ID: 1103791580

View in Genome Browser
Species Human (GRCh38)
Location 12:123475875-123475897
Sequence TTTTAAGTGAATTTAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 374}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103791580_1103791582 29 Left 1103791580 12:123475875-123475897 CCTGCCTCTAAATTCACTTAAAA 0: 1
1: 0
2: 1
3: 35
4: 374
Right 1103791582 12:123475927-123475949 AGAGTCTCACTGTCTCGTCCAGG 0: 1
1: 13
2: 721
3: 10990
4: 61394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103791580 Original CRISPR TTTTAAGTGAATTTAGAGGC AGG (reversed) Intronic
901029201 1:6296870-6296892 TTTTAAGTGAAATAAGAGTCAGG - Intronic
903089378 1:20897502-20897524 TTTTAGATGAAATTATAGGCAGG - Intronic
904191812 1:28750794-28750816 TATTAAAGAAATTTAGAGGCTGG + Intronic
904640662 1:31925456-31925478 AATAAAGTGAATTTAGAGGCCGG + Intronic
905697460 1:39985828-39985850 TTATAATGGTATTTAGAGGCAGG - Intergenic
906336429 1:44935795-44935817 TTTTAAAAGAATTTACAGGCTGG - Intronic
907826965 1:58027237-58027259 TTTTAAATGTATATAGAGACAGG + Intronic
908327645 1:63039017-63039039 TTTTAATTTATTTTAGAGACAGG - Intergenic
908857155 1:68443534-68443556 ATTTCAGTGAATTTAGAGAAAGG - Intronic
909247795 1:73310713-73310735 ATTTAAATGTATTTTGAGGCTGG - Intergenic
909554146 1:76934058-76934080 TTTTAACTACATTTAGAGTCTGG + Intronic
909886840 1:80951791-80951813 TTTTAAATGAATTATGTGGCTGG - Intergenic
911730719 1:101289761-101289783 TTTTAAATGTTTTTAGAGACAGG + Intergenic
911965770 1:104368802-104368824 TTTTATATGATTTTGGAGGCAGG - Intergenic
912225644 1:107731104-107731126 TGTTAAGAGTATTTAGAGTCTGG - Intronic
912321011 1:108713300-108713322 TCTAAATAGAATTTAGAGGCTGG - Intronic
912764115 1:112393543-112393565 TTGTAAATAAATTTAGAGTCTGG - Intergenic
912991728 1:114494131-114494153 TTTTAATTTTATTTAGAGACAGG + Intronic
913005272 1:114624305-114624327 TTTTATGTTATTTTAGAGGCAGG + Intronic
914213921 1:145607502-145607524 TTTGAAGAGATTTTACAGGCCGG - Intergenic
914465866 1:147927905-147927927 TTTGAAGAGATTTTACAGGCCGG - Intergenic
915043025 1:152984259-152984281 TTTTAAGTTAAATTACAGTCTGG + Intergenic
916326025 1:163561019-163561041 TTTTGAGTGAATTGAGCAGCAGG + Intergenic
916729061 1:167550282-167550304 TTTAAAATGCATATAGAGGCGGG - Intronic
919095787 1:193034104-193034126 GTTTAAGTCAATTTACAGGAAGG + Intronic
919162332 1:193846943-193846965 TTTAAAGTGAATTTACATTCTGG + Intergenic
919512530 1:198483656-198483678 TTTTAAATGAAATAAGAGGTAGG - Intergenic
920224812 1:204430637-204430659 TTTTAAATGAATTTTTTGGCCGG - Intronic
920338001 1:205257819-205257841 TTTTTAGGGAATTCAGAGGATGG + Intronic
920549125 1:206843710-206843732 TTTTAAATGATTATAGAGGCAGG - Intergenic
920735222 1:208527412-208527434 TTTTAAGTGAATTTTGTGCTTGG + Intergenic
921872397 1:220155019-220155041 TTTTAAAAGGATTCAGAGGCTGG - Intronic
922944406 1:229499427-229499449 TTTAAAGAGACTATAGAGGCCGG - Intronic
923398621 1:233592227-233592249 TTTTGAGAGAATTTTGTGGCAGG + Intergenic
923762726 1:236861846-236861868 TTTTAAGTGAGTTTTAAAGCTGG + Intronic
1063051542 10:2454645-2454667 TTTAAATTGAATATATAGGCAGG - Intergenic
1063740733 10:8816245-8816267 TTTTAACTGAATTAACAGTCTGG - Intergenic
1063950589 10:11219138-11219160 TTTTAAGTGAATGCAGAGCTTGG + Intronic
1064366534 10:14713579-14713601 TGTTAAGTGAATTGAGAGGAAGG + Intronic
1065553805 10:26894268-26894290 TATTAAGGGAACTCAGAGGCTGG + Intergenic
1065984189 10:30933198-30933220 TTTGAACAGAATTTAGAGGAAGG - Intronic
1066927323 10:41713984-41714006 TTCTAAGGGAACTCAGAGGCTGG + Intergenic
1068027451 10:51664746-51664768 TTTTAAGTAATTGTAGAGTCAGG - Intronic
1068519128 10:58060089-58060111 TTTTAGGTGAATTTAAAGGAAGG - Intergenic
