042 17:43281799-43281821 CCACGCCCGGCTACTTTTTGTGG + Intergenic
1147832212 17:43304923-43304945 CCACGCCCGGCTAATTTTTGTGG - Intergenic
1148062355 17:44845641-44845663 CCACACCCAGCTAGTTTTTGGGG - Intergenic
1148430831 17:47642192-47642214 CCACACCTGGCTAATTTTTGGGG - Intergenic
1150093507 17:62351578-62351600 CCACACCCAGCTAATTTTTGTGG + Intergenic
1150685089 17:67314155-67314177 CCACACCTGGCTAATTTTTGTGG - Intergenic
1151044523 17:70903826-70903848 CCGCACCTGGCCTTTTTTTGGGG + Intergenic
1151241156 17:72758946-72758968 CCACACCCGGCTAATTTTTGTGG - Intronic
1151630429 17:75307457-75307479 CCACACCCGGCTAATTTTTGTGG + Intergenic
1151740971 17:75981737-75981759 CCGCACCCAGCTTATATTTAGGG - Intronic
1152326183 17:79639328-79639350 CCGCGCCCGGCTAATTTTTTTGG + Intergenic
1152464812 17:80460024-80460046 CCGCGCCCGGCCTTTCATTGTGG - Intergenic
1152736125 17:81997777-81997799 CCGCGCCCAGCTCTTTTTTCTGG + Intronic
1152841478 17:82571443-82571465 CCGCGCCCGGCTAATTTTTGTGG - Intronic
1152968004 18:134336-134358 CCGCACCCGGCCTGATTGTGGGG - Intergenic
1154126842 18:11699348-11699370 CCACACCTGGCTAATTTTTGGGG + Intronic
1155699619 18:28727499-28727521 CCACACCCAGCTAATTTTTGTGG - Intergenic
1156620499 18:38845927-38845949 CCACACCTGGCTAATTTTTGGGG - Intergenic
1156805520 18:41174598-41174620 CCACACCCGGCTAATTTTTTTGG - Intergenic
1157257003 18:46148475-46148497 CTGCACCTGGCTTTGTTTTTTGG + Intergenic
1159003440 18:62992628-62992650 CTGCGCCCAGCTTTATTTTGTGG - Intergenic
1159589202 18:70314098-70314120 CCACACCCGGCTAATTTTTGTGG - Intronic
1161020569 19:2009172-2009194 CCACGCCCGGCTAATTTTTGTGG + Intronic
1161147533 19:2687960-2687982 CCGCGCCCGGCTATTTTATCTGG - Intronic
1161547960 19:4893750-4893772 CCGCACCCGGCCTTCCTTTTTGG - Intronic
1161624249 19:5316817-5316839 CCACACCCGGCTGTGATTTGGGG + Intronic
1162239268 19:9335688-9335710 CCACACCTGGCTAATTTTTGTGG + Intronic
1162240964 19:9354064-9354086 CCACACCCGGCATGTGTTTGTGG + Intronic
1162358758 19:10204435-10204457 CCACACACGGCTAATTTTTGAGG - Intronic
1163112801 19:15171503-15171525 CCACACCTGGCTAATTTTTGGGG + Intronic
1163724713 19:18916027-18916049 CCACACCTGGCTAATTTTTGAGG - Intronic
1163787840 19:19285719-19285741 CCACACCCGGCTAATTTTTGTGG + Intronic
1164131750 19:22369331-22369353 CCATGCCCGGCCTTTTTTTGAGG - Intergenic
1164313503 19:24066742-24066764 CCACACCTGGCTGATTTTTGTGG - Intronic
1164320003 19:24135824-24135846 CCACACCTGGCCTTTTTTTTTGG + Intergenic
1165008160 19:32823366-32823388 CCCCACACAGCTTTTTTTTGGGG + Intronic
1165072858 19:33265537-33265559 CCCCACCTGGCTTCATTTTGGGG + Intergenic
1165569796 19:36766042-36766064 CCACACCTGGCTATTTTTTTTGG + Intronic
1166225863 19:41394876-41394898 CCGCGCCCGGCTAATTTTTGTGG - Intronic
1166502212 19:43350164-43350186 CCGCGCCCAGCTAATTTTTGTGG - Intergenic
1166803864 19:45473473-45473495 CCACACCCACCCTTTTTTTGGGG + Exonic
1168050294 19:53824750-53824772 CCACACCCAGCTAATTTTTGTGG + Intergenic
1168060064 19:53886392-53886414 CCGCACCCAGCCGATTTTTGGGG + Intronic
1168608358 19:57777909-57777931 CCACGCCCGGCTAATTTTTGGGG + Intronic
1168708935 19:58486697-58486719 CCGCACCCAGCTTTTTTTTTTGG + Intronic
1202655573 1_KI270708v1_random:17491-17513 CCATACCCGGCTGATTTTTGTGG + Intergenic
925084927 2:1100433-1100455 CCGCACCCAGCCTCTTTTTGAGG + Intronic
926286080 2:11489301-11489323 CCACGCCCGGCTAATTTTTGTGG - Intergenic
926475069 2:13311596-13311618 CTGGACCTGGGTTTTTTTTGTGG + Intergenic
926646598 2:15296384-15296406 CCACACCCGGCTAATTTTTTTGG - Intronic
928508876 2:31983103-31983125 CCACACCCAGCTAATTTTTGTGG - Intronic
928515168 2:32038389-32038411 CCGCGTCCGGCCTTATTTTGAGG + Intronic
928743571 2:34385359-34385381 TCACACACGGCTTATTTTTGAGG - Intergenic
929132974 2:38596412-38596434 CCACACCTGGCTGATTTTTGTGG + Intronic
929155247 2:38783158-38783180 CCGTGCCCGGCTGTTTTTTGTGG + Exonic
930623434 2:53668510-53668532 TAGCACCCAGCTTTTTCTTGGGG - Intronic
930773336 2:55149583-55149605 CCACACCTGGCTAATTTTTGTGG - Intergenic
931386322 2:61800957-61800979 CCACACCCAGCTAATTTTTGTGG + Intergenic
931726204 2:65113348-65113370 CTGCACCAGGCTTTTTTTAAAGG - Intronic
934066934 2:88349655-88349677 CCGCGCCCGGCTAATTTTTGTGG - Intergenic
935167556 2:100582446-100582468 CCGCACCCGGCCTTTTTTTGGGG - Intergenic
935632840 2:105226075-105226097 CCACACCCAGCTAATTTTTGTGG - Intergenic
936382351 2:111997759-111997781 CCGCACTCGGCCTATTTTTAAGG - Intronic
937403558 2:121607049-121607071 CCGTACCCGGCCTTTTTTGACGG - Intronic
940671788 2:156678967-156678989 CCGCGCCCGGCTAATTTTTTTGG - Intergenic
943435683 2:187863843-187863865 CCTGACCCTTCTTTTTTTTGAGG - Intergenic
944145737 2:196505382-196505404 CCACACCCAGCTAATTTTTGTGG - Intronic
945065907 2:205947377-205947399 CCCCCCCAAGCTTTTTTTTGAGG - Intergenic
945275739 2:207985830-207985852 CCACACCCGGCTAATTTTTTTGG - Intronic
945588780 2:211701600-211701622 CCGCGCCCGGCTAATTTTTTTGG - Intronic
946378203 2:219327066-219327088 CTGGACCCTGCTGTTTTTTGAGG - Intergenic
946958417 2:224957287-224957309 CCCCCCCCGGCTTTGTTTTTCGG + Intronic
947206115 2:227662651-227662673 CTGCACCCGGCCTCTTTTTCAGG + Intergenic
947381548 2:229550146-229550168 CCACACCCAGCTAATTTTTGTGG + Intronic
948984342 2:241510988-241511010 CCACACCCAGCTAATTTTTGTGG + Intergenic
949056447 2:241930439-241930461 CTGCGTCCGGCTTTTTTTTTTGG + Intergenic
1169063040 20:2675360-2675382 CCACACCTGGCTTTTTTGTTTGG + Intergenic