1069169661 10:65210441-65210463 TTTTAAGAAAGTTTACAGGCTGG + Intergenic
1069650045 10:70040230-70040252 TTTTAAGTGTTTTTGGAGACAGG - Intergenic
1069707012 10:70465268-70465290 TTAAAAGTGTATGTAGAGGCCGG - Intergenic
1070497065 10:77034277-77034299 TTTTAAGTGAATTTATGGAGAGG - Intronic
1070908432 10:80095639-80095661 TTTTAAGTGAATTTCTGGCCAGG - Intergenic
1071449959 10:85784723-85784745 TTTTGAATGGATCTAGAGGCTGG + Intronic
1072166664 10:92820121-92820143 TTTTAAGGGAATGTTGTGGCTGG + Intergenic
1072335376 10:94393667-94393689 TTTTAAATGAAATTTGTGGCTGG + Intergenic
1073313084 10:102558206-102558228 TTTTAATTGATTTTTGAGACAGG + Intronic
1074461231 10:113638828-113638850 TATTAATTGAGTTTAGAGGTGGG - Intronic
1074624013 10:115158250-115158272 TTTTCAGTTAAATTAGAGGTTGG + Intronic
1074989966 10:118696345-118696367 TTTTAAGAAAATTTACAGGCTGG + Intronic
1075708126 10:124514805-124514827 TTTTAATCTAATTTAGAGACAGG + Intronic
1078236524 11:9490176-9490198 TTTTTATTTAATTTAGAGACAGG - Intronic
1078874098 11:15376575-15376597 ATTTAATTCAATTTAGTGGCAGG - Intergenic
1080521063 11:33068217-33068239 TTTTAAAAGAATAAAGAGGCCGG - Intronic
1080905149 11:36537052-36537074 TTTAAAGTGAATATATTGGCCGG - Intronic
1081444200 11:43114267-43114289 TTTTTACTGAAGTTAGAGGAGGG + Intergenic
1084740905 11:71138967-71138989 TTTTGAGTGACTGTACAGGCGGG + Intronic
1086102191 11:83112611-83112633 TTTTATTTTATTTTAGAGGCAGG - Intergenic
1088632735 11:111789534-111789556 TTTTAAGTTATTTTATAGGCTGG - Intronic
1091078569 11:132644078-132644100 TTTTAAATGAATTTATAGGTTGG - Intronic
1092530485 12:9340277-9340299 TTTTAAGGGAATTTAAAAGTAGG - Intergenic
1092547243 12:9462690-9462712 TTTTAAGGGAAATTAGGAGCAGG + Intergenic
1092647325 12:10590159-10590181 TTTTAAATTGTTTTAGAGGCAGG - Intergenic
1092895907 12:13010129-13010151 TTTTAAAAAAATTTACAGGCAGG - Intergenic
1093998610 12:25670230-25670252 TTTTAAGTGATTTTAAGGGCCGG + Intergenic
1094436921 12:30430855-30430877 TTTTAAGAGACTTGACAGGCCGG - Intergenic
1094437850 12:30441204-30441226 TTTAAAATGCATTTTGAGGCTGG - Intergenic
1094505695 12:31059374-31059396 TTTTAAGGGAAATTAGGAGCAGG - Intergenic
1095434480 12:42172010-42172032 TTTGAAATGTAGTTAGAGGCTGG - Intronic
1096859217 12:54511410-54511432 TTTTAAAAAAATTTAGAGACAGG + Intronic
1100518219 12:95348758-95348780 TTATTAGTGAATTTAGATGCAGG + Intergenic
1101911678 12:108864795-108864817 ATTTAAATGAATTAATAGGCCGG + Intronic
1102714459 12:114958073-114958095 TTTTAAATGTTTTTAGAGACAGG + Intergenic
1102860269 12:116330213-116330235 TTTTAAGTGCATTCATAGCCAGG - Intergenic
1103056761 12:117827353-117827375 AGATAAGTGATTTTAGAGGCAGG - Intronic
1103525336 12:121563944-121563966 TTTTAAATGTTTGTAGAGGCAGG - Intronic
1103688379 12:122751012-122751034 TACTAAGGGAACTTAGAGGCCGG - Intergenic
1103791580 12:123475875-123475897 TTTTAAGTGAATTTAGAGGCAGG - Intronic
1104779884 12:131413304-131413326 TTCTGAGTGATTTAAGAGGCGGG + Intergenic
1105714014 13:23043411-23043433 TTTAAAGGAAATTTATAGGCGGG + Intergenic
1109094872 13:58101070-58101092 TTTAAACTGTATTTATAGGCAGG + Intergenic
1109151164 13:58848758-58848780 TTATAAGTAAATCTATAGGCAGG - Intergenic
1110100418 13:71594510-71594532 TTTTAATTGAATTTTATGGCTGG - Intronic
1114701585 14:24683980-24684002 TTTTAAATGACTTTAGAGATGGG - Intergenic
1114883740 14:26821012-26821034 TTTTAACTGTATTTAGAGATGGG - Intergenic
1116091694 14:40315919-40315941 TTTTAAGGGAATGTTGTGGCTGG - Intergenic
1116235946 14:42279586-42279608 GTTTAAGAGTATTTATAGGCCGG - Intergenic
1116344805 14:43778967-43778989 TTTTAATTGATTTTAGTTGCTGG + Intergenic
1116500115 14:45610727-45610749 TTTTATGTGATTTTAGTGGTAGG - Intergenic
1118518395 14:66552450-66552472 TTTTAAGTGAATTATGAGAAAGG + Intronic