1169126758 20:3133906-3133928 CCACATCCGGCTAATTTTTGGGG + Intronic
1170994603 20:21340137-21340159 CCACACCCGGCTAATTTTTGTGG - Intronic
1172180710 20:33001822-33001844 CCACGCCCGGCTAATTTTTGTGG + Intronic
1172535801 20:35672246-35672268 CTGTGCCCGGCTTTTTTTTTTGG + Intronic
1174832095 20:53822538-53822560 CCACACCCGGCTAATTTTTTTGG + Intergenic
1175357476 20:58380335-58380357 CCGAAGCCGGGTTTTTTTTTTGG + Intergenic
1176202721 20:63869970-63869992 CCACACCTGGCTAATTTTTGGGG - Intronic
1176632042 21:9148891-9148913 CCATACCCGGCTAATTTTTGTGG - Intergenic
1177188814 21:17826620-17826642 CCACACCCGGCTAATTTTTTTGG - Intergenic
1177440488 21:21116697-21116719 CCGCACCCAGCTATTTTTTTTGG - Intronic
1179338480 21:40481197-40481219 CCGCACCCGGCCTGTTCTTGTGG - Intronic
1179718590 21:43302773-43302795 CCTCACCTGGCTCTGTTTTGGGG + Intergenic
1179768929 21:43598358-43598380 CCACACCCGGCTAATTTTTGTGG + Intronic
1180309902 22:11160120-11160142 CCACACCCAGCTAATTTTTGCGG - Intergenic
1180374567 22:12078760-12078782 CCATACCCGGCTAATTTTTGTGG + Intergenic
1180387934 22:12196952-12196974 CCATACCCGGCTAATTTTTGTGG - Intergenic
1180548379 22:16521930-16521952 CCACACCCAGCTAATTTTTGCGG - Intergenic
1180674353 22:17577013-17577035 CCGCACCTGGCTAATTTTTTTGG + Intronic
1180760106 22:18195657-18195679 CCACACCCGGCTAATTTTTTTGG + Intergenic
1180770417 22:18379956-18379978 CCACACCCGGCTAATTTTTTTGG + Intergenic
1180775562 22:18429039-18429061 CCACACCCGGCTAATTTTTTTGG - Intergenic
1180789106 22:18564600-18564622 CCACACCCAGCTGATTTTTGTGG + Intergenic
1181071561 22:20345058-20345080 CCACACCCGGCTAATTTTTTTGG - Intergenic
1181194633 22:21174008-21174030 CCACACCCGGCTAATTTTTTTGG - Intergenic
1181214810 22:21318770-21318792 CCACACCCGGCTAATTTTTTTGG + Intergenic
1181232633 22:21430712-21430734 CCACACCCAGCTAATTTTTGTGG - Intronic
1181246018 22:21504145-21504167 CCACACCCAGCTAATTTTTGTGG + Intergenic
1182211073 22:28678368-28678390 CCACACCCAGCTAATTTTTGCGG + Intronic
1182224902 22:28789982-28790004 CCACACCTGGCTAATTTTTGTGG + Intergenic
1182291839 22:29286127-29286149 CCGCACCCGGCCTGATTTTTTGG + Intronic
1183573280 22:38670238-38670260 CCATACCCGGCTAATTTTTGGGG - Intronic
1183909582 22:41068368-41068390 CCGTGCCCGGCTATTTTTTTTGG + Intergenic
1183916580 22:41125406-41125428 CTGCGCCCGGCTGTTTTTTGGGG + Intronic
1184721271 22:46315042-46315064 CCACACCCGGCTAATTTTTGTGG + Intronic
1184772090 22:46603361-46603383 CCACACCCGGCTAATTTTTTTGG + Intronic
1185189907 22:49428618-49428640 CCACACCTGGCTTTTTTTTGGGG + Intronic
949496233 3:4634892-4634914 CCACACCTGGCTAATTTTTGGGG + Intronic
949534207 3:4983310-4983332 CTGCATCCGGTTCTTTTTTGTGG - Exonic
950514281 3:13454001-13454023 CCGCACCCAGCTAATTTTTGCGG - Intergenic
951038847 3:17966105-17966127 CCACACCTGGCTGATTTTTGTGG + Intronic
954341611 3:49958593-49958615 CCACGCCCGGCTAATTTTTGTGG - Intronic
956422220 3:69097313-69097335 CCACACCTGGCTAATTTTTGTGG + Intronic
958562175 3:95760191-95760213 CTGCAGCCTGCTTTTCTTTGTGG + Intergenic
959982453 3:112530401-112530423 CCCCCCCCGCCTTTTTTTTTTGG - Intergenic
960049327 3:113225116-113225138 CCACACCCGACTTATTTTTGTGG - Intronic
961445201 3:126977270-126977292 CTGCACCTGGATTTTCTTTGGGG + Intergenic
961692495 3:128680339-128680361 CCAGCCCGGGCTTTTTTTTGGGG + Intronic
962816893 3:139008525-139008547 CTGCACCCGGCCATATTTTGAGG + Intronic
963296209 3:143549509-143549531 CCCCACACTGCCTTTTTTTGGGG - Intronic
963597871 3:147350812-147350834 CTCCACCCAGCTTTTATTTGCGG - Intergenic
964009541 3:151874328-151874350 CCACGCCCGGCTATTTTTTTTGG + Intronic
964199836 3:154106662-154106684 CTGAACCAGGCTTTTTTTTGTGG - Intergenic
965582939 3:170288591-170288613 CCACACCTGGCTAGTTTTTGTGG - Intronic
965599878 3:170444214-170444236 CCACACCAGGCTAATTTTTGTGG + Intronic
966310410 3:178587577-178587599 CCACACCCGGCTAATTTTTTGGG + Intronic
966395785 3:179501452-179501474 CCACACCTGGCTAATTTTTGGGG + Intergenic
966981140 3:185136754-185136776 CCATACCCGGCTAATTTTTGTGG - Intronic
967765251 3:193272151-193272173 CCGCACCTGGCCTGTTATTGTGG - Intronic
967848866 3:194066716-194066738 CTACACCCAGTTTTTTTTTGAGG - Intergenic
967984115 3:195082691-195082713 CCACACCCGGCTAATTTTTGTGG - Intronic
968340878 3:197954487-197954509 CCACACCCAGCTAATTTTTGGGG + Intronic
968694228 4:2014044-2014066 CCACACCCAGCCTATTTTTGTGG + Intronic
968838009 4:2979721-2979743 CCACACATGGATTTTTTTTGGGG - Intronic
969351298 4:6599506-6599528 CCACACCCGGCTCATTTTTTTGG - Intronic
970609393 4:17711189-17711211 CCACATCTGGCTTTTTTTTTTGG - Intronic
972446633 4:39150577-39150599 CCGCACCCGGCCTTTACCTGTGG - Intergenic
972506420 4:39724261-39724283 CCACACCTGGCTAATTTTTGTGG + Intronic
972576368 4:40355907-40355929 CCACACCCGGCTAATTTTTTTGG + Intergenic
973649017 4:52979047-52979069 ACACACCAGGCCTTTTTTTGGGG + Intronic
973985702 4:56350297-56350319 CCGCACCCAGCTAATTTTCGTGG - Intronic
976589236 4:86832449-86832471 CCACACCCGGCTAATTTTTTTGG - Intronic
978894827 4:113873989-113874011 CCTCATCTGGCTTTTTTTTAAGG - Intergenic
980027156 4:127781397-127781419 CCACACTGGGCTCTTTTTTGAGG + Intergenic
982140954 4:152317468-152317490 CTGCACCCAGCTCCTTTTTGGGG - Intergenic
982760714 4:159279832-159279854 CCACACCCAGCTAATTTTTGTGG + Intronic
983085607 4:163440725-163440747 CCACACCCAGCTAGTTTTTGTGG - Intergenic
984023868 4:174519956-174519978 CTGCACCCGGCCTTTTTTCATGG + Intronic
985829149 5:2215233-2215255 CCTCACCAGGCTTTTTATTTGGG + Intergenic