1119504776 14:75163061-75163083 TTTTAATTATTTTTAGAGGCAGG - Intronic
1120624354 14:86805973-86805995 TTTGAAGTGATTTTAGGAGCAGG - Intergenic
1121233951 14:92379054-92379076 TATTTATTGATTTTAGAGGCAGG - Intronic
1121978834 14:98434179-98434201 TTCTTAGTGAATCGAGAGGCAGG + Intergenic
1122432103 14:101658506-101658528 TTTAAAGTGCATTTTGAGCCAGG + Intergenic
1123802777 15:23838884-23838906 TTTTAAATGACTTTTTAGGCTGG + Intergenic
1125057647 15:35381320-35381342 TTTTAAATGAATTTAGTTGATGG - Intronic
1125495593 15:40190307-40190329 TTTTTAGTGAAAGTTGAGGCTGG + Intronic
1126861996 15:52894075-52894097 TTTTAAGTCAATATGGAGCCTGG + Intergenic
1127922084 15:63502456-63502478 TTTTAAGTGTTTTTAAAAGCCGG + Intergenic
1128259978 15:66226542-66226564 TATTAAGTAAATTAAGGGGCTGG - Intronic
1128285182 15:66430535-66430557 TGGTCACTGAATTTAGAGGCTGG - Intronic
1129466867 15:75728954-75728976 TTTAAAGTGAAAATTGAGGCTGG + Intergenic
1129720367 15:77874799-77874821 TTTAAAGTGAAAATTGAGGCTGG - Intergenic
1131203418 15:90420854-90420876 TTTTAAATGTCTTTATAGGCCGG + Intronic
1131824475 15:96307227-96307249 TTTTAATTTTATGTAGAGGCAGG + Intergenic
1131878893 15:96841443-96841465 TCTTAAGAGAATTTTGTGGCTGG - Intergenic
1133974948 16:10594063-10594085 TTTTAAAAGAATTTGGAGGCCGG - Intergenic
1134397975 16:13882754-13882776 TTTTAAGTAAATAAACAGGCCGG + Intergenic
1134794017 16:17018012-17018034 TTTTAAAAGAATTTCCAGGCTGG - Intergenic
1134809288 16:17153574-17153596 TTTAAAGTTAGCTTAGAGGCCGG - Intronic
1135112498 16:19701548-19701570 TTTTAAATCAATTTATTGGCCGG + Intronic
1135559533 16:23465295-23465317 TGTTAAGTGAATGAAGAGGTAGG + Exonic
1135923058 16:26668450-26668472 TTTAAAATGCATTTTGAGGCTGG + Intergenic
1135989275 16:27207754-27207776 TTTTAATTGTTTTTAGAGACAGG + Intronic
1137522635 16:49208130-49208152 CTTTTAGGGAGTTTAGAGGCTGG + Intergenic
1138570887 16:57872173-57872195 TTTCAAGTAAATTTAGATTCAGG + Intergenic
1139715172 16:68807496-68807518 TTTTAAATTTTTTTAGAGGCAGG - Intronic
1139899199 16:70313738-70313760 ATTTAAGTGAATTTTGAGAAAGG - Intronic
1140383239 16:74509981-74510003 TTTTAAGGGAATCAAGAGGCTGG - Intronic
1141124511 16:81391581-81391603 TTTTAATTTAATTTTGAGACAGG + Intergenic
1141580831 16:84997565-84997587 GTTTAAGAATATTTAGAGGCCGG - Intronic
1141600293 16:85121824-85121846 TTTTAAAACAATTTAGGGGCTGG + Intergenic
1143137297 17:4719068-4719090 TTTTAAGTGAAGATGGTGGCCGG - Intronic
1146032886 17:29381420-29381442 TTTTAATTTATTTTAGAGACAGG - Intergenic
1146666698 17:34709948-34709970 TTTTAATTTCCTTTAGAGGCTGG - Intergenic
1146945666 17:36871663-36871685 ATCTAAGTGAATTTAGATACAGG - Intergenic
1147603440 17:41759915-41759937 TTTTAATTCAATGTATAGGCCGG + Intronic
1147712740 17:42481515-42481537 TTTAAAATGAATTTAGGGCCAGG - Intronic
1147789128 17:43002207-43002229 TTAAAAGTGAATTTTCAGGCCGG + Intronic
1148092124 17:45028999-45029021 TTTTAAAGGATCTTAGAGGCCGG - Intronic
1148234993 17:45962752-45962774 TTTTAAATTATTTTAGAGACGGG - Intronic
1148715507 17:49712880-49712902 TTTTAATTGTTTTTAGAGACAGG + Intronic
1151113786 17:71709765-71709787 TATGAAGTGAATTCAGAGTCAGG + Intergenic
1151126831 17:71854371-71854393 TTTTAACAGTATTGAGAGGCGGG - Intergenic
1151199446 17:72456895-72456917 TTAAAAGAGAATTGAGAGGCAGG - Intergenic
1151732343 17:75918915-75918937 TTTTAAATGTTTTTAGAGACAGG + Intronic
1151793187 17:76323025-76323047 TTTTATTTTATTTTAGAGGCGGG - Intronic
1152766896 17:82146374-82146396 TTTTAAATGTTTTTAGAGACTGG + Intronic
1153196231 18:2600312-2600334 CTTTAAGAGATTTGAGAGGCCGG + Intronic
1153589676 18:6659861-6659883 TTTTAAAAGATTTTAGAGGCCGG - Intergenic
1153809573 18:8740144-8740166 TGCTGAGTGAATTTGGAGGCAGG + Intronic