987096934 5:14558568-14558590 CCACACCTGGCTAATTTTTGTGG - Intergenic
987123181 5:14787021-14787043 CCGCACCCGGCCTGTTTCTTGGG - Intronic
988664259 5:33307967-33307989 CCACACCTGGCTAATTTTTGTGG - Intergenic
990982464 5:61614459-61614481 CCACACCCAGCTAATTTTTGTGG + Intergenic
991734448 5:69618916-69618938 CTGCACCCAGTTTCTTTTTGAGG - Intergenic
991780530 5:70127809-70127831 CTGCACCCAGTTTCTTTTTGAGG + Intergenic
991810882 5:70474051-70474073 CTGCACCCAGTTTCTTTTTGAGG - Intergenic
991859818 5:71003232-71003254 CTGCACCCAGTTTCTTTTTGAGG + Intronic
991872978 5:71128128-71128150 CTGCACCCAGTTTCTTTTTGAGG + Intergenic
992511657 5:77442600-77442622 CCGCACCCGGCTTTTTTTAAAGG - Intronic
992681885 5:79161716-79161738 CCACACCTGGCTAATTTTTGTGG + Intronic
992958732 5:81937864-81937886 CCACACCCGGCTAATTTTTGTGG + Intergenic
994631475 5:102293888-102293910 CCGCACCCGGCTAATTTTTGTGG + Intronic
995236616 5:109836263-109836285 CCACACCTGGCTAATTTTTGTGG + Intronic
996482506 5:123990869-123990891 CCAAACCCTGCTTTTTTTTTAGG - Intergenic
998183171 5:139959664-139959686 CCGCGCCTGGCTTTTTTTTTTGG + Intronic
998240879 5:140443398-140443420 CCACGCCCGGCCTTTTTTTTGGG - Intronic
998375243 5:141686310-141686332 CCACATCCGGCTAATTTTTGTGG + Intergenic
998508571 5:142692179-142692201 CCACACCCAGCTAATTTTTGTGG - Intronic
999290668 5:150423654-150423676 CCACACCTGGCTTTTTTTTTGGG + Intergenic
999452418 5:151688234-151688256 CCGCACCCAGCTTAGCTTTGTGG + Intergenic
1001474624 5:172041590-172041612 CGGTGCCTGGCTTTTTTTTGTGG - Intergenic
1002024473 5:176387744-176387766 CCATACCCGGCTGATTTTTGTGG - Intronic
1003542936 6:7033868-7033890 CCACACCCAGCTAATTTTTGTGG - Intergenic
1004206446 6:13595834-13595856 CCACACCCAGCTAATTTTTGTGG - Intronic
1004656347 6:17665838-17665860 CCACACCCGGCTAATTTTTTTGG + Intronic
1005914980 6:30344014-30344036 CCACACCCGGCTAATTTTAGTGG + Intronic
1006970686 6:38041989-38042011 CCACACACGGCTTTTTTTTGGGG + Intronic
1007540033 6:42633679-42633701 CCGCACCTGGCCAGTTTTTGGGG + Intronic
1009716211 6:67399796-67399818 CAGCATCCGGCTTTATTTTATGG - Intergenic
1010969828 6:82251531-82251553 CCTCACCCTGCTTTCTTTTGGGG - Intergenic
1012871619 6:104679622-104679644 CTGCACCTGGCTAATTTTTGTGG - Intergenic
1013522776 6:110947983-110948005 CCACACCCAGCTATTTTTAGTGG - Intergenic
1013618525 6:111867297-111867319 CCACACCCGGCTAATTATTGGGG - Intronic
1015581353 6:134729018-134729040 CTGCACCGGGCCTTTTTTTCTGG - Intergenic
1015586545 6:134782434-134782456 CCACACCCGGCTAATTTTTTTGG - Intergenic
1016626354 6:146173944-146173966 CCGCACCTGGCTCTTCCTTGAGG + Intronic
1017025880 6:150180044-150180066 CCACTCCCGGCTAATTTTTGTGG - Intronic
1017176384 6:151508555-151508577 CCACTCCCGGCTAATTTTTGGGG - Intronic
1018403023 6:163445058-163445080 CCACACCTGGCTAATTTTTGTGG + Intronic
1019991646 7:4695958-4695980 CCACACCCAGCTAATTTTTGTGG - Intronic
1020545345 7:9522117-9522139 CCATACCTGGCTGTTTTTTGTGG - Intergenic
1021443685 7:20709917-20709939 CCACACCCAGCTAATTTTTGTGG - Intronic
1021593485 7:22290453-22290475 CCGCGCCCGGCCTTTCATTGTGG - Intronic
1022156176 7:27663687-27663709 CCACACCCGGCTAATTTTTTTGG + Intergenic
1022267942 7:28776180-28776202 CCACACCCGGCTAATTTTTTTGG - Intronic
1023137287 7:37065179-37065201 CCCCACCCTTTTTTTTTTTGAGG + Intronic
1023213584 7:37834400-37834422 CCACACCAGGCTATTTTTTGTGG + Intronic
1023678728 7:42660394-42660416 TCCCACCAGGCTTTTTTTGGGGG + Intergenic
1023940790 7:44767373-44767395 CCGCACCCGGCCTGTGTGTGAGG + Intronic
1024259783 7:47565363-47565385 CCGCGCCCGGCCTTTTTTTTTGG + Intronic
1024311107 7:47969941-47969963 CCGCGCCCGGCTGGTTTTTCTGG - Intronic
1025817335 7:64927243-64927265 CCACACCCGGCTAATTTTTGTGG + Intronic
1025817536 7:64930017-64930039 CCACACCTGGCTAATTTTTGTGG + Intronic
1026518063 7:71089882-71089904 CCACACCCGGCTAATTTTTGTGG - Intergenic
1026803197 7:73412783-73412805 CTGCACCCGGCCTTTATTTAAGG + Intergenic
1026860395 7:73783420-73783442 CCACACCTGGCTTTTTTTCTAGG + Intergenic
1026971519 7:74471351-74471373 CCACACCCGGCTAATTTTTTTGG - Intronic
1027125967 7:75556936-75556958 CCACACCCTGCACTTTTTTGGGG - Intronic
1027148683 7:75716807-75716829 CCACGCCCAGCTTTTTTTTAGGG + Intronic
1027784174 7:82558222-82558244 CCACACCCGGCTAATTTTTTTGG + Intergenic
1028390101 7:90306096-90306118 CCATACCCAGCTTTTTATTGGGG + Intronic
1028548907 7:92034654-92034676 CCACACCCAGCTAATTTTTGTGG + Intronic
1029090484 7:98044286-98044308 CCACACCCGGCTAATTGTTGTGG - Intergenic
1029278465 7:99421597-99421619 CCACACCAGGCTAATTTTTGTGG - Intronic
1030050166 7:105530761-105530783 CTGCGCCCGGCCTTTTTTTCTGG - Intergenic
1030564617 7:111137978-111138000 CCACACCCAGCTAATTTTTGTGG + Intronic
1031881514 7:127203765-127203787 CCTCACCCCCCTTTTTTTTGAGG - Intronic
1032035160 7:128516165-128516187 CCACACCCAGCTAATTTTTGTGG - Intergenic
1032859209 7:135861673-135861695 CCTCACCAGGCTGTTTTTTTTGG - Intergenic
1035196932 7:157229605-157229627 CTGCACCCGGCCTGTTTTTGGGG + Intronic
1036953447 8:13162788-13162810 CCACACCGGGCTTTTTTGAGGGG - Intronic
1037276971 8:17191115-17191137 CCACGCCCGGCTATTTTTTGTGG + Intronic
1039172531 8:34764275-34764297 CCACCCCCGCTTTTTTTTTGTGG - Intergenic
1039590868 8:38745832-38745854 CCGCACCCAGCCTTGTTTTCTGG + Intronic
1039852805 8:41384999-41385021 CCTCACCTGGCTAATTTTTGTGG + Intergenic
1041241184 8:55850339-55850361 CCACACCCGGCTAATTTTTTTGG - Intergenic