1154955312 18:21248346-21248368 TTTTATGTGAATTTAAATGTTGG + Intronic
1155626248 18:27838267-27838289 TTTTGTTTGAATTTAGAGGAGGG + Intergenic
1156567919 18:38217279-38217301 ATTTAATTTAATTTAGAGACAGG - Intergenic
1157371814 18:47120472-47120494 TCTTAAGGGAATTTTGTGGCTGG + Intronic
1157533331 18:48440541-48440563 TTTTAAGGGAAAGTAGAGGGAGG + Intergenic
1158907821 18:62030971-62030993 ATTTAATTTAATTTAGAGACAGG - Intergenic
1158917515 18:62150396-62150418 TATTAAGGGAATATAGAGGAGGG + Intronic
1159069200 18:63604720-63604742 TTTTAAGGGAATTTAAAAGGTGG + Intergenic
1162618798 19:11823665-11823687 TTTTAATAGAAATTAGTGGCTGG + Intronic
1162627524 19:11897050-11897072 TTTTAATAGAAATTAGTGGCTGG + Intronic
1163109500 19:15150816-15150838 TTAGAAGTGAGTTTAGAGACAGG + Intergenic
1163211518 19:15844359-15844381 TTTTTTTTTAATTTAGAGGCTGG - Intergenic
1164239441 19:23371042-23371064 TTGAAAGTGAACTAAGAGGCTGG + Intronic
1165259806 19:34603148-34603170 ATCTAAGTTAATTTAGAGTCAGG - Intronic
1165437612 19:35804928-35804950 TTTTAAGTTATTTTTGAGACAGG - Intronic
1165611140 19:37154308-37154330 TTGTAAGTGAATTAAGAGTTTGG - Intronic
1165913306 19:39243110-39243132 TTTAAAATTAATTTAGAGCCTGG - Intergenic
1165917814 19:39271630-39271652 TTTAAAATTAATTTAGAGCCTGG + Intergenic
1167252614 19:48408491-48408513 TTTTAAATTATTTTAGAGACAGG - Intronic
1167746083 19:51352582-51352604 TTTTGGGTGAGTTTAGAGGCTGG - Intronic
1168011899 19:53539628-53539650 TTGTAAGTGGAGTTAAAGGCAGG - Intronic
1168025295 19:53639427-53639449 TTTTAATTAATTGTAGAGGCTGG - Intergenic
925235203 2:2271931-2271953 ATTCAAATAAATTTAGAGGCTGG + Intronic
927564750 2:24102439-24102461 TTTTAAATGTATTTTCAGGCTGG + Intronic
928595187 2:32853333-32853355 GTTTAAGGAAATTTTGAGGCTGG + Intergenic
928958959 2:36902933-36902955 TTCTCAGTGACTGTAGAGGCTGG - Intronic
929658281 2:43756047-43756069 TATTAAGGGAATGTTGAGGCTGG - Intronic
929672881 2:43891995-43892017 TTTTAAGGGAATGTTGTGGCTGG - Intronic
931392097 2:61853222-61853244 TTTTAAGTGAATTGAGCAGATGG + Intronic
932413508 2:71560595-71560617 TTTTAATTGAATTTTTAGGATGG - Intronic
932458070 2:71862310-71862332 TATTAAATGAATTTAGAGTGAGG - Intergenic
932686624 2:73876139-73876161 TTTTAAATGAAAGTAGGGGCTGG - Intergenic
932690256 2:73907136-73907158 TTTTAAGTGAAAGAAGAGGTAGG - Intronic
932692310 2:73923346-73923368 TTTTGAATGTTTTTAGAGGCTGG + Intergenic
933801469 2:85963601-85963623 TTATAAATCAAATTAGAGGCGGG - Intergenic
934587353 2:95513708-95513730 TTATAGGTGAGTTTGGAGGCAGG + Intergenic
935166399 2:100572817-100572839 TTTTAATTTAATTTAAAAGCTGG - Intronic
936140262 2:109933733-109933755 TTTTAAGTCTCTTTTGAGGCTGG + Intergenic
936176952 2:110231678-110231700 TTTTAAGTCTCTTTTGAGGCTGG + Intergenic
936204433 2:110437753-110437775 TTTTAAGTCTCTTTTGAGGCTGG - Intronic
937536800 2:122898868-122898890 TTTTAAGTAAATGGAGAGGAAGG - Intergenic
938174775 2:129115622-129115644 TTTTAAAGAAATTTTGAGGCTGG + Intergenic
938903847 2:135820506-135820528 TTTGAAGTGGATTGAGAGGATGG + Intronic
938943245 2:136187775-136187797 TGGTGTGTGAATTTAGAGGCTGG + Intergenic
939786924 2:146526180-146526202 TTTTAAGGGAATGTTGAGACCGG - Intergenic
939950365 2:148464784-148464806 TTTTAAATTATTTTAGAGACAGG - Intronic
940510348 2:154606173-154606195 TTTTAAGTGAATTATGTGGGAGG + Intergenic
941126151 2:161585920-161585942 TTTTAATTTATTTTAGAGTCAGG + Intronic
941505065 2:166332725-166332747 TTTAAAGTGAATTTTAAGGACGG - Intronic
941516010 2:166479720-166479742 TTGTAAATGAATCCAGAGGCTGG - Intronic
942668003 2:178342708-178342730 TTTTAAATGAAGTAAGAGGAAGG + Intronic
943180653 2:184536484-184536506 TTTTTAAAGAATTTTGAGGCAGG + Intergenic