1042139617 8:65664750-65664772 CCATACCCGGCTATTTTTTGTGG + Intronic
1043364159 8:79512274-79512296 CCTCCCCCTCCTTTTTTTTGGGG - Intergenic
1044021997 8:87116355-87116377 CCACACCTGGCTAATTTTTGTGG + Intronic
1045764546 8:105651310-105651332 CCACACCCGGCTAATTTTTGTGG - Intronic
1047007441 8:120635005-120635027 CCGCACCCAGCTAATTTTTTTGG + Intronic
1047512237 8:125524353-125524375 CCGCACCCGGCTTTCCCTAGAGG - Intergenic
1048338546 8:133521287-133521309 CCACACCCAGCTAATTTTTGGGG + Intronic
1049588682 8:143444262-143444284 CCGCACCTGGCCTTTACTTGTGG + Intronic
1050319788 9:4439832-4439854 CCACACCAGGCTAATTTTTGTGG + Intergenic
1053127541 9:35594986-35595008 CCACACCCAGCTAATTTTTGGGG + Intergenic
1055303785 9:74907979-74908001 CCACACCCGGCTAATTTTTTTGG - Intergenic
1057102410 9:92375446-92375468 CCACGCCCGGCTAATTTTTGTGG + Intronic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1059446258 9:114339941-114339963 CCACACCCGGCTAATTTTTTTGG - Intronic
1059914701 9:119085972-119085994 CCACACCCAGCTAATTTTTGTGG - Intergenic
1060089772 9:120732616-120732638 CCGCACCCGGCCTTGCTTTCAGG + Intergenic
1060697552 9:125722323-125722345 CCACGCCCGGCTAATTTTTGTGG + Intergenic
1061131590 9:128711586-128711608 CCACGCCCGGCCTTTTTTTTGGG + Intronic
1061690256 9:132321690-132321712 CCACACCCGGCTAATTTTTGTGG - Intronic
1061886807 9:133595299-133595321 GCACACCCGGCTAATTTTTGTGG + Intergenic
1062330212 9:136038382-136038404 CCACACCCAGCTAATTTTTGTGG - Intronic
1203687751 Un_GL000214v1:11256-11278 CCATACCCGGCTAATTTTTGTGG + Intergenic
1203699250 Un_GL000214v1:122470-122492 CCACATCCTGCGTTTTTTTGGGG - Intergenic
1203754868 Un_GL000218v1:116502-116524 CCATACCCGGCTAATTTTTGTGG - Intergenic
1203648524 Un_KI270751v1:92797-92819 CCATACCCGGCTAATTTTTGTGG - Intergenic
1185598284 X:1321837-1321859 CCGCACCCGGCTGATACTTGGGG - Intergenic
1185840645 X:3386947-3386969 CCACACCAGGCTAATTTTTGGGG + Intergenic
1186211275 X:7252993-7253015 CCACACCCAGCTAATTTTTGTGG - Intronic
1186937505 X:14466579-14466601 CCTCACAGGGATTTTTTTTGTGG + Intergenic
1188220388 X:27534053-27534075 CCACACCTGGCTAATTTTTGTGG - Intergenic
1189932803 X:46033069-46033091 CCGCGCCCGGCCTTGTTTCGAGG - Intergenic
1190315750 X:49149658-49149680 CCGCGCCCAGCCTTTTTTTTTGG - Intergenic
1192783716 X:74318442-74318464 CCCCACCCAGCTAATTTTTGTGG - Intergenic
1197223836 X:123937332-123937354 CCACACCCGGCTAATTTTTTTGG + Intergenic
1198212072 X:134525635-134525657 CCACACCCAGCTAATTTTTGTGG - Intergenic
1198261773 X:134971132-134971154 CCACACCCAGCTTTTTTTTGGGG - Intergenic
1199926282 X:152468149-152468171 CCGTGCCCGGCTCATTTTTGTGG - Intergenic
1201983280 Y:19930904-19930926 CCACACCCGGATGATTTTTGTGG + Intergenic