944067868 2:195638287-195638309 TTTAAAGTTATTTTTGAGGCTGG - Intronic
944575020 2:201083007-201083029 TAAAAAGTGAATTTAGCGGCCGG - Intronic
944720970 2:202422972-202422994 TTTTAAAAGAATATACAGGCCGG - Intronic
945120245 2:206449976-206449998 GTTTAAGTGAATTTAGATCTTGG + Intronic
945898383 2:215510844-215510866 TTTTAAATGAATACAGAGGCTGG - Intergenic
946045176 2:216814947-216814969 TTTTAAGAGCATTTAGAGCTGGG - Intergenic
948955075 2:241283150-241283172 GTTTAAGGGAATTTTGAGACTGG - Intronic
1169119582 20:3086975-3086997 TTTAAAATGTATTTATAGGCCGG - Intergenic
1169435722 20:5587660-5587682 TTTTAAGAGTATGTATAGGCTGG - Intronic
1169546535 20:6656400-6656422 TGCAAAGTGACTTTAGAGGCAGG + Intergenic
1171016293 20:21544880-21544902 TTTTAAGTTAATTTGGTGGGGGG - Intergenic
1171963128 20:31509662-31509684 TTTGAATTGAATTTAGAAGATGG - Intergenic
1172328154 20:34053566-34053588 TTTTAATTGTTTTTAGAGACAGG + Intronic
1173659274 20:44722138-44722160 TTTAAACTGAATTTAGAGGCCGG + Intronic
1174243407 20:49157171-49157193 TTGGAAGAGAATTTTGAGGCTGG - Intronic
1174318583 20:49722239-49722261 TTTTTAATTATTTTAGAGGCAGG - Intergenic
1175406292 20:58732392-58732414 TTTTAAATTTATTGAGAGGCTGG - Intergenic
1176888100 21:14281092-14281114 TACTAAGGGAATTCAGAGGCTGG - Intergenic
1177318460 21:19491654-19491676 TTTAAAATGCATTTTGAGGCAGG - Intergenic
1177472324 21:21575029-21575051 TATTAAGTGGATTTTGAAGCAGG - Intergenic
1177646705 21:23907798-23907820 ATTAAAGTCAATTTACAGGCCGG - Intergenic
1177827905 21:26104356-26104378 TTTTAAATGCATTGAAAGGCAGG + Intronic
1178866130 21:36328994-36329016 TTTTAAGAAAGTTTACAGGCCGG + Intronic
1179171460 21:38976180-38976202 GTTTTAGGGAATTTAGAGTCAGG + Intergenic
1179814188 21:43893358-43893380 GTTTAAGGGAATATTGAGGCTGG + Intronic
1181498925 22:23304767-23304789 TTTGAAGTGATGTTAGAGACTGG + Intronic
1183610537 22:38900956-38900978 TTTAAAATGCATTTCGAGGCTGG - Intergenic
1184431897 22:44445872-44445894 TTTGCTCTGAATTTAGAGGCAGG - Intergenic
949656121 3:6222122-6222144 TTTTAAGTAAAACTTGAGGCAGG + Intergenic
950225800 3:11233611-11233633 TTCTAAGTGAAGGGAGAGGCTGG - Intronic
950608918 3:14112257-14112279 TTCTAAGTGAAGGGAGAGGCTGG - Exonic
951273136 3:20652282-20652304 TTATAAGAGAATATTGAGGCTGG + Intergenic
952169166 3:30786816-30786838 TTTTAAGTGAACTTACAAGCAGG - Intronic
953330038 3:42045131-42045153 TTTTAACTGTATTTAGAAGCTGG + Intronic
954337947 3:49930699-49930721 ATTTAATTGAATTTAGAGTAGGG + Intergenic
955954662 3:64276523-64276545 TTTTAATTTATTTTAGAGACAGG + Intronic
956293280 3:67684402-67684424 TTTTATTTTAATTTAGAGGGGGG - Intergenic
956411329 3:68982854-68982876 TTTTCAGTGCATTTACAAGCTGG + Exonic
957424490 3:80020505-80020527 TTTTAAGAAAATGAAGAGGCAGG - Intergenic
957815195 3:85289320-85289342 TTTTAAGTGAGGTTAGAGACAGG + Intronic
960636369 3:119788732-119788754 TTTAAAGTCAATATACAGGCCGG - Intronic
960979285 3:123206789-123206811 CTTTAAATGAATGGAGAGGCTGG + Intronic
961031636 3:123609977-123609999 TTTTAAGACATTTTAAAGGCTGG - Intergenic
961248126 3:125474759-125474781 TTTTAATTAATTTGAGAGGCAGG - Intronic
963305057 3:143642122-143642144 TTTTAGTTGAATTTAGAACCTGG + Intronic
963683919 3:148414087-148414109 TTTTAAATGCATATAGTGGCAGG + Intergenic
964175152 3:153819097-153819119 TTTAAAGTGAATTAAGAGACTGG + Intergenic
966089431 3:176114677-176114699 TTTTAAGTCAATTTAGACTATGG - Intergenic
966810506 3:183839713-183839735 TTTTAAGTGTGTTTTGAGGCTGG - Intronic
966902328 3:184495629-184495651 TTTAAAGTGAAGTTATTGGCCGG + Intronic
968168544 3:196489229-196489251 TTTTAATGGAGTTTAGAGGAAGG - Intronic
968216444 3:196895525-196895547 TTTTCAGTTATTTTTGAGGCAGG + Intronic
968778708 4:2562441-2562463 TTTTAAATGATCTTAAAGGCAGG - Intronic
970187270 4:13470749-13470771 TTTTAAGTTAATTTAAAATCTGG + Intronic
970723338 4:19013857-19013879 TTTTGAATGAATTTTGAGTCAGG + Intergenic
971541415 4:27821552-27821574 TTTTAAATGAATTTTAAGACAGG - Intergenic
972512657 4:39784335-39784357 TTTTAATTTTATTTGGAGGCAGG - Intergenic
972579769 4:40384998-40385020 TTTTAAATTTTTTTAGAGGCCGG - Intergenic
974366454 4:60955821-60955843 CTGTAAGTGAATTCAGAGGTAGG + Intergenic
975388450 4:73787191-73787213 TTTTAAGTTAATTTTGTGGTTGG + Intergenic
975548647 4:75587611-75587633 TTTTAAAGAAATTGAGAGGCCGG + Intronic
977024685 4:91802472-91802494 GTTTAAGGGAATGTAGTGGCTGG - Intergenic
977823615 4:101504274-101504296 TTTTAAAATATTTTAGAGGCTGG + Intronic
980495288 4:133582131-133582153 ACTGAAGTGAATTTAGTGGCTGG + Intergenic
980755459 4:137153601-137153623 CTTCAAGTGAGTTTAGAAGCGGG - Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981882887 4:149636845-149636867 TAGAAAGTGAATTTAGCGGCCGG + Intergenic
982005617 4:151060169-151060191 TTTAAAGATAATTTAAAGGCTGG - Intergenic
983567392 4:169167963-169167985 TTTTAATTTTATTTAGAGACAGG - Intronic
984013671 4:174401558-174401580 TAGTAAGGGAATTCAGAGGCCGG + Intergenic
984536998 4:180989166-180989188 TTTTAAGACTATTAAGAGGCTGG + Intergenic
985077575 4:186231709-186231731 CTGTAAGGGAAATTAGAGGCAGG - Intronic
985256162 4:188071979-188072001 TTTTAATTTATTTTAGAGACAGG - Intergenic
985311988 4:188612020-188612042 ATTTAAGTTGTTTTAGAGGCGGG - Intergenic
986579815 5:9253799-9253821 TTTAAAGGGAAAGTAGAGGCTGG - Intronic
986630023 5:9762812-9762834 TCCTAAGTAAGTTTAGAGGCAGG - Intergenic
987346228 5:16981304-16981326 TTTTCAGAGACTTGAGAGGCTGG + Intergenic
987542048 5:19268835-19268857 GTTCAAGTGATTTTAGAGGCTGG + Intergenic
987661378 5:20882606-20882628 GTTTACGTGATTATAGAGGCTGG + Intergenic
987828057 5:23059590-23059612 ATTTAATTAAATTTAGATGCAGG - Intergenic
988578527 5:32448725-32448747 TTTTTGGTGAGTTTAGGGGCTGG - Intergenic
988762207 5:34322719-34322741 GTTTACGTGATTATAGAGGCTGG - Intergenic
989760121 5:45005322-45005344 GTTTAAGGGAATATAGTGGCTGG - Intergenic
990562235 5:56994907-56994929 TTTTAAGTGTATACAGTGGCAGG - Intergenic
990687944 5:58328727-58328749 TTTTTAGTGAATTTAGCTTCAGG - Intergenic
990961862 5:61402261-61402283 TTTTAAGTACATTTAGGGGAAGG + Intronic
991715280 5:69445967-69445989 TTTAAAGTGATTTTACAGCCAGG - Intergenic
992092804 5:73333649-73333671 TTTTAGTTGTATTTAGTGGCAGG + Intergenic
992136534 5:73751734-73751756 TTTTAACAGAATCTAGAGGCAGG + Intronic
992399247 5:76396552-76396574 TTTAAAGTCATTTTAAAGGCTGG - Intergenic
992566522 5:78000113-78000135 TTTTAAATTACTTTAGAGACAGG + Intergenic
993655362 5:90571794-90571816 TTTAAGGTGACTTTGGAGGCTGG + Intronic
994114924 5:96051041-96051063 TTTTAAGTTAATTTAGAATAGGG - Intergenic
994383717 5:99102803-99102825 TTTTAAGTGGATCTAGCGGTGGG + Intergenic
994703819 5:103174194-103174216 TTTTAGGTGATTTTATAGACTGG + Intronic
995210413 5:109531159-109531181 TTTTAAGATAATGTTGAGGCAGG + Intergenic
995945213 5:117636836-117636858 TTTTGGGTGAAGTTAAAGGCAGG + Intergenic
996092626 5:119365555-119365577 TCTTAACTGAATGAAGAGGCAGG - Intronic
996357423 5:122612290-122612312 TTTTAAGAAAGTTTACAGGCCGG + Intergenic
996722236 5:126641196-126641218 TCTTAAGGGAATTTTGTGGCTGG + Intergenic
997328842 5:133044551-133044573 TTAGAAGTGAATTGTGAGGCCGG + Intergenic
997392686 5:133530052-133530074 TTTTAGCTGAATTTGGAGGCAGG - Intronic
998841660 5:146260633-146260655 TTTTAAGTGCCTTTTGTGGCTGG - Intronic
999158863 5:149478387-149478409 ATAAAAGTGAATTTGGAGGCAGG - Intergenic
1000315302 5:160084918-160084940 TTTTAAGTGAATCTAAATGAGGG + Intronic
1002542423 5:179915024-179915046 TTTTAATTTTATTTAGAGACAGG - Intronic
1003934844 6:10964948-10964970 TTTGAAGTGAATTGGGAGGATGG + Intronic
1004877882 6:19973984-19974006 AATTAAGTGAATTTTGAGCCTGG - Intergenic
1005269346 6:24146684-24146706 TTTTAATTTTTTTTAGAGGCAGG + Exonic
1005410534 6:25540559-25540581 TTTTCAGTGAATCTATAGGCAGG - Intronic
1008669297 6:53750604-53750626 CTTTAAGTGAATTTGAAGGAAGG - Intergenic
1009479683 6:64141083-64141105 TTTTAAGTTCATTTAGAGGAAGG + Intronic
1010273718 6:73944703-73944725 TTTTAAGAGAATTTATAGTTTGG - Intergenic
1010906505 6:81497414-81497436 TTTTATTTGATTTTAGTGGCAGG + Intronic
1011750995 6:90454630-90454652 TTTTAAATGATTTGATAGGCTGG + Intergenic
1013216048 6:108028192-108028214 TTTAAAGTTAAATTAAAGGCCGG + Intergenic
1013789263 6:113817262-113817284 TTTAAAGTGTATTTTGGGGCTGG - Intergenic
1014226590 6:118855198-118855220 TATTAAGTGTCTTCAGAGGCTGG - Intronic
1014558734 6:122864524-122864546 TTTAAAGTAAAGTTACAGGCTGG - Intergenic
1015316701 6:131824762-131824784 TTTTAAGAGCAATTGGAGGCCGG + Intronic
1016199395 6:141389118-141389140 TTTTAAGGGAATGTTGTGGCTGG + Intergenic
1016385682 6:143528619-143528641 TTTTAAGTGACTTTAAAAGCAGG + Intergenic
1016519574 6:144931448-144931470 TTACATGTGAATTAAGAGGCAGG + Intergenic
1016802382 6:148179829-148179851 TTTGAAGTGAAGTTTGAGGTAGG + Intergenic
1016986139 6:149897344-149897366 TTTTAATTGAAGTAAGAAGCGGG + Intronic
1017274149 6:152546467-152546489 TTTTAAGTGACATCTGAGGCTGG + Intronic
1017288607 6:152708505-152708527 TTTTAAGAGATTTTAGAGACAGG - Intronic
1017443561 6:154486839-154486861 TTTTAAGTTAAAATAGAGACAGG + Intronic
1018013892 6:159694898-159694920 TTTTAAGGGTATCTATAGGCCGG - Intronic
1019293125 7:260057-260079 AATTCAGTGAATTCAGAGGCAGG + Exonic
1019339465 7:502051-502073 TTTAAATTGTTTTTAGAGGCAGG - Intronic
1019467738 7:1199459-1199481 TTTAAAGTGAAGTTAGGGGCTGG + Intergenic
1020403704 7:7806261-7806283 TTTCAAGGGATTTTAGAGGGGGG - Intronic
1023365836 7:39462371-39462393 ATTTAAGTGAATTCAAAGGGTGG + Intronic
1023421717 7:39987083-39987105 TTTTAAGAAAATTTACAGCCAGG - Intronic
1024387312 7:48767325-48767347 TTTTATTTAAACTTAGAGGCCGG - Intergenic
1027619316 7:80463779-80463801 TGTTAACTGAATAGAGAGGCAGG + Intronic
1027831951 7:83188435-83188457 TTTTAAGTGGATTAATAAGCAGG - Intergenic
1028764892 7:94543338-94543360 TTTAAAGTGATCTTTGAGGCTGG - Intronic
1029080876 7:97972842-97972864 TTTTAATTTAATTTAGAGACAGG + Intergenic
1029574412 7:101393750-101393772 TTTTAATTTATTTTAGAGACAGG + Intronic
1030136456 7:106256038-106256060 GTTAAAGTGAATTTTGAGTCTGG + Intronic
1030294864 7:107913199-107913221 TTTTTAGTAAATTTTGAAGCCGG + Intronic
1030968727 7:116026983-116027005 TTTTACCAGAATTTAAAGGCTGG + Intronic
1031093161 7:117387126-117387148 TTTTAAGTAGAGGTAGAGGCAGG - Intronic
1031093339 7:117389377-117389399 TTTAAAATGCATTTTGAGGCTGG - Intronic
1031795481 7:126168958-126168980 TACTAAGTGAACTCAGAGGCTGG + Intergenic
1032225296 7:130026657-130026679 GTTTAAGTAAATTTAGTGTCAGG - Intronic
1033081069 7:138297873-138297895 TTTTCCTTAAATTTAGAGGCTGG - Intergenic
1033719418 7:144042010-144042032 TTTCAAGTGAATTCAAAGGGAGG + Intergenic
1035147638 7:156835865-156835887 TTCTAAGTGAAATTAGAGGTTGG - Intronic
1035585368 8:768758-768780 TTTTAAGTGTTTTTTGATGCTGG - Intergenic
1035722521 8:1802692-1802714 TTTTAAGTAAAATGGGAGGCGGG - Intergenic
1035978086 8:4335536-4335558 TTTTAAGCTAATTTAGATGTTGG - Intronic
1036602183 8:10271565-10271587 TTTTAATTGAATTTACGGGCAGG - Intronic
1037400568 8:18491739-18491761 TTTTAGGTGCTTTTAGAAGCAGG + Intergenic
1037448377 8:18990923-18990945 TTTTAACTGTCTTTGGAGGCAGG - Intronic
1037523149 8:19699813-19699835 TTTTAAAAGAACTTAGGGGCTGG + Intronic
1037687811 8:21158582-21158604 TTTTAAGTCACCATAGAGGCTGG - Intergenic
1037690163 8:21175029-21175051 TTTTAATTAATTTTAGAGACAGG + Intergenic
1038831959 8:31071821-31071843 TATTAAATGTATTTTGAGGCTGG - Intronic
1039001216 8:32982178-32982200 TTTTGAATGAATTGAGAGACAGG + Intergenic
1040525031 8:48214639-48214661 TAATAAATGAATTCAGAGGCTGG + Intergenic
1041857650 8:62476749-62476771 TTTTAAATTACTATAGAGGCCGG - Intronic
1042679820 8:71370625-71370647 TACTTAGTTAATTTAGAGGCAGG + Intergenic
1042974417 8:74451151-74451173 CTTTAAGGAAATTAAGAGGCTGG + Intronic
1043552696 8:81392689-81392711 TTTAAAGGGAATTAAGAGCCGGG - Intergenic
1043933032 8:86112350-86112372 TTTTAAGTGACTTTGAAGTCAGG + Intronic
1043972656 8:86549488-86549510 ATATAAGTGAATTTAGGGGAGGG + Intronic
1044943138 8:97363854-97363876 TTTTAAGTAAATTTAGCCACAGG - Intergenic
1046066164 8:109199193-109199215 TTTTAAATGAATTTAAAGTATGG + Intergenic
1046237452 8:111444556-111444578 TTTTAAGTGAATTTAAATATTGG - Intergenic
1046266845 8:111842007-111842029 ACGTAAGTGCATTTAGAGGCTGG - Intergenic
1046970433 8:120216923-120216945 TATCAAGTGACTTCAGAGGCTGG - Intronic
1047201672 8:122772586-122772608 TTCTATGTGATTTTTGAGGCTGG - Intergenic
1048733892 8:137476167-137476189 TTTTAAGGTACTTTAGAGACGGG + Intergenic
1048810547 8:138281814-138281836 TTTTAAATTATTTTAGAGACAGG + Intronic
1049845082 8:144796692-144796714 TATTAAGGGAACTCAGAGGCTGG + Intergenic
1050153205 9:2638157-2638179 TTTTCAGTGATTTTAGAAACAGG + Intronic
1051033288 9:12709872-12709894 TTTTCAGCGAATTGAGAGGCAGG - Exonic
1051263139 9:15285556-15285578 TTTTAAAAGAATATACAGGCCGG + Intronic
1051593400 9:18799119-18799141 AGCTAAGTGAATTTAGAGGGAGG - Intronic
1055312424 9:74996873-74996895 TTTTAAGTGATTTTAAATGAAGG - Intronic
1059173030 9:112144599-112144621 TTTTAAGTTAATTTTAAGACAGG - Intronic
1060448222 9:123711757-123711779 TAATTAGTGATTTTAGAGGCAGG - Intronic
1061552559 9:131346234-131346256 TTTAAAGTTAATTTCGAGGTTGG - Intergenic
1061819122 9:133214785-133214807 TTTTAAGCACATTTTGAGGCTGG + Intergenic
1062241563 9:135543402-135543424 TTTTAAGCACATTTTGAGGCTGG - Intergenic
1186752115 X:12631979-12632001 TTTAATGTGAAATTAGAGGTTGG - Intronic
1187010582 X:15274321-15274343 TTTAAAATGCATTTTGAGGCTGG + Intergenic
1187061257 X:15789433-15789455 TTTAAAGTGCAGTTCGAGGCTGG - Intergenic
1189485970 X:41432142-41432164 TTTTAAATGAATTAATAGGCTGG - Intergenic
1189660648 X:43294173-43294195 TTTTAAGTAACTTTAGAACCTGG + Intergenic
1190997554 X:55624778-55624800 TGTTAAGTAAAGTTAGAGGTGGG + Exonic
1191800889 X:65077934-65077956 GTTTAGTTGAATTTAGAGGAAGG + Intergenic
1194928677 X:99861222-99861244 TTTTAAGACAAATTAGAGGAGGG + Intergenic
1195220944 X:102745414-102745436 TCTTAAGTGAATTCTGGGGCAGG - Intronic
1196369915 X:114965928-114965950 TTATAAGTGAATGTTCAGGCTGG - Intergenic
1197166665 X:123384869-123384891 TTTTAATTGCATATAGATGCTGG + Intronic
1197528437 X:127592148-127592170 TTTTATGGGAATTCAGAGGAGGG - Intergenic
1198720250 X:139609829-139609851 TTTTAAGTTTTTTTAGAGACAGG - Intronic
1198970362 X:142272264-142272286 CATGAAGTGATTTTAGAGGCTGG - Intergenic
1199256160 X:145720988-145721010 TATTAAGGGAACTCAGAGGCTGG - Intergenic
1200699770 Y:6392143-6392165 GTCTCAGTGAATTGAGAGGCAGG - Intergenic
1200780938 Y:7215025-7215047 TTTTAAATTTTTTTAGAGGCAGG - Intergenic
1201034341 Y:9772555-9772577 GTCTCAGTGAATTGAGAGGCAGG + Intergenic
1201184212 Y:11382997-11383019 TTTTAAGGGATGTTAGTGGCTGG - Intergenic
1202281842 Y:23198546-23198568 TTGTAAGTGAACTGTGAGGCAGG + Intronic
1202284049 Y:23219973-23219995 TTGTAAGTGAACTGTGAGGCAGG - Intronic
1202433514 Y:24812931-24812953 TTGTAAGTGAACTGTGAGGCAGG + Intronic
1202435725 Y:24834359-24834381 TTGTAAGTGAACTGTGAGGCAGG - Intronic